Methods and compositions for improving genome editing specificity and efficiency of cytosine base editor

Abstract

The present invention relates to improved materials and methods relating to cytosine and adenosine base editing of genomic DNA.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to U.S. Provisional Patent Application No. 63 / 386,187, filed on December 6, 2022, the entire contents of which are incorporated herein in their entirety. Background Art

[0003] Targeted genome modification is a powerful tool for DNA genetic manipulation, including the manipulation of eukaryotic cells, embryos and animals. For example, exogenous sequences can be integrated into the targeted genomic position and / or specific endogenous DNA (e.g., chromosome) sequence can be deleted, inactivated or modified. The CRISPR-Cas9 genome editing system has become a widespread method for introducing genetic modification into various cell types and organisms. Although the simple double-stranded DNA cutting of Cas9 allows gene inactivation by forming insertions and deletions, precise editing can be achieved by homology-directed repair (HDR) or base editing. By HDR, the introduction rate (rate of installation) of the required editing is usually very challenging, and donor DNA may be toxic in some cell types, and the requirement for double-stranded DNA breaks (DSBs) introduces the risk of unwanted repair results outside of expectation. On the contrary, base editing utilizes a deaminase domain to introduce C to T or A to G substitutions at the target site without the need for donor DNA. In the case of cytosine base editors (CBEs), the cytosine base is deaminated to uracil, which is then "read" as thymine by DNA polymerase, resulting in the introduction of a cytosine-to-thymine substitution. Additionally, base editors utilize CRISPR effectors, such as Cas9 and Cas12a, with fully or partially inactivated DNA cleavage functions, which prevents the formation of DSBs.

[0004] Since its initial publication by Komor et al. (Nature, 2016), cytosine base editing has been widely used in a variety of organisms from bacteria to humans and is being explored for correcting pathogenic mutations in therapeutic settings. Komor's cytosine base editing system utilizes a catalytically dead Cas9 (dCas9) containing Asp10Ala and His840Ala mutations that inactivate its nuclease activity while still retaining its ability to bind to DNA in a guide RNA-programmed manner without cutting the DNA backbone. As described above, the deamination of cytosine is catalyzed by cytosine deaminase and results in the conversion of cytosine to uracil. Uracil has the base pairing properties of thymine and produces AT base pairs during replication or repair.

[0005] However, there are still some shortcomings that need to be addressed in this editing technology. One of the shortcomings is the so-called “bystander editing”, in which adjacent cytosine residues other than the expected cytosine residues in the R ring are converted to thymine, thereby causing off-target effects. Several efforts to solve this problem have been attempted previously, and some success has been achieved. These efforts include the use of rigid peptide linkers between the deaminase and the Cas9 nickase to narrow the editing window, thereby minimizing bystander editing (Tan et al., Nat. Commun., 2019)), and protein engineering on the deaminase domain to limit C to T editing to certain nucleotide motifs (Gehrke et al., Nat Biotechnol, 2018; Kim et al., Nat Biotechnol, 2017)) or reduce the editing frequency of multiple cytosine residues in the editing window (Jin et al., Molecular Cell, 2020)). However, each of these methods has its own limitations.

[0006] Another problem associated with cytosine base editing is the undesirable excision of uracil intermediates during the C to T conversion process. Uracil does not naturally occur in DNA. The most common causes of the presence of deoxyuridine in DNA are the misincorporation of deoxythymidine and spontaneous deamination of cytosine, both of which are mutagenic. Therefore, the presence of deoxyuracil will lead to a DNA damage reaction by uracil DNA glycosylase, resulting in the excision of uracil bases. Transamination synthesis at abasic sites can lead to the introduction of undesirable cytosine to adenine or cytosine to guanine substitutions. Abasic sites are also prone to DNA chain breaks, and in the case of CBEs containing Cas9 nickase activity, this can lead to double-stranded DNA breaks (DSBs), which typically result in DNA insertions and deletions. To address these undesirable repair events that may occur during cytosine base editing, the second-generation cytosine base editor (BE2) (Komor et al., Nature, 2016) carries a phage-derived uracil glycosylase inhibitor (UGI) covalently linked to the C-terminus of Cas9, which has been shown to improve the C-to-T conversion rate and overall editing efficiency compared to the first-generation cytosine base editor (BE1) (Komor et al., Nature, 2016) without UGI. The fourth-generation cytosine base editor (BE4) adds additional UGI to enhance the effect (Komor et al., Sci. Adv., 2017). Currently, almost all cytosine base editors contain this combination of two UGIs linked in series to the C-terminus of the Cas effector.

[0007] Plasmid delivery of base editors and single guide RNA (sgRNA) is currently a common practice in base editing. However, plasmid delivery has the risk of increased off-target effects due to prolonged overexpression of base editors, toxicity in some cell types due to sensitivity to exogenous DNA, and the possibility of plasmid DNA integration into the host genome. Ribonucleoprotein (RNP) complex delivery of base editor recombinant proteins and chemically synthesized sgRNA will greatly reduce or eliminate these risks. However, expressing and purifying base editor recombinant proteins from Escherichia coli hosts may be challenging because elevated deaminase levels may be toxic to bacterial cells. To overcome this obstacle, some people have resorted to the use of immortalized human HEK293 cells (Jiang et al., Sci. Adv., 2021). In addition to the protein purification challenge, the editing rate after RNP complex delivery may be lower than that of plasmid delivery. Therefore, there is a need for base editor proteins that can be produced on a commercial scale, generate high rates of cytosine-thymine substitutions, and deaminize within a relatively narrow window to allow the introduction of precise cytosine-thymine substitutions without bystander editing. Summary of the Invention

