SNP (Single Nucleotide Polymorphism) molecular markers for hypoxia adaptation and genetic analysis of Himalayan marmot and application of SNP molecular markers

Abstract

The invention belongs to the technical field of molecular markers, and particularly relates to a group of SNP (Single Nucleotide Polymorphism) molecular markers for genetic analysis of hypoxia genes of Himalayan marmots and application of the SNP molecular markers. The SNP molecular marker comprises one or more than two of 11 SNP loci which are all located in an amplified fragment of a Himalayan marmot EPO gene with a nucleotide sequence as shown in SEQ ID NO.1, molecular technical support is provided for Himalayan marmot population genetics research, and the SNP molecular marker can be used for research on Himalayan marmot hypoxia adaptation, population evolution and the like. Moreover, the invention also provides a primer pair capable of identifying the SNP molecular marker, the primer pair can perform specific amplification on Himalayan marmot EPO hypoxia gene sequences of different geographical populations, has high polymorphism, can be applied to the research fields of Himalayan marmot environmental adaptation, genetic diversity, pedigree geography and the like, and has wide application prospects.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker technology, specifically relating to a set of SNP molecular markers for hypoxia adaptation and genetic analysis of Himalayan marmots and their applications. Background Technology

[0002] The EPO gene (erythropoietin gene) is a core genetic factor regulating erythrocyte production. It encodes erythropoietin (EPO), a glycoprotein hormone crucial for maintaining oxygen homeostasis. In particular, EPO acts as a "molecular switch" for hypoxia adaptation. By stimulating increased EPO gene expression, it promotes erythrocyte production, enhances blood oxygen-carrying capacity, and precisely regulates erythrocyte production, enabling animals to maintain oxygen homeostasis in hypoxic environments. Current research has found a close relationship between the EPO gene and the adaptation of plateau-specific organisms to high-altitude environments. For example, studies on Tibetan antelopes and plateau pikas have shown that EPO enhances cellular responses to EPO, increases erythrocyte production efficiency, promotes oxygen release, and provides energy metabolism for adaptation to hypoxic environments. Therefore, studying the adaptation of plateau-specific organisms to high-altitude environments through the EPO gene is of great significance for exploring adaptive evolution in organisms.

[0003] The Himalayan marmot (Marmota himalayana) belongs to the order Rodentia, family Sciuridae, and genus Marmota. It widely inhabits alpine meadows and grasslands at altitudes of 2700–5500 m, exhibiting a strip-like or beaded distribution on sunny and semi-sunny slopes of low mountains and hills, foothill plains, and along valley sides. Having thrived on the Qinghai-Tibet Plateau for generations, the marmot possesses a strong survival and reproductive capacity despite the high-altitude, low-oxygen partial pressure environment, making it an ideal experimental animal for studying hepatitis, cardiovascular diseases, and the mechanisms of adaptation to high-altitude hypoxia. However, there are currently no reports on research into the EPO gene of the Himalayan marmot. Summary of the Invention

[0004] The purpose of this invention is to provide molecular markers for the study of hypoxia adaptation and population dynamics in Himalayan marmots, providing molecular technical support for population genetics research on Himalayan marmots. To this end, this invention provides a set of SNP molecular markers for hypoxia adaptation and genetic analysis of Himalayan marmots and their applications.

[0005] This invention provides a set of SNP molecular markers for hypoxia adaptation and genetic analysis of Himalayan marmots. The SNP molecular markers include one or more of 11 SNP sites, all located within the amplified fragment of the Himalayan marmot EPO gene as shown in SEQ ID NO.1.

[0006] The SNP site includes the second position of the nucleotide sequence shown in SEQ ID NO.1, where the base of the nucleotide molecule is C or A;

[0007] The SNP site includes the 3rd position of the nucleotide sequence shown in SEQ ID NO.1, where the base of the nucleotide molecule is A or C;

[0008] The SNP site includes position 56 of the nucleotide sequence shown in SEQ ID NO.1, where the base of the nucleotide molecule is G or A;

[0009] The SNP site includes position 111 of the nucleotide sequence shown in SEQ ID NO.1, where the base of the nucleotide molecule is A or G;

[0010] The SNP site includes position 471 of the nucleotide sequence shown in SEQ ID NO.1, where the base of the nucleotide molecule is C or A;

[0011] The SNP site includes position 477 of the nucleotide sequence shown in SEQ ID NO.1, where the base of the nucleotide molecule is C or T;

[0012] The SNP site includes position 606 of the nucleotide sequence shown in SEQ ID NO.1, where the base of the nucleotide molecule is C or T;

[0013] The SNP site includes position 689 of the nucleotide sequence shown in SEQ ID NO.1, where the base of the nucleotide molecule is C or T;

[0014] The SNP site includes position 690 of the nucleotide sequence shown in SEQ ID NO.1, where the base of the nucleotide molecule is A or C;

[0015] The SNP site includes position 770 of the nucleotide sequence shown in SEQ ID NO.1, where the base of the nucleotide molecule is either T or C;

[0016] The SNP site includes position 803 of the nucleotide sequence shown in SEQ ID NO.1, where the base of the nucleotide molecule is either A or G.

[0017] The present invention also provides primer pairs for identifying the SNP molecular markers described in the above technical solutions, wherein the primer pairs include an upstream primer with a nucleotide sequence as shown in SEQ ID NO.2 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.3.

[0018] The present invention also provides a kit comprising the primer pairs described in the above technical solutions.

[0019] This invention also provides the application of the SNP molecular markers, primer pairs, or kits described in the above-described technical solutions in the analysis of the genetic structure and genetic diversity of Himalayan marmot populations.

[0020] This invention also provides a method for analyzing the genetic structure and genetic diversity of Himalayan marmot populations, the method comprising the following steps:

[0021] Using the genomic DNA of the individual Malayan marmot to be tested as a template, PCR amplification was performed using the primer pairs described in the above technical solution to obtain the amplification product;

[0022] The amplified products are analyzed and identified to determine the population genetic structure and / or genetic diversity of the sample to be tested.

[0023] Preferably, the PCR amplification reaction program is as follows: pre-denaturation at 94°C for 2 min; 35 cycles of amplification reaction, each cycle including denaturation at 94°C for 40 s, annealing at 58°C for 30 s, extension at 72°C for 2 min; and final extension at 72°C for 10 min, followed by maintenance at 4°C until removal.

[0024] Preferably, the analysis and identification include cloning and sequencing and / or agarose gel electrophoresis detection of the obtained amplification products.

[0025] Preferably, the genomic DNA is extracted from the liver and / or muscle tissue of the sample to be tested.

[0026] The present invention also provides the application of the method described in the above technical solution in identifying the EPO gene haplotype of Himalayan marmot, wherein the nucleotide sequence of the EPO gene haplotype of Himalayan marmot is shown in SEQ ID NO.4 to SEQ ID NO.18.

