Feature sequence, marker primer and identification method of fig variety BBR
By developing the characteristic sequence and molecular-specific marker primer combination of the fig variety BBR and using SLAF-seq technology, the problem of identification between fig varieties was solved, rapid and reliable variety identification was achieved, sample requirements were reduced, and identification accuracy was improved.
Patent Information
- Application Number
- CN202410248460.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-03-05
- Publication Date
- 2025-09-05
AI Technical Summary
Existing technologies make it difficult to conduct accurate and rapid molecular-level identification between fig varieties, resulting in inconvenience in variety identification, promotion and communication.
Develop characteristic sequences and molecular-specific marker primer combinations for the fig variety BBR, use SLAF-seq technology to obtain molecular markers across the entire genome, design and verify more than 1,000 pairs of primers, and achieve specific identification of the BBR variety.
The rapid and reliable specific identification of the fig variety BBR was achieved, the sample requirements were reduced, the detection was convenient and intuitive, and the bands could be observed by ordinary electrophoresis, which improved the accuracy of identification.
Smart Images
Figure CN120591435A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to a characteristic sequence of a fig variety BBR, a molecular specific marker primer combination, and a method for specifically identifying the fig variety BBR by utilizing the molecular specific marker primer combination. Background Art
[0002] Fig Ficus carica Ficus genus, Moraceae Ficus This deciduous shrub or small tree, native to the Mediterranean coast, is now being cultivated in many parts of my country, characterized by high yields and rapid returns. Currently, over 20 varieties, including 'Bojihong,' 'Blanrick,' and 'Mas Yi Dafen,' have performed well in my country. The fruit of the fig contains polysaccharides, flavonoids, psoralens, and other active ingredients, which have been shown to treat sore throats, fight tumors, lower blood sugar and blood lipids, and enhance immunity, leading to increasing market demand. Although the fruit shape, size, color, and flavor of different fig cultivars vary significantly, the differences between individual plants are relatively small. Furthermore, the naming of hybrid offspring between some fig cultivars is confusing, hindering the identification, promotion, communication, and breeding of new varieties. Therefore, efforts are underway to develop stable and specific DNA markers at the molecular level, which is a scientific approach to accurately and rapidly identifying fig varieties. Summary of the Invention
[0003] The purpose of the present invention is to provide a characteristic sequence of the fig variety BBR, a molecular specific marker primer, and a method for specifically identifying the fig variety BBR using the molecular specific marker primer; The technical solution adopted in the present invention is: The characteristic sequence group of fig variety BBR is as follows: 2529_118: 5'-CCTCACGACGATGCTCTTGTTCTGACGTTGAACGTATCGAACTATGAAGTAGGTCAAATTCTGGTCGATAATGGGAGTTCTGCGAACGTTCTTTTCCTTTCAACACTCAGAGAGATGGAGTTATC TNNNNNNNNNNCCTACCAAGAATTATGTTGTAGGCAGATGGGCAGTCTAAAACTAAAAAGGTGGTTAGCTTGTTCTCTTCTGCTGCAAAGACAGGATGTTTGATCTTTCCAACAGTAGCAGTCGATTCCCCATTGAA -3' Where NNNNNNNNNN is an unknown sequence within 300bp.
[0004] The present invention also relates to a molecular specific marker primer set for the fig variety BBR, the primer set sequence being: 2529_118 primer set: 2529_118LFGAATTATGTTGTAGGCAGATGGG 2529_118RR GATCAAACATCCTGTCTTTGCAG 2529_118SF TTCCTTTCAACACTCAGAGAGATGT The three primers described above were derived from molecular markers developed using SLAF-seq (Specific-Locus Amplified Fragment Sequencing) technology across 23 accessions, generating genome-wide molecular markers. An average of 118,891 SLAF tags were generated per sample in this project, with an average sequencing depth of 10.12x. A total of 72.00 Mb reads were generated. Bioinformatics analysis identified 166,254 SLAF tags, including 6,575 polymorphic SLAF tags, for a total of 72,678 population SNPs. Based on these results, over 1,000 primer pairs were designed and screened and validated in 23 samples, generating DNA fragments specific to the fig variety BBR. The selected primer combinations failed to generate specific fragments for other fig varieties. It should be noted that the molecular marker primer combinations described in this invention are limited to fig variety identification, meaning that the samples tested are limited to figs.