[0008] Various aspects of the present invention are compositions and methods for significantly improving the specificity of cytosine base editing by limiting bystander editing within the R-loop using an ssDNA binding domain (SSB). Bystander editing, in which adjacent cytosine residues other than the expected cytosine within the R-loop are converted to thymine, constitutes a major limitation on cytosine base editors used as precise gene editing tools for correcting pathogenic mutations. Without wishing to be bound by theory, we hypothesize that the SSB covalently linked to the cytosine base editor (CBE) can compete with the deaminase domain for binding to a portion of the single-stranded DNA region formed after Cas9 target binding and R-loop formation, and this limits the deaminase activity to smaller segments on the single-stranded DNA region. SSBs are ubiquitous and vary greatly in size and DNA binding footprint. For proof of concept, we fused T4 phage-derived SSB (SEQ ID NO: 1) or T7 phage-derived SSB (SEQ ID NO: 2) to the N-terminus of human APOBEC3A or APOBEC3B deaminase, which was in turn covalently linked to the N-terminus of the SpCas9 nickase.

[0009] In some embodiments, it is contemplated that the fusion protein may also contain one or more UGIs at the C-terminus of the fusion protein. In other embodiments, the one or more UGIs may be free standing, i.e., not fused to the fusion protein, but separated from the fusion protein. In other embodiments, UGIs fused to fusion proteins are specifically excluded from the present invention. In other embodiments, UGIs may be fused and free standing. In other embodiments, the present invention contemplates methods and materials for use with cytosine base editing that exclude one or more fused and / or free standing UGIs.

[0010] To our knowledge, this is the first successful use of a self-sustaining UGI protein in a cytosine base editing application. Other attempts have been made by Jang et al. (Science Advances (2021) "High purity production and precise editing of DNA base editing ribonucleoproteins" DOI: 10.1126 / sciadv.abg 2661)) and Wang et al. (Cell Research (2017) "Enhanced base editing by co-expression of free uracil DNA glycosylase inhibitor" DOI: 10.1038 / cr.2017.111). However, in these papers, UGI was overexpressed from a plasmid.

[0011] The recombinant protein was expressed and purified from Escherichia coli, and C-to-T base editing was tested in human immortalized HEK293 cells using chemically synthesized sgRNAs delivered via RNP complexes. Compared to their non-SSB counterparts, all tested SSB-CBE fusion proteins improved editing specificity by narrowing the editing window by at least one residue. The results show that this new strategy can be used to reduce CBE bystander editing, thereby improving editing specificity. Compared to existing methods that rely on deaminase mutagenesis to bias editing towards certain DNA sequence motifs or rigid peptide linkers to narrow the editing window, this new strategy can utilize SSBs with different DNA binding footprints and affinities to customize the size of the editing window according to specific needs. Those skilled in the art can identify suitable SSBs for use in the present invention under the guidance of this specification (see, for example, Guo and Malik et al., Biomolecules, 2022 12(9), 1187)).

[0012] Another aspect of the present invention discloses a CBE protein fusion composition that improves editing efficiency relative to conventional CBEs when C-to-T editing is performed by delivering preassembled RNP complexes. As disclosed in the prior art, conventional CBEs contain at least one covalently linked UGI as a means of improving editing efficiency compared to CBEs without UGI. This teaching is based on the delivery of plasmid DNA encoding CBEs (Komor et al., Nature, 2016; Komor et al., Sci. Adv., 2017). However, we reasoned that a UGI covalently linked to the C-terminus of a CBE might actually interfere with target binding of a CRISPR effector nuclease and reduce editing efficiency in the absence of plasmid DNA overexpression. To test this hypothesis, we constructed pairs of CBEs with or without a covalently linked UGI and purified the recombinant proteins from Escherichia coli. After transfection of these proteins in combination with chemically synthesized sgRNAs in RNP complexes into human immortalized HEK293 cells, we indeed found that CBEs without UGIs performed C-to-T conversion more efficiently than CBEs with covalently attached UGIs for all targets tested. Thus, we have revealed a novel phenomenon that contrasts with the teachings of the prior art and established an improved CBE protein fusion composition for enhanced cytosine base editing via RNP complex delivery.

[0013] We further demonstrate that free-standing recombinant UGI can be used to further enhance CBE editing efficiency and specificity, regardless of whether the CBE contains a covalently linked UGI. We engineered a recombinant UGI containing a Bacillus phage-derived UGI, the c-MYC nuclear localization signal (NLS), and the SV40 large T antigen NLS (SEQ ID NO:3) and purified the protein from Escherichia coli. Co-transfection of recombinant UGI with recombinant CBE significantly improved C-to-T editing efficiency. Furthermore, UGI co-transfection also improved editing product purity by reducing C-to-G / A conversion and indel formation. Although UGI efficacy was evident regardless of whether the CBE contained a covalently linked UGI, CBEs without UGI were preferred for achieving optimal editing outcomes. It appears that the respective enhancing effects of free-standing UGI and CBEs without covalently linked UGI are additive to some extent. To our knowledge, this novel composition of recombinant UGI proteins and their use as effective enhancers have not been reported elsewhere.

[0014] Another embodiment of the present invention provides a method for enhancing CBERNP editing efficiency using an RNP electroporation enhancer based on sulfonated polysaccharides. It is well known that compared to plasmid DNA delivery, RNP complex delivery of gene editing reagents can help reduce off-target effects and eliminate the risk of plasmid DNA-induced cytotoxicity and random genomic integration. However, the editing efficiency delivered by RNP complex may be lower than that delivered by plasmid DNA due to rapid protein turnover in the absence of overexpression. In order to solve this problem in base editing, we infer that the SpCas9 nuclease enhancer based on dextran sulfate (MilliporeSigma Product No. PEXBUF, Burlington, MA) can also be effective for CBE. In fact, we found that enhancers can increase C-to-T editing efficiency by up to several times, especially on target sites that are difficult to edit. In addition, enhancers can be used in combination with CBEs with or without covalently linked UGIs. However, it is preferred that enhancers be used in combination with self-supporting UGIs because, in the absence of self-supporting UGIs, enhancers can also increase other editing events, such as C-to-G / A conversion and indel formation. This unique combination of an RNP enhancer and recombinant UGI has not been disclosed elsewhere.