[0027] This invention also provides the application of the SNP molecular markers, primer pairs, or kits described in the above-mentioned technical solutions in the study of hypoxia adaptation of Himalayan marmots on the plateau or in the study of the transmission mechanism of natural focal diseases.

[0028] Beneficial effects:

[0029] This invention provides a set of SNP molecular markers for hypoxia adaptation and genetic analysis of Himalayan marmots. The SNP molecular markers include one or more of 11 SNP sites, all located within the amplified fragment of the Himalayan marmot EPO gene as shown in SEQ ID NO.1. Specifically, the nucleotide bases at the following locations are: C or A at 2 bp, A or C at 3 bp, G or A at 56 bp, A or G at 111 bp, C or A at 471 bp, C or T at 606 bp, C or T at 689 bp, A or C at 690 bp, T or C at 770 bp, and A or G at 803 bp. The SNP molecular markers described in this invention provide molecular technical support for population genetics research of Himalayan marmots. They can be used to study the genetic diversity and population evolution of Himalayan marmots in response to hypoxia, and provide scientific data for exploring the pathways of rodents' adaptation to hypoxia on the plateau and for in-depth research on the hypoxia adaptation mechanisms of native animals on the Qinghai-Tibet Plateau.

[0030] Furthermore, this invention provides primer pairs capable of identifying the aforementioned SNP molecular markers, specifically including an upstream primer with the nucleotide sequence shown in SEQ ID NO.2 and a downstream primer with the nucleotide sequence shown in SEQ ID NO.3. The EPO hypoxia gene (EPO) primer pair provided by this invention can specifically amplify the EPO hypoxia gene sequence of Himalayan marmots from different geographical populations, and exhibits high polymorphism. It can be applied to research fields such as environmental adaptation, genetic diversity, and phylogenetics of Himalayan marmots, showing broad application prospects. It is beneficial for us to gain a deeper understanding of the formation mechanism of human high-altitude adaptation from a genetic perspective, and provides new research ideas and strategies for deepening our understanding of the pathogenesis of high-altitude diseases and for treating and preventing their occurrence. Attached Figure Description

[0031] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0032] Figure 1 Electrophoresis image of the EPO gene of the Himalayan marmot;

[0033] Figure 2 This is a diagram of the median-joining haplotype network constructed based on the EPO gene;

[0034] Figure 3 This is a map showing the distribution of Himalayan marmot populations at different points. Detailed Implementation

[0035] This invention provides a set of SNP molecular markers for hypoxia adaptation and genetic analysis of Himalayan marmots. The SNP molecular markers include one or more of 11 SNP sites, all located within the amplified fragment of the Himalayan marmot EPO gene as shown in SEQ ID NO.1. Specifically, SEQ ID NO.1 is:

[0036] The length is 810bp.

[0037] The SNP site includes the second position of the nucleotide sequence shown in SEQ ID NO.1, where the base of the nucleotide molecule is C or A;

[0038] The SNP site includes the 3rd position of the nucleotide sequence shown in SEQ ID NO.1, where the base of the nucleotide molecule is A or C;

[0039] The SNP site includes position 56 of the nucleotide sequence shown in SEQ ID NO.1, where the base of the nucleotide molecule is G or A;

[0040] The SNP site includes position 111 of the nucleotide sequence shown in SEQ ID NO.1, where the base of the nucleotide molecule is A or G;

[0041] The SNP site includes position 471 of the nucleotide sequence shown in SEQ ID NO.1, where the base of the nucleotide molecule is C or A;

[0042] The SNP site includes position 477 of the nucleotide sequence shown in SEQ ID NO.1, where the base of the nucleotide molecule is C or T;

[0043] The SNP site includes position 606 of the nucleotide sequence shown in SEQ ID NO.1, where the base of the nucleotide molecule is C or T;

[0044] The SNP site includes position 689 of the nucleotide sequence shown in SEQ ID NO.1, where the base of the nucleotide molecule is C or T;

[0045] The SNP site includes position 690 of the nucleotide sequence shown in SEQ ID NO.1, where the base of the nucleotide molecule is A or C;

[0046] The SNP site includes position 770 of the nucleotide sequence shown in SEQ ID NO.1, where the base of the nucleotide molecule is either T or C;

[0047] The SNP site includes position 803 of the nucleotide sequence shown in SEQ ID NO.1, where the base of the nucleotide molecule is either A or G.

[0048] In one embodiment, the SNP molecular markers of the present invention are used to define haplotypes selected from any sequence in SEQ ID NO.4 to SEQ ID NO.18.

[0049] The nucleotide sequence shown in SEQ ID NO.4 of this invention corresponds to haplotype Hap_1, specifically as follows:

[0050] agagttgcacaaagtatcgacagtgaatgtccggagtggagcagcagaggctgcatctggaggcaagacggcttccctctgccaggaaagaacaggaggttactgtagtgctggggaccccaaatggaaatgggatcagggacagcattggtggggggatgaggaaggcccccagtatttcttggcaggatgttttccccagcttacagaaagagcaaggagaagtgtccacacccccttctacacacctggactcccatcgctcggagcagggaggtgaggctgcgcaggccactgacagctttgtccacgtgcagtcgcagagtatctgatggctgggaggagttggccagcagggcctggctctgcagaatggcttctgagagcagggccaggccttgccagacttctacagcctgctgcccaacctagagggaacagagacttggagtcaggaggcccaagtgacctcttgcccctccctcccagcagctccatgcaccaaacagagcaaacagaaagtacgcaagaaggtgtgttggatacgaataacaaatgaatgagtgaacatattcctttctccatttcttttctattgttttctcttccaccccgtgagggtctcaaaatgagagccccctcaagaaggaggaaaagacaaactcacctcctttctcctccaggcatagaagttaaccttggtgtctgggacggtgatattctcactcaggctgcagccatctgcacagcccatctgaaaaacatagcccaggagtcaggacccccaagggctctggtcctgggccccag。

[0051] The nucleotide sequence shown in SEQ ID NO.5 of the present invention corresponds to haplotype Hap_2, specifically:

[0052] gaagagtttgcacaaagtatcgacagtgaatgtccggagtggagcagcagaggctgcatctggaggcaagacggcttccctctgccaggaaagaacaggaggttactgtagtgctggggaccccaaatggaaatgggatcagggacagcattggtggggggatgaggaaggcccccagtatttcttggcaggatgttttccccagcttacagaaagagcaaggagaagtgtccacacccccttctacacacctggactcccatcgctcggagcagggaggtgaggctgcgcaggccactgacagctttgtccacgtgcagtcgcagagtatctgatggctgggaggagttggccagcagggcctggctctgcagaatggcttctgagagcagggccaggccttgccagacttctacagcctgctgcccaacctagagggaacagagacttggagtcaggaggcccaagtgacctcttgcccctccctcccagcagctccatgcaccaaacagagcaaacagaaagtacgcaagaaggtgtgttggatacgaataacaaatgaatgagtgaacatattcctttctccatttcttttctattgttttctcttccaccccgtgagggtctcaaaatgagagccccctcaagaaggaggaaaagacaaactcacctcctttctcctccaggcatagaagttaaccttggtgtctgggacggtgatattctcactcaggctgcagccatctgcacagcccatctgaaaaacatagcccaggagtcaggacccccaagggctctggtcctgggccc。