[0005] The fruit test of 5 randomly selected plants of this variety showed that the characteristics of BBR variety figs are shown in the table: The present invention also relates to a method for rapidly identifying the fig variety BBR using the molecular specific marker primers, the method comprising: extracting genomic DNA from leaves of the fig variety to be tested as a template, using the molecular specific marker primers as amplification primers, and performing PCR amplification, wherein the primers correspond to binding sites on characteristic sequences such as Figure 1 As shown: The key to the method of the present invention lies in the selection of amplification primers, while DNA extraction, PCR reaction system and reaction conditions, and electrophoresis detection can all be carried out according to conventional methods in the art. Compared with existing molecular marker methods for fig varieties, such as SSR markers, the method of the present invention has the following advantages: (1) Because the primers used have been sequenced and repeatedly verified, their reliability has been greatly improved; (2) The detection is convenient and intuitive. The presence or absence of band combinations can be directly determined by ordinary electrophoresis. However, if the SSR marker method is used, further analysis or sequencing by high-resolution electrophoresis is required after amplification. (3) The sample requirements are relatively low, and DNA samples from tissues such as leaves can meet the needs of variety identification; Preferably, the PCR amplification system of the present invention is composed as follows: The final concentration of PCR Buffer is 1× dNTPs 1 mmol / L MgCl2 2.5 mmol / L Taq enzyme 1.0 U / reaction 0.2 μM each of upstream and downstream primers Template DNA 60 ng / reaction The balance is ddH2O; The PCR amplification conditions were as follows: pre-denaturation at 94°C for 300 s, denaturation at 95°C for 10 s, annealing at 56°C for 50 s, extension at 72°C for 40 s, for a total of 30 cycles, and a final fill-in at 72°C for 300 s; the termination temperature was 4°C; The final concentration of PCR Buffer is 1×, which means that the concentrations of the components in the reaction system are the same as those of 1× PCR Buffer. 10× PCR Buffer is usually used, with a volume of 1 / 10 of the reaction system volume. 10× PCR Buffer consists of: 100 mM Tris-HCl (pH 8.5), 500 mM KCl, 25 mM MgCl2, and 1.0% Triton-X-100, with the solvent being ddH2O. Specifically, the method is as follows: (1) Take the fig leaves to be tested, grind them with liquid nitrogen, and extract the genomic DNA of the fig leaves to be tested using the CTAB method; (2) Using the genomic DNA extracted in step (1) as a template and the molecular specific labeled primers as amplification primers, PCR amplification is performed: The PCR reaction system per 15 μL is composed as follows: 2×TsingKE master mix 7.5μL 0.2 μL each of 10 μM upstream and downstream primers 2 μL 20 ng / μL template DNA dd H2O 5.1 μL; PCR reaction conditions are as follows: After pre-denaturation at 94°C for 300 s, the reaction was cycled for 30 cycles: denaturation at 95°C for 10 s, annealing at 56°C for 50 s, and extension at 72°C for 40 s. The final cycle was completed at 72°C for 300 s. The termination temperature was 4°C. (3) Take 3 μL of the amplified product from step (2), mix it with 1 μL of 0.25% bromophenol blue buffer, apply the sample to a 1.5% agarose gel, and electrophorese in 1×TAE buffer at 5 V / cm. After the electrophoresis, stain with EB and photograph it on an automatic gel image analyzer. If a specific DNA band appears in the electrophoresis result, the fig variety to be tested is BBR; otherwise, it is not. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 . Schematic diagram of the primer position relationship on the 2529_118 fragment;
[0006] Figure 2 PCR amplification results of 23 fig varieties using primer set 2529_118 (varieties numbered 1-23: 1, Brooke Red; 2, Grace; 3, Brunswick; 4, Early Yellow; 5, Mas-i-Taufin; 6, Strawberry; 7, B1011; 8, Huishankou; 9, Jinaofen; 10, Qinghua; 11, Hongyan; 12, Papa John's; 13, BNR; 14, Hardy; 15, BBR; 16, Baishan; 17, Sala; 18, Rockery; 19, Green Anti-1; 20, Dela; 21, Baiya; 22, California Black; 23, Baraunay). Takara DL2000 marker was used. Only one specific DNA band was amplified from fig variety 15, BBR. DETAILED DESCRIPTION
[0007] The present invention will be further described below with reference to specific embodiments, but the protection scope of the present invention is not limited thereto. Example