[0015] The present invention also discloses a method for C-to-T editing of cytosine residues that are inaccessible using conventional methods. These cytosine residues are located at the 5' end of about 18 or more nucleotides upstream of the pre-spacer adjacent motif (PAM). In the case of conventional 20-nt guide RNA spacers, they are located at the edge of the R loop or in a base-paired state, so CBE is inaccessible. By extending the guide RNA spacer from conventional 18nt to 19nt or 20nt to 21nt, 22nt, 23nt or more on synthetic sgRNA, we found that cytosine residues located at 18nt to 23nt of the PAM can be effectively converted into thymine residues by CBE. It is conceivable that guide RNA spacers longer than 23-nt can be used to further expand the editing range. We also found that spacer extension largely shifts the editing window proportionally to the PAM without significantly increasing the size of the editing window. Therefore, this strategy provides a means to expand the CBE editing range on each available PAM and increase the total genome coverage. It is expected that this strategy can also be applied to crRNA (CRISPR RNA) design and tracrRNA (trans-activating crRNA). The crRNA guides the Cas effector nuclease to bind to a DNA or RNA sequence that is complementary to the "guide" portion of the crRNA and is flanked by a protospacer adjacent motif (PAM) (for DNA targets) or a sequence that is not extensively complementary to the crRNA repeats (for RNA targets).

[0016] In summary, this disclosure describes novel compositions and methods for improving the specificity and efficiency of CBE using RNP complex delivery. Additionally, these novel approaches can also be used in the context of mRNA delivery or plasmid DNA delivery. Furthermore, they can be used alone or in various combinations without departing from the principles of the present invention.

[0017] Although the present invention contemplates the use of cytosine deaminase in the compositions and methods of the present invention, the present invention also contemplates the use of adenosine deaminase in the compositions and methods of the present invention. Similar to how the cytosine base editor converts a cytosine (C)-guanine (G) binding pair into a thymidine (T)-adenine (A) binding pair, the adenosine base editor converts an AT binding pair into a GC binding pair. Adenosine deaminase is known to those of ordinary skill in the art. See, for example, Gaudelli et al., 2017, Nature, 551, 464-471; Richter et al., 2020, Nature Biotechnology, 38, 883-891. In view of the teachings of this specification, those of ordinary skill in the art will be able to use adenosine deaminase in the present invention without undue experimentation.

[0018] In addition, although the present invention contemplates the use of T4 and / or T7 phage SSBs, the present invention also contemplates the use of other SSBs. SSBs are known to exist in all kingdoms of life (Antony & Lohman, 2019, Semin Cell Dev Biol, 86: 102-111). Although SSBs have structural diversity, these structures are known to those of ordinary skill in the art (see Antony & Lohman). In addition, the physiological mechanisms by which SSBs function are also known to those of ordinary skill in the art. For example, the functional structure of an SSB is an oligonucleotide / oligosaccharide binding (OB) fold, a protein domain that promotes binding to ssDNA and various protein-protein interactions. An OB fold consists of a five-stranded β-sheet that is coiled to form a closed β-barrel, with an end-capped α-helix between the third and fourth β-strands. Based on the number of OB folds, SSBs can be divided into two groups: simple SSBs that contain only one OB fold and high-order SSBs that contain multiple OB folds (see Antony & Lohman). SSB may also or additionally comprise a K homology (KH) domain, an RNA recognition motif (RRM), and a whipple domain, the structures and functions of which are known to those of ordinary skill in the art (for a detailed description of the OB fold and other domains / motifs, see Guo and Malik, 2022, Biomolecules, 12: 1187-1199).

[0019] In one aspect, the present invention contemplates a composition suitable for modifying cytosine residues in a DNA sequence, comprising a single-stranded DNA binding domain (SSB), a deaminase, a catalytically modified Cas protein, a guide RNA, and optionally one or more free and / or fused uracil glycosylase inhibitors (UGIs) to form a base editing RNP complex optionally with UGI. Similarly, the system is designed to work with a crRNA and tracrRNA-based system.

[0020] In another aspect, the present invention contemplates direct linkage of the SSB to the deaminase.

[0021] In another aspect, the present invention contemplates indirect linkage of the SSB to the deaminase.

[0022] In another aspect, the present invention contemplates that the SSB is not covalently linked to any of the deaminase, the catalytically modified Cas protein, the guide RNA, or the optional UGI.

[0023] In another aspect, the present invention contemplates covalent linkage of the deaminase to a catalytically modified Cas protein.

[0024] In another aspect, the present invention contemplates that the one or more UGIs are not covalently linked to any of the deaminase, catalytically modified Cas, or guide RNA.

[0025] In another aspect, the present invention contemplates that the one or more SSBs are derived from a virus, a prokaryote, or a eukaryote.

[0026] In another aspect, the present invention contemplates that the deaminase is selected from cytosine deaminase or adenosine deaminase.

[0027] In another aspect, the present invention contemplates that the catalytically modified Cas protein contains a catalytically inactive RuvC nuclease domain.

[0028] On the other hand, the present invention contemplates that the catalytically modified Cas protein contains a catalytically inactive RuvC nuclease domain and a catalytically inactive HNH nuclease domain.

[0029] On the other hand, the present invention contemplates that the catalytically modified Cas protein is Cas9.