[0053] The nucleotide sequence shown in SEQ ID NO.6 of the present invention corresponds to haplotype Hap_3, specifically:

[0054] aattctgaagagtttgcacaaagtatcgacagtgaatgtccggagtggagcagcagaggctgcatctggaggcaagacggcttccctctgccaggaaagaacaggaggttactgtagtgctggggaccccaaatggaaatgggatcagggacagcattggtggggggatgaggaaggcccccagtatttcttggcaggatgttttccccagcttacagaaagagcaaggagaagtgtccacacccccttctacacacctggactcccatcgctcggagcagggaggtgaggctgcgcaggccactgacagctttgtccacgtgcagtcgcagagtatctgatggctgggaggagttggccagcagggcctggctctgcagaatggcttctgagagcagggccaggccttgccagacttctacagcctgctgcccaacctagagggaacagagacttggagtcaggaggcccaagtgacctcttgcccctccctcccagcagctccatgcaccaaacagagcaaacagaaagtacgcaagaaggtgtgttggatacgaataacaaatgaatgagtgaacatattcctttctccatttcttttctattgttttctcttccactccgtgagggtctcaaaatgagagccccctcaagaaggaggaaaagacaaactcacctcctttctcctccaggcatagaagttaaccttggtgtctgggacggtgatattctcactcaggctgcagccatctgcacagcccatctgaaaaacatagcccaggagtcaggacccccaagggctctggtcct。

[0055] The nucleotide sequence shown in SEQ ID NO.7 of the present invention corresponds to haplotype Hap_4, specifically:

[0056] gaagagtttgcacaaagtatcgacagtgaatgtccggagtggagcagcagaggctgcatctggaagcaagacggcttccctctgccaggaaagaacaggaggttactgtagtgctggggaccccaaatggaaatgggatcagggacagcattggtggggggatgaggaaggcccccagtatttcttggcaggatgttttccccagcttacagaaagagcaaggagaagtgtccacacccccttctacacacctggactcccatcgctcggagcagggaggtgaggctgcgcaggccactgacagctttgtccacgtgcagtcgcagagtatctgatggctgggaggagttggccagcagggcctggctctgcagaatggcttctgagagcagggccaggccttgccagacttctacagcctgctgcccaacctagagggaacagagacttggagtcaggaggcccaagtgacctcttgcccctccctcccagcagctccatgcaccaaacagagcaaacagaaagtacgcaagaaggtgtgttggatacgaataacaaatgaatgagtgaacatattcctttctccatttcttttctattgttttctcttccaccccgtgagggtctcaaaatgagagccccctcaagaaggaggaaaagacaaactcacctcctttctcctccaggcatagaagttaaccttggtgtctgggacggtgatattctcactcaggctgcagccatctgcacagcccatctgaaaaacatagcccaggagtcaggacccccaagggctctggtcctggtcct。

[0057] The nucleotide sequence shown in SEQ ID NO.8 of the present invention corresponds to haplotype Hap_5, specifically:

[0058] ctggagtggcaagtatcgacagtgaatgtccggagtggagcagcagaggctgcatctggaggcaagacggcttccctctgccaggaaagaacaggaggttactgtagtgctggggaccccaaatggaaatgggatcagggacagcattggtggggggatgaggaaggcccccagtatttcttggcaggatgttttccccagcttacagaaagagcaaggagaagtgtccacacccccttctacacacctggactcccatcgctcggagcagggaggtgaggctgcgcaggccactgacagctttgtccacgtgcagtcgcagagtatctgatggctgggaggagttggccagcagggcctggctctgcagaatggcttctgagagcagggccaggccttgccagacttctacagcctgctgcccaacctagagggaacagagacttggagtcaggaggcccaagtgacctcttgcccctccctcccagcagctccatgcaccaaacagagcaaacagaaagtacgcaagaaggtgtgttggatacgaataacaaatgaatgagtgaacatattcctttctccatttcttttctattgttttctcttccaccccgtgagggtctcaaaatgagagccccctcaagaaggaggaaaagacaaactcacctcctttctcctccaggcatagaagttacccttggtgtctgggacggtgatattctcactcaggctgcagccatctgcacagcccatctgaaaaacatagcccaggagtcaggacccccaagggctctggtcctgggccccagg。

[0059] The nucleotide sequence shown in SEQ ID NO.9 of the present invention corresponds to haplotype Hap_6, specifically:

[0060] gagttgcacaaagtatcgacagtgaatgtccggagtggagcagcagaggctgcatctggaggcaagacggcttccctctgccaggaaagaacaggaggttactgtagtgctggggaccccaaatggaaatgggatcagggacagcattggtggggggatgaggaaggcccccagtatttcttggcaggatgttttccccagcttacagaaagagcaaggagaagtgtccacacccccttctacacacctggactcccatcgctcggagcagggaggtgaggctgcgcaggccactgacagctttgtccacgtgcagtcgcagagtatctgatggctgggaggagttggccagcagggcctggctctgcagaatggcttctgagagcagggccaggccttgccagacttctacagcctgctgcccaacctagagggaacagagacttggagtcaggaggcccaagtgacctcttgcccctccttcccagcagctccatgcaccaaacagagcaaacagaaagtacgcaagaaggtgtgttggatacgaataacaaatgaatgagtgaacatattcctttctccatttcttttctattgttttctcttccaccccgtgagggtctcaaaatgagagccccctcaagaaggaggaaaagacaaactcacctcctttctcctccaggcatagaagttaaccttggtgtctgggacggtgatattctcactcaggctgcagccatctgcacagcccatctgaaaaacatagcccaggagtcaggacccccaagggctctggtcctgggccccagg。

[0061] The nucleotide sequence shown in SEQ ID NO.10 of the present invention corresponds to haplotype Hap_7, specifically:

[0062] ttgaagagtttgcacaaagtatcgacagtgaatgtccggagtggagcagcagaggctgcatctggaggcaagacggcttccctctgccaggaaagaacaggaggttactgtagtgctggggaccccaaatggaaatgggatcagggacagcattggtggggggatgaggaaggcccccagtatttcttggcaggatgttttccccagcttacagaaagagcaaggagaagtgtccacacccccttctacacacctggactcccatcgctcggagcagggaggtgaggctgcgcaggccactgacagctttgtccacgtgcagtcgcagagtatctgatggctgggaggagttggccagcagggcctggctctgcagaatggcttctgagagcagggccaggccttgccagacttctacagcctgctgcccaacctagagggaacagagacttggagtcaggaggcccaagtgacctcttgcccctccttcccagcagctccatgcaccaaacagagcaaacagaaagtacgcaagaaggtgtgttggatacgaataacaaatgaatgagtgaacatattcctttctccatttcttttctattgttttctcttccaccccgtgagggtctcaaaatgagagccccctcaagaaggaggaaaagacaaactcacctcctttctcctccaggcatagaagttaaccttggtgtctgggacggtgatattctcactcaggctgcagccatctgcacagcccatctgaaaaacatagcccaggagtcaggacccccaagggctctggtcctgggc。

[0063] The nucleotide sequence shown in SEQ ID NO.11 of the present invention corresponds to haplotype Hap_8, specifically:

[0064] atgaaattgaagagttgcacaaagtatcgacagtgaatgtccggagtggagcagcagaggctgcatctggaagcaagacggcttccctctgccaggaaagaacaggaggttactgtagtgctggggaccccaaatggaaatgggatcagggacagcattggtggggggatgaggaaggcccccagtatttcttggcaggatgttttccccagcttacagaaagagcaaggagaagtgtccacacccccttctacacacctggactcccatcgctcggagcagggaggtgaggctgcgcaggccactgacagctttgtccacgtgcagtcgcagagtatctgatggctgggaggagttggccagcagggcctggctctgcagaatggcttctgagagcagggccaggccttgccagacttctacagcctgctgcccaacctagagggaacagagacttggagtcaggaggcccaagtgacctcttgcccctccctcccagcagctccatgcaccaaacagagcaaacagaaagtacgcaagaaggtgtgttggatacgaataacaaatgaatgagtgaacatattcctttctccatttcttttctattgttttctcttccaccccgtgagggtctcaaaatgagagccccctcaagaaggaggaaaagacaaactcacctcctttctcctccaggcatagaagttacccttggtgtctgggacggtgatattctcactcaggctgcagccatctgcacagcccatctgaaaaacatagcccaggagtcaggacccccaagggctctggtcc。

[0065] The nucleotide sequence shown in SEQ ID NO.12 of the present invention corresponds to haplotype Hap_9, specifically:

[0066] atggtaatcgaagagttgcacaaagtatcgacagtgaatgtccggagtggagcagcagaggctgcatctggaggcaagacggcttccctctgccaggaaagaacaggaggttactgtagtgctgggggccccaaatggaaatgggatcagggacagcattggtggggggatgaggaaggcccccagtatttcttggcaggatgttttccccagcttacagaaagagcaaggagaagtgtccacacccccttctacacacctggactcccatcgctcggagcagggaggtgaggctgcgcaggccactgacagctttgtccacgtgcagtcgcagagtatctgatggctgggaggagttggccagcagggcctggctctgcagaatggcttctgagagcagggccaggccttgccagacttctacagcctgctgcccaacctagagggaacagagacttggagtcaggaggcccaagtgacctcttgcccctccctcccagcagctccatgcaccaaacagagcaaacagaaagtacgcaagaaggtgtgttggatacgaataacaaatgaatgagtgaacatattcctttctccatttcttttctattgttttctcttccaccccgtgagggtctcaaaatgagagccccctcaagaaggaggaaaagacaaactcacctcctttctcctccaggcatagaagttacccttggtgtctgggacggtgatattctcactcaggctgcagccatctgcacagcccatctgaaaaacatagcccaggagtcaggacccccaagggctctggtc。

[0067] The nucleotide sequence shown in SEQ ID NO.13 of the present invention corresponds to haplotype Hap_10, specifically:

[0068] attctgaagagtttgcacaaagtatcgacagtgaatgtccggagtggagcagcagaggctgcatctggaggcaagacggcttccctctgccaggaaagaacaggaggttactgtagtgctggggaccccaaatggaaatgggatcagggacagcattggtggggggatgaggaaggcccccagtatttcttggcaggatgttttccccagcttacagaaagagcaaggagaagtgtccacacccccttctacacacctggactcccatcgctcggagcagggaggtgaggctgcgcaggccactgacagctttgtccacgtgcagtcgcagagtatctgatggctgggaggagttggccagcagggcctggctctgcagaatggcttctgagagcagggccaggccttgccagacttctacagcctgctgcccaacctagagggaacagagacttggagtcaggaggcccaagtgacctcttgcccctccctcccagcagctccatgcaccaaacagagcaaacagaaagtacgcaagaaggtgtgttggatacgaataacaaatgaatgagtgaacatattcctttctccatttcttttctattgttttctcttccactccgtgagggtctcaaaatgagagccccctcaagaaggaggaaaagacaaactcacctcctttctcctccaggcatagaagttaaccttggtgtctgggacggtgatattctcactcaggctgcagccatctgcacagcccatctgaaaaacatagcccaggagtcaggacccccaagggctctggtcctg。

[0069] The nucleotide sequence shown in SEQ ID NO.14 of the present invention corresponds to haplotype Hap_11, specifically:

[0070] atttgaagagtttgcacaaagtatcgacagtgaatgtccggagtggagcagcagaggctgcatctggaagcaagacggcttccctctgccaggaaagaacaggaggttactgtagtgctggggaccccaaatggaaatgggatcagggacagcattggtggggggatgaggaaggcccccagtatttcttggcaggatgttttccccagcttacagaaagagcaaggagaagtgtccacacccccttctacacacctggactcccatcgctcggagcagggaggtgaggctgcgcaggccactgacagctttgtccacgtgcagtcgcagagtatctgatggctgggaggagttggccagcagggcctggctctgcagaatggcttctgagagcagggccaggccttgccagacttctacagcctgctgcccaacctagagggaacagagacttggagtcaggaggcccaagtgacctcttgcccctccctcccagcagctccatgcaccaaacagagcaaacagaaagtacgcaagaaggtgtgttggatacgaataacaaatgaatgagtgaacatattcctttctccatttcttttctattgttttctcttccaccccgtgagggtctcaaaatgagagccccctcaagaaggaggaaaagacaaactcacctcctttctcctccaggcatagaagttaaccttggtgtctgggacggtgatattctcactcaggctgcagccatctgcacagcccatctgaaaaacatagcccaggagtcaggacccccaagggctctggtcctgg。

[0071] The nucleotide sequence shown in SEQ ID NO.15 of the present invention corresponds to haplotype Hap_12, specifically:

[0072] attctgaagagtttgcacaaagtatcgacagtgaatgtccggagtggagcagcagaggctgcatctggaagcaagacggcttccctctgccaggaaagaacaggaggttactgtagtgctggggaccccaaatggaaatgggatcagggacagcattggtggggggatgaggaaggcccccagtatttcttggcaggatgttttccccagcttacagaaagagcaaggagaagtgtccacacccccttctacacacctggactcccatcgctcggagcagggaggtgaggctgcgcaggccactgacagctttgtccacgtgcagtcgcagagtatctgatggctgggaggagttggccagcagggcctggctctgcagaatggcttctgagagcagggccaggccttgccagacttctacagcctgctgcccaacctagagggaacagagacttggagtcaggaggcccaagtgacctcttgcccctccctcccagcagctccatgcaccaaacagagcaaacagaaagtacgcaagaaggtgtgttggatacgaataacaaatgaatgagtgaacatattcctttctccatttcttttctattgttttctcttccaccccgtgagggtctcaaaatgagagccccctcaagaaggaggaaaagacaaactcacctcctttttcctccaggcatagaagttaaccttggtgtctgggacggtgatattctcactcaggctgcagccatctgcacagcccatctgaaaaacatagcccaggagtcaggacccccaagggctctggtcctg。

[0073] The nucleotide sequence shown in SEQ ID NO.16 of the present invention corresponds to the haplotype Hap_13, specifically:

[0074] agtgaccaaagtatcgacagtgaatgtccggagtggagcagcagaggctgcatctggaggcaagacggcttccctctgccaggaaagaacaggaggttactgtagtgctggggaccccaaatggaaatgggatcagggacagcattggtggggggatgaggaaggcccccagtatttcttggcaggatgttttccccagcttacagaaagagcaaggagaagtgtccacacccccttctacacacctggactcccatcgctcggagcagggaggtgaggctgcgcaggccactgacagctttgtccacgtgcagtcgcagagtatctgatggctgggaggagttggccagcagggcctggctctgcagaatggcttctgagagcagggccaggccttgccagacttctacagcctgctgcccaacctagagggaacagagacttggagtcaggaggcccaagtgacctcttgcccctccctcccagcagctccatgcaccaaacagagcaaacagaaagtacgcaagaaggtgtgttggatacgaataacaaatgaatgagtgaacatattcctttctccatttcttttctattgttttctcttccaccccgtgagggtctcaaaatgagagccccctcaagaaggaggaaaagacaaactcacctcctttctcctccaggcatagaagttaaccttggtgtctgggacggtgatattctcactcaggctgcagccatctgcacagcccatctgaaaaacatagcccaggagtcaggacccccaagggctctggtcctgggcccccaggc。

[0075] The nucleotide sequence shown in SEQ ID NO.17 of the present invention corresponds to haplotype Hap_14, specifically:

[0076] ctgaagagtttgcacaaagtatcgacagtgaatgtccggagtggagcagcagaggctgcatctggaggcaagacggcttccctctgccaggaaagaacaggaggttactgtagtgctggggacccccaaatggaaatgggatcagggacagcattggtggggggatgaggaaggcccccagtatttcttggcaggatgttttccccagcttacagaaagagcaaggagaagtgtccacacccccttctacacacctggactcccatcgctcggagcagggaggtgaggctgcgcaggccactgacagctttgtccacgtgcagtcgcagagtatctgatggctgggaggagttggccagcagggcctggctctgcagaatggcttctgagagcagggccaggccttgccagacttctacagcctgctgcccaacctagagggaacagagacttggagtcaggaggcccaagtgacctcttgcccctccctcccagcagctccatgcaccaaacagagcaaacagaaagtacgcaagaaggtgtgttggatacgaataacaaatgaatgagtgaacatattcctttctccatttcttttctattgttttctcttccaccccgtgagggtctcaaaatgagagccccctcaagaaggaggaaaagacaaactcacctcctttctcctccaggcatagaagttaaccttggtgtctgggacggtgatattctcactcaggctgcagccatctgcacagcccatctgaaaaacatagcccaggagccaggacccccaagggctctggtcctggg。

[0077] The nucleotide sequence shown in SEQ ID NO.18 of the present invention corresponds to haplotype Hap_15, specifically:

[0078] attctgaagagtttgcacaaagtatcgacagtgaatgtccggagtggagcagcagaggctgcatctggaggcaagacggcttccctctgccaggaaagaacaggaggttactgtagtgctggggaccccaaatggaaatgggatcagggacagcattggtggggggatgaggaaggcccccagtatttcttggcaggatgttttccccagcttacagaaagagcaaggagaagtgtccacacccccttctacacacctggactcccatcgctcggagcagggaggtgaggctgcgcaggccactgacagctttgtccacgtgcagtcgcagagtatctgatggctgggaggagttggccagcagggcctggctctgcagaatggcttctgagagcagggccaggccttgccagacttctacagcctgctgcccaacctagagggaacagagacttggagtcaggaggcccaagtgacctcttgcacctccctcccagcagctccatgcaccaaacagagcaaacagaaagtacgcaagaaggtgtgttggatacgaataacaaatgaatgagtgaacatattcctttctccatttcttttctattgttttctcttccaccccgtgagggtctcaaaatgagagccccctcaagaaggaggaaaagacaaactcacctcctttctcctccaggcatagaagttaaccttggtgtctgggacggtgatattctcactcaggctgcagccatctgcacagcccatctgaaaaacatagcccaggagtcaggacccccaagggctctggtcctg。

[0079] The present invention also provides a primer pair for identifying the SNP molecular marker described in the above technical solution.

[0080] In one embodiment, the primer pair of the present invention includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.2 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.3. Specifically, SEQ ID NO.2 of the present invention is 5'-CCCGGAGGAAATTGGAGTAA-3'; and SEQ ID NO.3 of the present invention is 5'-TAAGGGGCAAAGCAAGAGTG-3'.

[0081] This invention also provides a kit containing the primer pairs described in the above-described technical solutions. As one embodiment, the kit of this invention further includes reagents for PCR amplification and / or reagents for PCR product cloning and sequencing. As one embodiment, the kit of this invention further includes agarose gel electrophoresis detection reagents. As one embodiment, the kit of this invention can detect one or more of the 11 SNP sites described in the above-described technical solutions.

[0082] This invention also provides the application of the SNP molecular markers, primer pairs, or kits described in the above-mentioned technical solutions in the analysis of the genetic structure and genetic diversity of Himalayan marmot populations. As one embodiment, the SNP molecular markers of this invention provide molecular technical support for the genetic research of Himalayan marmot populations, and can be used for studies on the genetic diversity and population evolution of Himalayan marmots' hypoxia adaptation, providing scientific data for exploring the pathways of rodent hypoxia adaptation to high altitudes and for in-depth research on the hypoxia adaptation mechanisms of native animals on the Qinghai-Tibet Plateau. As another embodiment, the primer pairs or kits of this invention can specifically amplify the EPO hypoxia gene sequence of Himalayan marmots from different geographical populations, and exhibit high polymorphism. They can be applied to research fields such as environmental adaptation, genetic diversity, and phylogenetics of Himalayan marmots, with broad application prospects. This is beneficial for us to deeply understand the formation mechanism of human high-altitude adaptation from a genetic perspective, and provides new research ideas and strategies for deepening our understanding of the pathogenesis of high-altitude diseases and for treating and preventing their occurrence. As yet another embodiment, the molecular markers, primer pairs, or kits of this invention can quantify population diversity. As one implementation, the quantification of population diversity according to the present invention includes calculating population genetic diversity parameters, including haplotype diversity (Hd), nucleotide diversity (Pi), average number of nucleotide differences (K), genetic distance between populations, and genetic differentiation coefficient (FST).