[0008] (1) Extraction of genomic DNA from fig varieties: 0.05 g of young leaves of the tested fig variety were thoroughly ground in liquid nitrogen. Genomic DNA was extracted using the Bioteke Rapid Plant Genomic DNA Extraction Kit according to the operating instructions. Genomic DNA extracts of the fig variety were obtained through multiple extractions. The DNA extracts were then subjected to 1.5% agarose gel electrophoresis to test integrity, purity, and concentration. Band brightness was determined for subsequent PCR amplification. The DNA extracts were stored at -20°C until use. (2) Design specific PCR amplification primers. The sequences of the primer pairs are: 2529_118 primer set: 2529_118LF:GAATTATGTTGTAGGCAGATGGG 2529_118RR:GATCAAACATCCTGTCTTTTGCAG 2529_118SF: TTCCTTTCAACACTCAGAGAGATGT Synthesized by Shanghai Bioengineering Technology Co., Ltd.; (3) PCR amplification: PCR reaction solution composition (15 μL): 2×TsingKE master mix (Qingke Biotechnology, Beijing) 7.5μL 0.2 μL each of 10 μM upstream and downstream primers 20 ng / μL template DNA 2 μL dd H2O 5.1 μL; The amplification reaction was performed on a TC-XP thermal amplification instrument. The amplification conditions were as follows: 94°C pre-denaturation for 300 s, 95°C denaturation for 10 s, 56°C annealing for 50 s, and 72°C extension for 40 s, for a total of 30 cycles, followed by a final fill-in at 72°C for 300 s. The termination temperature was 4°C. (4) Electrophoresis detection: Take 3 μL of the PCR amplification product from step (3), mix it with 1 μL of 0.25% bromophenol blue buffer, apply it to a 1.5% agarose gel, and run electrophoresis in 1×TAE buffer at 5 V / cm. After the electrophoresis, stain it in an aqueous solution containing 0.5 μg / mL EB for 30 minutes, and then photograph it on the Bio-rad gel imaging system Gel Doc; According to the above method, 23 fig varieties (numbered 1-23, representing fig varieties, are as follows: 1, Brooke Red; 2, Grace; 3, Brunswick; 4, Early Yellow; 5, Masyi Dauphin; 6, Strawberry; 7, B1011; 8, Huishankou; 9, Jinaofen; 10, Qinghua; 11, Hongyan; 12, Papa John's; 13, BNR; 14, Hardy; 15, BBR; 16, Baishan; 17, Sala; 18, Rockery; 19, Green Anti-1; 20, Dela; 21, Baiya; 22, California Black; 23, Balaonai) were detected by electrophoresis. The marker used was Takara DL2000. The results of electrophoresis are shown in the table. Figure 2 Only a stable DNA band of approximately 100 bp was amplified from fig variety BBR numbered 15, while two bands were amplified from the other numbered fig varieties. No special DNA bands were observed, nor were any other non-target bands generated. This indicates that the molecular-specific marker primer pair developed by the present invention is very stable and specific for early identification of fig variety BBR.
Claims
1. The characteristic sequence of fig variety BBR, the characteristic sequence is as follows: 2529_118: 5'-CCTCACGACGATGCTCTTGTTCTGACGTTGAACGTATCGAACTATGAAGTAGGTCAAATTCTGGTCGATAATGGGAGTTCTGCGAACGTTCTTTTCCTTTCAACACTCAGAGAGATGGAGTTATC TNNNNNNNNNNCCTACCAAGAATTATGTTGTAGGCAGATGGGCAGTCTAAAACTAAAAAGGTGGTTAGCTTGTTCTCTTCTGCTGCAAAGACAGGATGTTTGATCTTTCCAACAGTAGCAGTCGATTCCCCATTGAA -3' Where NNNNNNNNNN is an unknown sequence within 300bp.
2. A primer set for detecting the characteristic sequence of the fig variety BBR according to claim 1, wherein the primer set is composed of the following primer sequences: 2529_118 primer set: 2529_118LFGAATTATGTTGTAGGCAGATGGG 2529_118RR GATCAAACATCCTGTCTTTGCAG 2529_118SF TTCCTTTCAACACTCAGAGAGATGT.
3. A method for rapidly identifying the fig variety BBR using the primer set of claim 2, the method comprising: extracting genomic DNA from leaves of the fig variety BBR to be tested as a template, performing PCR amplification using the primers in groups, and performing electrophoresis on the amplified products. If the electrophoresis results show that the 2529_118 primer set amplifies a single band, the fig variety to be tested is the fig variety BBR; otherwise, it is not. The primer set is composed of all the following primers: 2529_118 primer set: 2529_118LFGAATTATGTTGTAGGCAGATGGG 2529_118RR GATCAAACATCCTGTCTTTGCAG 2529_118SF TTCCTTTCAACACTCAGAGAGATGT.
4. The method according to claim 3, wherein The PCR amplification conditions were as follows: pre-denaturation at 94°C for 300 s; denaturation at 95°C for 30 s, annealing at 56°C for 60 s, and extension at 72°C for 50 s, for a total of 30 to 40 cycles; and a final fill-in at 72°C for 300 s, with a termination temperature of 4°C.
5. The method according to claim 3, wherein The method is as follows: 1) Take the fig leaves to be tested, grind them in liquid nitrogen, and extract the genomic DNA from the fig leaves using the CTAB method; 2) performing PCR amplification using the genomic DNA extracted in step 1) as a template and the primers in the molecular-specific marker primer set as amplification primers; 3) Take 3 μL of the amplified product from step 2) and mix it with 1 μL of 0.25% bromophenol blue buffer. Blot the sample onto a 1.5% agarose gel and electrophorese in 1× TAE buffer at 5 V / cm. After electrophoresis, stain with EB and photograph the gel using an automated gel image analyzer. If the electrophoresis results show the characteristic bands described in claim 3, the fig variety being tested is BBR; otherwise, it is not.