[0030] On the other hand, the present invention contemplates that the catalytically modified Cas protein is Cas12.

[0031] Other RNA-guided endonucleases and their partially or fully inactive mutants are planned as described below.

[0032] In another aspect, the present invention contemplates at least one nucleic acid encoding one or more of the SSB, deaminase, catalytically modified Cas protein, guide RNA, and optionally one or more free and / or fused UGI of the composition of the invention.

[0033] In another aspect, the present invention contemplates at least one expression vector comprising a nucleic acid encoding at least one or more of the SSB, deaminase, catalytically modified Cas protein, guide RNA, and optionally one or more free and / or fused UGI of the composition of the present invention.

[0034] In another aspect, the present invention further contemplates a composition suitable for modifying cytosine residues in a DNA sequence, comprising: a deaminase, a Cas protein that catalyzes the modification, a guide RNA, and one or more free UGIs to form a base editing RNP complex with free UGIs.

[0035] In another aspect, the present invention contemplates covalent linkage of the deaminase to a catalytically modified Cas protein.

[0036] In another aspect, the present invention contemplates that the one or more UGIs are not covalently linked to any of the deaminase, the catalytically modified Cas protein, or the guide RNA.

[0037] In another aspect, the present invention contemplates that the deaminase is selected from cytosine deaminase or adenosine deaminase.

[0038] In another aspect, the present invention contemplates that the catalytically modified Cas protein contains a catalytically inactive RuvC nuclease domain.

[0039] On the other hand, the present invention contemplates that the catalytically modified Cas protein contains a catalytically inactive RuvC nuclease domain and a catalytically inactive HNH nuclease domain.

[0040] On the other hand, the present invention contemplates that the catalytically modified Cas protein is Cas9.

[0041] On the other hand, the present invention contemplates that the catalytically modified Cas protein is Cas12.

[0042] In another aspect, the present invention contemplates one or more nucleic acids encoding the deaminase, the catalytically modified Cas protein, the guide RNA, and wherein the UGI is a peptide.

[0043] In another aspect, the invention contemplates one or more expression vectors comprising one or more nucleic acids of the invention.

[0044] In another aspect, the present invention further contemplates a method for modifying a DNA sequence, the method comprising: providing 1) an RNP complex comprising a single-stranded DNA binding domain (SSB), a deaminase, a catalytically modified Cas protein and a guide RNA, and optionally; 2) one or more free uridine glycosylase inhibitors (UGIs); introducing the RNP complex and the optionally present free UGI into a recipient cell; wherein at least one cytosine residue in the DNA of the recipient cell is converted to a thymine residue.

[0045] In another aspect, the present invention contemplates a method wherein the SSB is directly linked to the deaminase.

[0046] In another aspect, the present invention contemplates a method wherein the SSB is indirectly linked to the deaminase.

[0047] In another aspect, the present invention contemplates a method wherein the deaminase is covalently linked to the catalytically modified Cas protein.

[0048] In another aspect, the present invention contemplates a method wherein the one or more UGIs are not covalently linked to the deaminase, catalytically modified Cas protein, or guide RNA.

[0049] In another aspect, the present invention contemplates a method wherein the one or more SSBs are derived from a virus, a prokaryote, or a eukaryote.

[0050] In another aspect, the present invention contemplates a method wherein the deaminase is selected from cytosine deaminase or adenosine deaminase.

[0051] In another aspect, the present invention contemplates a method wherein the catalytically modified Cas protein comprises a catalytically inactive RuvC nuclease domain.

[0052] In another aspect, the present invention contemplates a method wherein the catalytically modified Cas protein comprises a catalytically inactive RuvC nuclease domain and a catalytically inactive HNH nuclease domain.

[0053] In another aspect, the present invention contemplates a method wherein the catalytically modified Cas protein is Cas9.

[0054] In another aspect, the invention contemplates a method wherein the catalytically modified Cas protein is Cas12.

[0055] In another aspect, the present invention contemplates a method wherein the RNP complex and the UGI are introduced into a recipient cell as recombinant proteins.

[0056] In another aspect, the present invention contemplates a method wherein the RNP complex and the UGI are introduced into a recipient cell as RNA.

[0057] In another aspect, the present invention contemplates a method wherein the RNP complex and the UGI are introduced into a recipient cell using at least one expression vector.

[0058] In another aspect, the present invention contemplates a method wherein a recombinant protein or nucleic acid is introduced into a recipient cell by electroporation in the presence of a sulfonated polysaccharide-based RNP electroporation enhancer.

[0059] In another aspect, the present invention contemplates a method wherein the guide RNA has a target-complementary sequence that is 20 to 30 nucleotides long.

[0060] In another aspect, the present invention contemplates a method for modifying a DNA sequence, the method comprising: providing 1) an RNP complex comprising a deaminase peptide, a catalytically modified Cas protein, and a guide RNA; 2) one or more free uracil glycosylase inhibitors (UGI); introducing the RNP complex and the free UGI into a recipient cell; wherein at least one cytosine residue in the DNA of the recipient cell is converted to a thymine residue.

[0061] In another aspect, the present invention contemplates a method wherein the deaminase is covalently linked to a catalytically modified Cas protein.

[0062] In another aspect, the present invention contemplates a method wherein the one or more UGIs are not covalently linked to a deaminase, a catalytically modified Cas protein, or a guide RNA.

[0063] In another aspect, the present invention contemplates a method wherein the deaminase is selected from cytosine deaminase or adenosine deaminase.

[0064] In another aspect, the present invention contemplates a method wherein the catalytically modified Cas protein comprises a catalytically inactive RuvC nuclease domain.