[0083] This invention also provides a method for analyzing the genetic structure and genetic diversity of Himalayan marmot populations, the method comprising the following steps:

[0084] Using the genomic DNA of the individual Malayan marmot to be tested as a template, PCR amplification was performed using the primer pairs described in the above technical solution to obtain the amplification product;

[0085] The amplified products are analyzed and identified to determine the population genetic structure and / or genetic diversity of the sample to be tested.

[0086] This invention uses genomic DNA from a Malayan marmot as a template and performs PCR amplification using the primer pairs described in the above-described technical solution to obtain amplified products. As one embodiment, the genomic DNA is extracted from the liver and / or muscle tissue of the sample to be tested. As one embodiment, the total reaction volume of the PCR amplification in this invention is 25.0 μL, including 12.5 μL of 2x Taq PCRMaster Mix, 0.5 mM each of the upstream and downstream primers described in the above-described technical solution, 1.0 μL of DNA template, and ddH2O to make up to 25.0 μL of reaction system. As one embodiment, the PCR amplification reaction program of this invention is as follows: pre-denaturation at 94℃ for 2 min; 35 cycles of amplification reaction, each cycle including denaturation at 94℃ for 40 s, annealing at 58℃ for 30 s, extension at 72℃ for 2 min; final extension at 72℃ for 10 min, and maintenance at 4℃ until removal.

[0087] After obtaining the amplification products, this invention analyzes and identifies them to determine the population genetic structure and / or genetic diversity of the sample to be tested. As one embodiment, the analysis and identification described in this invention includes cloning and sequencing and / or agarose gel electrophoresis detection of the obtained amplification products.

[0088] This invention also provides the application of the method described above in identifying the EPO gene haplotype of the Himalayan marmot, characterized in that the nucleotide sequence of the Himalayan marmot EPO gene haplotype is shown in SEQ ID NO.4 to SEQ ID NO.18. As one embodiment, the steps of the application of this invention include: using the genomic DNA of the Himalayan marmot individual to be tested as a template, performing PCR amplification using the primer pair described in claim 2 to obtain the amplification product; performing high-throughput sequencing analysis on the obtained amplification product to determine the EPO gene haplotype of the sample to be tested.

[0089] This invention also provides the application of the SNP molecular markers, primer pairs, or kits described in the above-mentioned technical solutions in the study of hypoxia adaptation of Himalayan marmots on the plateau or in the study of the transmission mechanism of natural focal diseases.

[0090] To further illustrate the present invention, the following detailed description, in conjunction with the accompanying drawings and embodiments, describes a set of SNP molecular markers provided by the present invention for hypoxia adaptation and genetic analysis of Himalayan marmots and their applications, but these should not be construed as limiting the scope of protection of the present invention.

[0091] The experimental methods not specified in the embodiments of the present invention are conventional methods and conditions well known in the art, or are performed according to the manufacturer's recommended conditions; all chemical reagents used in the embodiments are commercially available, and the primers used are obtained through commissioned synthesis.

[0092] Example 1

[0093] A kit comprising the following reagents:

[0094] The components of the kit of the present invention include:

[0095] (1) PCR amplification reagents: containing the primer pairs shown in SEQ ID NO: 1 and 2;

[0096] (2) Polymorphism detection reagents.

[0097] Example 2

[0098] Himalayan marmot EPO hypoxia gene polymorphism primer design

[0099] 1. Extraction and detection of total genomic DNA

[0100] Genomic total DNA was extracted from Himalayan marmots (sampling site: Nangqian County, Yushu Prefecture, Qinghai Province, longitude 96.15548°N, latitude 32.57023°E, altitude: 3600–3800 meters, ID: YS26) using the Qiager DNeasy Blood & Tissue Kit. The extracted genomic total DNA was quantitatively and qualitatively analyzed using 1% agarose gel electrophoresis and a Nanodrop 2000C spectrophotometer. DNA samples meeting the following criteria were selected for further processing:

[0101] ① The total volume of extracted genomic DNA was 150 μL;

[0102] ②The electrophoresis results show a bright main band with an indistinct tail;

[0103] ③ The spectrophotometer readings showed a concentration of 67.8 ng / μL and an OD260 / 280 of 2.02;

[0104] ④ The DNA quality meets the requirements for simplified genome sequencing.

[0105] 2. Primer design for the EPO hypoxia gene sequence of Himalayan marmot

[0106] Based on the complete EPO gene sequence of the house mouse provided by Wilson MD et al. (2016) in NCBI (accession number: AF312033.1), and using Primer 5.0 software and online primer design software, sequences with suitable amplification fragment length and range, similar GC content, absence of hairpin structures, and dimers were selected as PCR primers for partial fragments of the Himalayan marmot EPO gene. Finally, a pair of polymorphic Himalayan marmot EPO hypoxia gene molecular marker-specific primers was determined. The primer sequences are shown in Table 1. The primers were synthesized by Shanghai Sangon Biotech Co., Ltd., dissolved in ultrapure water to a concentration of 10 μmol / L, and stored at 4℃.

[0107] Table 1. Specific sequences of a pair of primers for the EPO hypoxia gene polymorphism in Himalayan marmots.

[0108]

[0109]

[0110] Example 3

[0111] Hypoxia adaptation and genetic analysis of EPO hypoxia gene polymorphism in Himalayan marmots

[0112] 1. PCR amplification system and reaction conditions

[0113] The total reaction volume was 25.0 μL, including 12.5 μL of 2xTaqPCRMaster Mix, 0.5 mM each of the upstream and downstream primers obtained in Example 2, 1.0 μL of DNA template (20 ng to 50 g), and ddH2O to make up to 25.0 μL of the reaction system.

[0114] PCR reaction conditions: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 40 s, 58℃ annealing for 30 s, 72℃ extension for 2 min, for a total of 35 cycles; final extension at 72℃ for 10 min, and storage at 4℃.