[0065] In another aspect, the present invention contemplates a method, wherein the present invention contemplates a method, wherein the catalytically modified Cas protein contains a catalytically inactive RuvC nuclease domain and a catalytically inactive HNH nuclease domain.

[0066] In another aspect, the present invention contemplates a method wherein the catalytically modified Cas protein is Cas9.

[0067] In another aspect, the present invention contemplates a method wherein the catalytically modified Cas protein is Cas12.

[0068] In another aspect, the present invention contemplates a method wherein the RNP complex and UGI are introduced into a recipient cell as recombinant proteins.

[0069] In another aspect, the present invention contemplates a method wherein a recombinant protein is introduced into a recipient cell by electroporation in the presence of a sulfonated polysaccharide-based RNP electroporation enhancer.

[0070] In another aspect, the present invention contemplates a method wherein the guide RNA has a target-complementary sequence that is 20 to 30 nucleotides long.

[0071] In another aspect, the present invention contemplates a method for introducing a UGI into a eukaryotic cell, the method comprising: at least one recipient cell and b) at least one UGI covalently linked to at least one NLS, wherein the at least one UGI covalently linked to the at least one NLS forms a UGI-NLS molecule; transfecting the UGI-NLS molecule into the recipient cell.

[0072] The present invention further contemplates that the UGI-NLS molecule is a recombinant protein.

[0073] The present invention further contemplates that the UGI-NLS molecule is encoded by a nucleic acid.

[0074] The present invention contemplates a composition comprising at least one UGI covalently linked to at least one NLS to form a UGI-NLS molecule.

[0075] The present invention further contemplates compositions consisting essentially of at least one UGI covalently linked to at least one NLS to form a UGI-NLS molecule.

[0076] The present invention further contemplates that the UGI-NLS molecule is a recombinant protein.

[0077] The present invention further contemplates that the UGI-NLS molecule is encoded by a nucleic acid. BRIEF DESCRIPTION OF THE DRAWINGS

[0078] Figures 1A-1E Results are shown for CBEs with N-terminal SSB domain fusions. (A) Target: EMX1-15. (B) Target: HEKSite2. (C) Target: HBB03. (D) Target: RNF2. (E) Graph showing C-to-T substitutions falling within a window of a given width.

[0079] Figures 2A-2D Shown are the percentages of sequencing reads containing substitutions at each cytosine residue with and without 2xUGI fusion. (A) Target: EMX1-15. (B) Target: HEKSite2. (C) Target: HBB03. (D) Target: RNF2.

[0080] Figures 3A-3C Shown are (A) the percentage of sequencing reads mapping insertions or deletions for the four targets; (B) the percentage of C-to-T cytosine substitutions; and (C) the percentage of reads containing at least one C-to-T substitution within the protospacer sequence.

[0081] Figures 4A-4H Shown are the percentage of reads with substitutions at each cytosine in the plotted protospacer sequence, C-to-T (grey), C-to-G (white), and C-to-A (black). A-D contain data for minimal CBE variants that do not contain an SSB domain: (A) target EMX1-15; (B) target HEKS ite2; (C) target HBB03; (D) target RNF2. F-H contain data for CBE variants with an N-terminal SSB domain: (E) target EMX1-15; (F) target HEKS ite2; (G) target HBB03; (H) target RNF2.

[0082] Figure 5 Shown are the results of adding dextran sulfate to the co-transfection mixture of each CBE variant and UGI.

[0083] Figures 6A-6G Results of increasing sgRNA length are shown. AC shows the percentage of reads with C-to-T substitutions for three targets and three spacer lengths: (A) target EMX1-15; (B) target RNF2; (C) target HBB03. DG shows the percentage of reads carrying a single-reside editing allele: (D) target EMX1-15, no SSB; (E) target RNF2, no SSB; (F) target EMX1-15, with T4 SSB; (G) target RNF2, with T4 SSB.

[0084] Figures 7A-7E Results of CBE and UGI delivered via mRNA: (A) Percentage of GFP-positive cells; (B) Percentage of C-to-T conversion; (C) Percentage of C-to-G conversion; (D) Percentage of C-to-A conversion; (E) Percentage of indels; from human K562 cells after transfection.

[0085] Figure 8A and 8B Shown is the effect of using an NLS on co-delivered UGI protein, measured as the percentage of reads with any C-to-T edits, compared to a commercially available UGI (NEB) without an NLS. (A) Target EMX1-15; (B) Target HEKS ite2. Detailed Description of the Invention

[0087] definition

[0088] Unless otherwise defined, all technical and scientific terms used herein have the meanings commonly understood by those skilled in the art to which the present invention belongs. The following references provide general definitions of many of the terms used in the present invention for those skilled in the art: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd ed. 1994); Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5th Ed., R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991). As used herein, unless otherwise indicated, the following terms have the meanings assigned to them.

[0089] When introducing elements of the present disclosure or the preferred embodiments thereof, the articles "a," "an," "the," and "said" are intended to mean that there are one or more of the elements. The terms "comprising," "including," and "having" are intended to be inclusive and mean that there may be additional elements other than the listed elements.

[0090] The transitional phrases “comprising,” “consisting essentially of,” and “consisting of” have the meanings of MPEP 2111.03 (Manual of Patent Examining Procedure; U.S. Patent and Trademark Office, 9 th Ed., Rev. 2023 [R-07.2022]). Any claim using the transition phrase “consisting essentially of” will be construed to recite only the essential elements of the invention (i.e., the basic and novel features), and any additional elements recited in the dependent claims will be construed as being non-essential to the invention recited in the claims to which they are dependent. Likewise, by using the transition phrase “consisting essentially of,” any additional elements beyond the claimed elements described in the prior art reference are excluded from the claim.

[0091] As used herein, the term "endogenous sequence" refers to a chromosomal sequence that is native to a cell.

[0092] As used herein, the term "exogenous" refers to a sequence that is not native to the cell, or a chromosomal sequence that is at a different chromosomal location than its natural location in the cell's genome.

[0093] As used herein, "gene" refers to a DNA region encoding a gene product (including exons and introns), as well as all DNA regions that regulate the production of a gene product, whether or not such regulatory sequences are adjacent to the coding and / or transcribed sequences. Thus, a gene includes, but is not necessarily limited to, promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencing elements, insulators, boundary elements, replication origins, matrix attachment sites, and locus control regions.

[0094] The term "complementary" or "complementarity" refers to the association of double-stranded nucleic acids through specific hydrogen bond base pairing. The base pairing can be standard Watson-Crick base pairing (e.g., 5'-AGT C-3' pairs with the complementary sequence 3'-TCA G-5'). The base pairing can also be Hoogsteen or reverse Hoogsteen hydrogen bonding. Complementarity is usually measured relative to the double-stranded region and therefore does not include, for example, overhangs. The complementarity between the two strands of a double-stranded region can be partial and expressed as a percentage (e.g., 70%) if only some of the base pairs are complementary. Non-complementary bases are "mismatched." Complementarity can also be complete (i.e., 100%) if all base pairs of the double-stranded region are complementary.

[0095] The term "homologous" refers to the degree to which two or more sequences are identical. Two sequences are considered homologous if they hybridize to the same sequence under a defined set of conditions. Defined conditions include, but are not limited to, buffer formulation, temperature, and sequence concentration.

[0096] The term "heterologous" refers to an entity that is not endogenous or native to the cell of interest. For example, a heterologous protein refers to a protein that is derived from or originally derived from an exogenous source (e.g., an exogenously introduced nucleic acid sequence). In some cases, the heterologous protein is not normally produced by the cell of interest.

[0097] The terms "nucleic acid" and "polynucleotide" refer to deoxyribonucleotide or ribonucleotide polymers in linear or cyclic conformations and in single-stranded or double-stranded form. For the purposes of this disclosure, these terms should not be construed as limiting the length of the polymer. These terms can include known analogs of natural nucleotides, as well as nucleotides modified in base, sugar and / or phosphate moieties (e.g., phosphorothioate backbones). Typically, analogs of a particular nucleotide have the same base pairing specificity; that is, an analog of A will base pair with T.

[0098] The term "synthetic nucleic acid" refers to a nucleotide sequence synthesized in vitro (e.g., in a laboratory and manually or using a nucleic acid synthesizer), and wherein the sequence is not found in nature. The sequence can be, for example, DNA or RNA or modifications thereof as described below, can be of any length and can be any nucleotide sequence, so long as the sequence is not naturally occurring.

[0099] The term "nucleotide" refers to a deoxyribonucleotide or a ribonucleotide. Nucleotide can be a standard nucleotide (i.e., adenosine, guanosine, cytidine, thymidine, and uridine) or a nucleotide analog. Nucleotide analogs refer to nucleotides with modified purine or pyrimidine bases or modified ribose moieties. Nucleotide analogs can be naturally occurring nucleotides (e.g., inosine) or non-naturally occurring nucleotides. Non-limiting examples of modifications to the sugar or base moiety of a nucleotide include adding (or removing) acetyl, amino, carboxyl, carboxymethyl, hydroxyl, methyl, phosphoryl, and thiol groups, and the carbon and nitrogen atoms of the base are replaced by other atoms (e.g., 7-deazapurine). Nucleotide analogs also include dideoxynucleotides, 2'-O-methyl nucleotides, locked nucleic acids (LNA), peptide nucleic acids (PNA), and morpholines.

[0100] The terms "polypeptide" and "protein" are used interchangeably to refer to a polymer of amino acid residues.

[0101] In the context of the present invention, the term "inactivated" may refer to the deletion of one or more amino acids in the target protein or the substitution of one or more amino acids, so that one or more functions of the protein are eliminated or reduced to an activity level of less than 75%, less than 50%, less than 40%, less than 30%, less than 20%, less than 15%, less than 10%, less than 5%, less than 4%, less than 3%, less than 2% or less than 1% of the activity level of the active protein. In the present invention, the Cas9-like protein (e.g., Cas9) is catalytically inactivated due to having two amino acids substituted with alanine residues as described in detail elsewhere in this specification, thereby inhibiting its ability to cut double-stranded DNA. Reduced activity can be referred to as "partial inactivation". In the context of the present invention, the term "catalytically modified" refers to an inactivated or partially inactivated target protein, and refers to one or more catalytic activities of the target protein that have been reduced or eliminated. The nuclease activity of the Cas protein of the present invention can be partially or completely inactivated, making the Cas protein a nickase (cutting only one DNA chain; discussed in more detail below) or catalytically inactive (not cutting the DNA chain), respectively.

[0102] In the context of the present invention, the term "directly linked" with respect to proteins and polypeptides refers to two proteins being linked together (i.e., fused) (e.g., via peptide bonds) to form a continuous protein or polypeptide, wherein no additional amino acid residues are incorporated between the two linked / fused proteins.

[0103] In the context of the present invention, the term "indirect linkage" refers to the incorporation of one or more amino acids between two joined / fused proteins.