[0115] 2. Himalayan marmot EPO hypoxia gene sequencing

[0116] The PCR amplification products were detected by electrophoresis on a 1.5% agarose gel, yielding the following results: Figure 1The electrophoresis image of the Himalayan marmot EPO gene shown is free of extraneous bands, indicating good specificity. PCR amplification products with bright bands and acceptable concentrations were selected and sent to Sangon Biotech (Beijing) Co., Ltd. for sequencing. The peak diagram obtained from sequencing was viewed using Chromos 2 software to assess sequencing quality, and the accuracy of the sequence bases was checked using the peak diagram. Corrections were made using bidirectional sequencing. The color image was manually verified to ensure accurate base interpretation. The obtained assembled sequence was run on NCBI using the BLAST program for sequence homology comparison to ensure that the obtained sequence was the target sequence. The sequencing results were then analyzed and compared using BLAST.

[0117] The comparison results showed that EPO had 100% similarity to the partial mRNA of Marmota marmota marmot (GenBank accession number: XM_015490709.1) and the whole EPO gene (length 1220bp), and 75% similarity to the whole EPO gene of Susscrofa (GenBank accession number: AJ249746.1) (length 3874bp).

[0118] Example 4

[0119] EPO gene base composition and polymorphism analysis

[0120] The same methods as in Examples 2 and 3 were used to perform sequence analysis and phylogenetic tree construction on the EPO gene of Himalayan marmots from different altitude ranges and geographical populations. The sequences obtained in this invention were aligned using MAFFT software, and primers at both ends and irregular sequences were removed. The average genetic distance within and between populations was calculated using the Kimura2-parameter model on Mega 6.0 after alignment, and a haplotype NJ phylogenetic tree of the EPO gene was constructed. The confidence level of each branch was tested using a 1000-times bootstrapping test. Variable sites and single nucleotide polymorphisms were analyzed using Dnasp 5.0 software, and haplotype diversity, nucleotide diversity, and the average number of nucleotide differences (K) between haplotypes were calculated. The degree of genetic differentiation between populations was measured using the factor of fixation (FST).

[0121] 1. Sample Information

[0122] To study the genetic diversity of EPO genes in Himalayan marmots at different altitudes and geographical populations, the sources of Himalayan marmot samples collected in this invention are shown in Table 2.

[0123] Table 2. Geographical Population Information of Himalayan Marmots

[0124]

[0125]

[0126] 2. Sequence characteristics and polymorphism results

[0127] By comparing the EPO gene of 203 Himalayan marmots from different regions of Qinghai Province, the effective sequence length was 804 bp. Comparison of the nucleotide sequences revealed 11 variant sites, with a variant rate of 1.37%. These 11 variant sites are: C→A at 2 bp, A→C at 3 bp, G→A at 56 bp, A→G at 111 bp, C→A at 471 bp, C→T at 477 bp, C→T at 606 bp, C→T at 689 bp, A→C at 690 bp, T→C at 770 bp, and A→G at 803 bp. Insertions and deletions are not considered. Detailed results are shown in Table 3. Five parsimony information sites were identified. There were 11 transition sites and 0 transversion sites. The transition modes were predominantly CT (4 sites) and GA (4 sites), with AG (1 site), TC (1 site), and CA (1 site) being the least common, as shown in Table 3. Nucleotide composition: A = 25.4%, T = 20.0%, C = 26.8%, G = 27.8%. This shows a high proportion of C+G, indicating a clear C / G base bias, and a low T content.

[0128] Table 3. Haplotype analysis of EPO genotypes among different Himalayan marmots

[0129]

[0130] Furthermore, 15 haplotypes were detected from 203 EPO gene sequences of 10 geographical populations of Himalayan marmots. The statistical results of the genetic diversity parameters of the Himalayan marmot populations at each sampling site are shown in Table 4, and the specific distribution of the number of individuals with haplotypes (H1–H15) at each sampling site is shown in Table 5. It can be seen that there are 121 individuals with haplotype 1, 29 individuals with haplotype 2, and 20 individuals with haplotype 3; H1, H2, and H3 are the dominant haplotypes. There are 11 individuals with haplotype 4, 8 individuals with haplotype 7, and 3 individuals with haplotypes 6 and 11. The remaining haplotypes are represented by a single individual. Of the 15 haplotypes, 6 are shared haplotypes, and the remaining 9 are singleton haplotypes. Of the six shared haplotypes, haplotype 1 was shared by all 10 populations, haplotype 2 was shared by 9 populations except the Tuotuohe population, haplotype 3 was shared by 5 populations including Tongren, Zeku, Jianzha, Tianjun, and Wulan, haplotypes 4 and 7 were shared by 3 populations including Tianjun, Wulan, and Xinghai, and haplotype 6 was shared by 2 populations including Tianjun and Xinghai. The existence of 9 unique haplotypes indicates that there is a certain degree of genetic differentiation within different populations.

[0131] A nucleotide diversity index of 0.001–0.0047 indicates low genetic diversity in the species population. Among the 10 populations, the Zeku population had the highest nucleotide diversity, followed by the Wulan, Qilian, and Xinghai populations. The Tianjun, Tongren, and Jianzha populations had low nucleotide diversity, while the Yushu population had the lowest. The Zeku population had the highest haplotype diversity, followed by the Xinghai, Wulan, Tianjun, Tongren, Jianzha, and Qilian populations, while the remaining three populations had low haplotype diversity.

[0132] Table 4. Genetic diversity parameters of Himalayan marmot populations at various sampling sites.

[0133]

[0134] Table 5. Distribution of haplotype (H1~H15) individuals at each sampling point for Himalayan marmots.

[0135]

[0136] The Kimura-2-Paramter model was used to analyze the genetic distance between different geographic populations of Himalayan marmots. Genetic distance and population differentiation coefficient (FST) analyses were performed on 203 EPO gene sequences from the aforementioned 10 geographic populations, yielding results shown in Table 6 (lower triangle represents the FST, upper triangle represents the genetic distance). It can be seen that the genetic distance between different geographic populations ranges from 0.00029 to 0.00165, with relatively low genetic distances among all geographic populations, indicating that the EPO gene of the Qinghai Himalayan marmot is relatively conserved. The population differentiation coefficient (FST) shows that the genetic differentiation between the Tuotuohe population and the Jianzha and Tongren populations is 0.30098 and 0.27672, respectively, indicating significant genetic differentiation among these populations. Genetic differentiation among the remaining populations is not very significant.

[0137] Table 6. Genetic distance and genetic differentiation coefficient (FST) among Himalayan marmot populations.

[0138]

[0139] Furthermore, a haplotype network was constructed using Network 5.0 based on the EPO gene of individual Himalayan marmots, resulting in a median-joining haplotype network diagram based on the EPO gene, as shown below. Figure 2As shown in the diagram, the yellow circle area represents the frequency of haplotype occurrence, the red numbers represent mutation sites, and the red dots represent the median vector; the circle area represents the sample size. The haplotype network diagram shows that haplotypes H1 and H2 form two radiation centers. H1 radiated outwards to evolve eight haplotypes, having the widest distribution, indicating that H1 is the oldest haplotype. The evolutionary direction of the network diagram is relatively concentrated, which can be seen as diffusion from the central haplotypes with a higher frequency outwards. Several haplotypes with higher frequencies in all populations are located on the right side of the network evolution diagram, while other low-frequency haplotypes are connected to these high-frequency haplotypes through branches, showing a diffusion phenomenon from high to low frequency. H1, H2, and H3 account for a large sample size and have high frequencies, while other haplotypes also have independent branches, indicating that genetic differentiation between populations originates from inter-population differences, suggesting that this species may exhibit population variation.