[0104] Techniques for determining nucleic acid and amino acid sequence identity are known in the art. Typically, such techniques include determining the nucleotide sequence of the mRNA of a gene and / or determining the amino acid sequence encoded thereby, and comparing these sequences with a second nucleotide or amino acid sequence. Genomic sequences can also be determined and compared in this manner. Typically, identity refers to the exact nucleotide-to-nucleotide or amino acid-to-amino acid correspondence of two polynucleotide or polypeptide sequences, respectively. Two or more sequences (polynucleotide or amino acid) can be compared by determining their percent identity. The percent identity of two sequences (nucleic acid or amino acid sequences) is the number of exact matches between the two compared sequences divided by the length of the shorter sequence and multiplied by 100. Approximate alignments of nucleic acid sequences are provided by the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2: 482-489 (1981). The algorithm can be applied to amino acid sequences by using a scoring matrix developed by Dayhoff Atlas of Protein Sequences and Structure, MO Dayhoff ed., 5 suppl. 3: 353-358, National Biomedical Research Foundation, Washington, DC, USA, and standardized by Gribskov, Nucl. Acids Res. 14 (6): 6745-6763 (1986). An exemplary embodiment of the algorithm for determining percentage sequence identity is provided by the Genetic Computer Group (Madison, WI) in the "BestFit" utility application. Other suitable programs for calculating percentage identity or similarity between sequences are generally known in the art, for example, another alignment program is BLAST, used with default parameters. For example, BLASTN and BLASTP can be used using the following default parameters: genetic code = standard; filter = none; strand = both; cutoff = 60; expectation = 10; Matrix = BLOSUM62; Descriptions = 50 sequences; sort by = HIGH SCORE; Databases = non-redundant, GenBank + EMBL + DDBJ + PDB + GenBank CDS translation + Swiss protein + Spupdate + PIR. Details of these programs can be found on the GenBank website.

[0105] As various changes could be made in the above-described units and methods without departing from the scope of the invention, it is intended that all matter contained in the above description and examples given below shall be interpreted as illustrative and not restrictive.

[0106] An understanding of the present invention will be aided by an understanding of the CRISPR / Cas protein system generally and in the context of the present invention.

[0107] CRISPR / Cas9-based systems

[0108] In its basic form, the CRISPR / Cas9 system introduces double-strand breaks near the binding site of the guide RNA (gRNA). The Cas9 protein and gRNA form a ribonucleoprotein (RNP) complex. The complex itself can be transfected into recipient cells (e.g., by using extracellular vesicles), or a plasmid or viral vector encoding the complex can be used. The gRNA targets the complex to the desired location in the genome by forming an R-loop (a three-stranded nucleic acid structure consisting of a DNA:RNA hybrid and displaced single-stranded DNA), where the Cas9 protein (nuclease) causes a double-stranded DNA break at which the sequence can be modified. Such modifications can take the form of non-homologous end joining (NHEJ), random small insertions or deletions (indels), or homology-directed repair (HDR). NHEJ can be used to produce knockout mutations, and HDR can be used to make desired modifications to the target sequence.

[0109] Cytosine base editors

[0110] As mentioned above, traditional CRISPR / Cas9 technology has efficiency and specificity challenges. Cytosine base editing (Komor, 2016) was developed to improve the efficiency and specificity of CRISPR / Cas9 technology. Cytosine base editing allows one target DNA base pair to be directly and irreversibly converted to another target DNA base pair without the need for dsDNA backbone breakage or donor template. Instead, the target cytosine (C) is converted to uracil (U) by a cytidine deaminase bound to the RNP complex. Uracil has the base pairing properties of thymine (T). Therefore, during DNA replication or repair, the targeted C:G pair is converted to a T:A pair.

[0111] In one aspect of the invention, an ssDNA binding domain (SSB) is used to limit bystander editing within the R-loop. Bystander editing is the conversion of adjacent non-target cytosine residues within the R-loop into thymine. This is important because bystander editing limits the use of cytosine base editors as precise gene editing tools (e.g., to correct pathogenic mutations). SSB is connected to a cytosine base editor (CBE) by, for example, covalent interactions. Although not limited to theory, it is believed that SSB can compete with CBE for binding to the ssDNA region formed after Cas9 target binding and R-loop formation.

[0112] (I) RNA-guided endonucleases

[0113] RNA-guided endonucleases, such as Cas9, can include at least one nuclear localization signal (NLS), at least one nuclease domain, and at least one domain that interacts with a guide RNA (gRNA) to guide the endonuclease / deaminase complex of the present invention to a specific cytosine for deamination. Nucleic acids encoding RNA-guided endonucleases are also known, as well as methods for modifying chromosomal sequences of eukaryotic cells or embryos using RNA-guided endonucleases. RNA-guided endonucleases interact with specific gRNAs, and each gRNA guides the endonuclease to a specific target site where the deaminase converts the target cytosine into a uracil residue, which can result in the conversion of CG base pairs into AT base pairs. Since specificity is provided by gRNA, RNA-based endonucleases are essentially universal and can be used with different gRNAs to target different genomic sequences. Methods disclosed herein can be used for targeting and modifying specific chromosomal sequences at the targeted position in a cell or embryonic genome. In addition, targeting is specific and has limited off-target effects.

[0114] Many forms of guide RNA (gRNA) are known in the art. Generally, gRNA is an RNA molecule that can guide an RNA binding protein or endonuclease to a specific nucleic acid sequence / target site through base pairing. The gRNA can comprise a single RNA molecule, such as crRNA, or two RNA molecules, such as crRNA and tracrRNA (or trRNA). In some embodiments, it may additionally comprise an auxiliary RNA or DNA molecule. In some embodiments, crRNA and tracrRNA can be covalently linked together to form a chimeric guide RNA or a single guide RNA (sgRNA). It is also well established in the art that gRNA can be introduced into target cells in different forms alone or in combination with its cognate gRNA binding protein or endonuclease. It can be expressed from a DNA vector introduced into the target cell. It can be synthesized by in vitro transcription or by chemical reaction before being introduced into the target cell. It will be appreciated by those skilled in the art that many chemical modifications can be made to the gRNA by chemical synthesis. For example, certain modifications, such as 2'-O methyl modifications and phosphorothioate bond modifications, can be introduced into the gRNA to change its stability or performance. Non-standard nucleotides, such as DNA and LNA, can also be introduced into the gRNA during chemical synthesis to change its specificity or performance. Guide RNAs that may have different forms or may contain different chemical modifications may be used in conjunction with the present disclosure without departing from the spirit of the present disclosure.