[0140] Example 5

[0141] Historical Dynamics Analysis of Himalayan Marmot Populations

[0142] The Himalayan marmot population in this invention was treated as a whole, and Tajima's D and Fu's Fs were tested neutrally. The total population Tajima's D value was -1.33214 (P>0.10), and the Fu's Fs value was -10.422 (P>0.10). The results were negative but not statistically significant, indicating that the Himalayan marmot population in Qinghai Province has not experienced population expansion recently.

[0143] The DnaSP5.0 software was used to perform neutrality tests and mismatch distribution analysis (MDA) on the detected Himalayan marmot EPO gene sequence to obtain the distribution of disjoint points in the Himalayan marmot population, as shown below. Figure 3 As shown, the solid line represents the theoretical expected distribution, and the dashed line represents the observed distribution. It can be seen that the expected value curve gradually decreases, while the observed value curve first rises and then continuously decreases, exhibiting a unimodal distribution, indicating that the size of the Qinghai Himalayan marmot population remains stable.

[0144] In summary, this invention identified 11 valid nucleotide variations in a portion of the EPO gene in the Himalayan marmot population. The average number of haplotype variations was 0.82300, the haplotype diversity was 0.61200, and the nucleotide diversity was 0.00102. These values ​​indicate high haplotype diversity (Hd>0.5) and low nucleotide diversity (pi<0.005), suggesting low genetic diversity. This indicates that while there are differences in the nucleotide level of the marmot EPO gene, the amino acid level is relatively conserved, indicating that this species has a strong ability to adapt to environmental changes and expand its population distribution range.

[0145] The maximum genetic distance between different marmot populations (0.00165) is still less than the subspecies boundary (0.02), indicating that none of the 10 marmot geographic populations in Qinghai have reached subspecies differentiation. Furthermore, the FST between different populations is very low, even negative, indicating a low degree of EPO gene differentiation, consistent with the stable functional characteristics of the EPO hypoxia gene, suggesting that stable gene expression is a result of long-term hypoxia. These results demonstrate that the Himalayan marmot, as a species endemic to the Qinghai-Tibet Plateau, plays a crucial role in the study of hypoxia adaptation mechanisms. This invention helps us to understand the formation mechanism of human high-altitude adaptation from a genetic perspective, providing new research ideas and strategies for deepening our understanding of the pathogenesis of high-altitude diseases and for treating and preventing their occurrence.

[0146] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A set of SNP molecular markers for genetic analysis of M. himalayana hypoxia adaptation, characterized in that, The SNP molecular marker comprises one or more than two of the 11 SNP loci, which are located in the amplified fragment of the EPO gene of the Himalayan marmot shown in the nucleotide sequence of SEQ ID NO.

1. The SNP locus comprises the 2nd nucleotide of the nucleotide sequence shown in SEQ ID NO. 1, wherein the base of the nucleotide molecule is C or A. The SNP locus comprises the 3rd nucleotide of the nucleotide sequence shown in SEQ ID NO. 1, wherein the base of the nucleotide molecule is A or C. The SNP locus comprises the 56th nucleotide of the nucleotide sequence shown in SEQ ID NO. 1, wherein the base of the nucleotide molecule is G or A. The SNP locus comprises the 111th nucleotide of the nucleotide sequence shown in SEQ ID NO. 1, wherein the base of the nucleotide molecule is A or G. The SNP locus comprises the 471st nucleotide of the nucleotide sequence shown in SEQ ID NO. 1, wherein the base of the nucleotide molecule is C or A. The SNP locus comprises the 477th nucleotide of the nucleotide sequence shown in SEQ ID NO. 1, wherein the base of the nucleotide molecule is C or T. The SNP locus comprises the 606th nucleotide of the nucleotide sequence shown in SEQ ID NO. 1, wherein the base of the nucleotide molecule is C or T. The SNP locus comprises the 689th nucleotide of the nucleotide sequence shown in SEQ ID NO. 1, wherein the base of the nucleotide molecule is C or T. The SNP locus comprises the 690th nucleotide of the nucleotide sequence shown in SEQ ID NO. 1, wherein the base of the nucleotide molecule is A or C. The SNP locus comprises the 770th nucleotide of the nucleotide sequence shown in SEQ ID NO. 1, wherein the base of the nucleotide molecule is T or C. The SNP locus comprises the 803th nucleotide of the nucleotide sequence shown in SEQ ID NO. 1, wherein the base of the nucleotide molecule is A or G.

2. A primer pair for identifying the SNP molecular marker of claim 1, characterized in that, The primer pair comprises an upstream primer with the nucleotide sequence shown in SEQ ID NO. 2 and a downstream primer with the nucleotide sequence shown in SEQ ID NO.

3.

3. A kit comprising the primer pair of claim 2.

4. Use of the SNP molecular marker of claim 1, the primer pair of claim 2 or the kit of claim 3 in the analysis of the genetic structure and genetic diversity of a Himalayan marmot population.

5. A method for analyzing genetic structure and genetic diversity of Marmota himalayana population, characterized in that, The method comprises the following steps: PCR amplification is performed on the genomic DNA of the Himalayan marmot to be tested using the primer pair of claim 2 to obtain an amplification product; The amplification product is analyzed and identified to determine the population genetic structure and / or genetic diversity of the sample to be tested.

6. The method of claim 5, wherein, The reaction procedure for the PCR amplification is as follows: pre-denaturation at 94℃ for 2 min; 35 cycles of amplification reaction, each cycle comprising denaturation at 94℃ for 40 s, annealing at 58℃ for 30 s, and extension at 72℃ for 2 min; final extension at 72℃ for 10 min, and maintenance at 4℃ until removal.

7. The method of claim 5, wherein, The analysis includes cloning sequencing and / or agarose acrylamide gel electrophoresis detection of the obtained amplification products.

8. The method of claim 5, wherein, The genomic DNA is extracted from liver and / or muscle tissue of the sample to be tested.

9. Use of the method of claim 5 for identifying M. himalayana EPO gene haplotypes, characterized in that, The nucleotide sequence of the Himalayan marmot EPO gene haplotype is shown as SEQ ID NO. 4-SEQ ID NO.

18.

10. The SNP molecular marker of claim 1, the primer pair of claim 2 or the kit of claim 3 is used in the study of Himalayan marmot highland hypoxia adaptation or the study of natural epidemic disease transmission mechanism.

Images