[0115] The present disclosure provides fusion proteins, wherein the fusion proteins include CRISPR / Cas-like proteins or fragments thereof, wherein the Cas-like proteins are completely or partially catalytically inactivated, retaining their ability to bind DNA, but unable to produce double-strand breaks in the target DNA. Each fusion protein is guided to a specific chromosomal sequence by a specific gRNA, wherein an associated (e.g., tethered or otherwise connected) cytosine deaminase converts the target cytosine into uracil.

[0116] RNA-guided endonucleases can include at least one nuclear localization signal that allows the endonuclease to enter the nucleus of eukaryotic cells and embryos (e.g., non-human one-cell embryos). RNA-guided endonucleases also include at least one nuclease domain and at least one domain that interacts with gRNA. RNA-guided endonucleases are directed to specific nucleic acid sequences (or target sites) via gRNA. gRNA interacts with RNA-guided endonucleases and target sites so that once directed to the target site, the associated cytosine deaminase can convert the target cytosine into uracil. Since gRNA provides specificity for targeted cutting, RNA-guided endonucleases are universal (as long as their ability to cut DNA is disabled) and can be used with different gRNAs to modify different target cytosines. RNA-guided endonucleases can be proteins, can be encoded by isolated nucleic acids (i.e., RNA or DNA), can be encoded by vectors containing nucleic acids encoding RNA-guided endonucleases, and can be protein-RNA complexes comprising RNA-guided endonucleases plus gRNA.

[0117] RNA-guided endonucleases can be derived from clustered regularly interspersed short palindromic repeats (CRISPR) / CRISPR-associated (Cas) systems. As known to those of ordinary skill in the art, CRISPR / Cas systems can be type I, type II, or type III systems. Non-limiting examples of suitable CRISPR / Cas proteins include Cas3, Cas4, Cas5, Cas5e (or CasD), Cas6, Cas6e, Cas6f, Cas7, Cas 8a1, Cas 8a2, Cas8b, Cas8c, Cas9, Cas10, Cas10d, Cas12, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (or CasA), Cse2 (or CasB), Cse3 (or CasE), Cse4 (or CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Csr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csz1, Csx15, Csf1, Csf2, Csf3, Csf4, and Cu1966. One of ordinary skill in the art will be able to modify any RNA-guided nuclease to inactivate its catalytic activity for use with the cytosine base editor system.

[0118] In one embodiment, the RNA-guided endonuclease is derived from a type II CRISPR / Cas system. In a specific embodiment, the RNA-guided endonuclease is derived from a Cas9 protein. The Cas9 protein can be from, for example, Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Microscilla marina, Burkholderiales bacteria, Polaromonas naphthalenivorans, Polaromonas sp., Crocohaera wasii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp.), Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas shaloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena), Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, or Acaryochloris marina.

[0119] Typically, CRISPR / Cas proteins include at least one RNA recognition domain and / or RNA binding domain. RNA recognition and / or RNA binding domain interacts with guide RNA. CRISPR / Cas proteins also typically include a nuclease domain (i.e., a DNase or RNase domain; however, for the purposes of cytosine base editors, these domains are disabled), a DNA binding domain, a helicase domain, an RNase domain, a protein-protein interaction domain, a dimerization domain, and other domains.

[0120] The CRISPR / Cas-like protein can be a wild-type CRISPR / Cas protein, a modified CRISPR / Cas protein, or a fragment of a wild-type or modified CRISPR / Cas protein. The CRISPR / Cas-like protein can be modified to increase nucleic acid binding affinity and / or specificity, change enzymatic activity (e.g., inactivate its ability to cut DNA), and / or change another property of the protein. For example, the nuclease (i.e., DNase, RNase) domain of the CRISPR / Cas-like protein can be modified, deleted, or inactivated. Alternatively, the CRISPR / Cas-like protein can be truncated to remove domains that are not essential for the function of the fusion protein. The CRISPR / Cas-like protein can also be truncated or modified to optimize the activity of the effector domain of the fusion protein.

[0121] In some embodiments, CRISPR / Cas-like proteins can be derived from wild-type Cas9 proteins or fragments thereof. In other embodiments, CRISPR / Cas-like proteins can be derived from modified Cas9 proteins. For example, the amino acid sequence of the Cas9 protein can be modified to change one or more properties of the protein (e.g., nuclease activity, affinity, stability, etc.). Alternatively, the domains of the Cas9 protein that do not participate in RNA-guided cleavage can be eliminated from the protein so that the modified Cas9 protein is smaller than the wild-type Cas9 protein.

[0122] Typically, the Cas9 protein includes at least two nuclease (i.e., DNase) domains. For example, the Cas9 protein may include a RuvC-like nuclease domain and an HNH-like nuclease domain. RuvC and HNH domains act together to cut a single strand to produce a double-strand break in DNA. (Jinek et al., Science, 337: 816-821). In some embodiments, the Cas9-derived protein can be modified to contain only one functional nuclease domain (RuvC-like or HNH-like nuclease domain). For example, the Cas9-derived protein can be modified so that one of the nuclease domains is deleted or mutated so that it no longer works (i.e., there is no nuclease activity). In some embodiments in which one of the nuclease domains is inactive, the Cas9-derived protein can introduce a nick into a double-stranded nucleic acid (this protein is referred to as a "nickase"), but does not cut double-stranded DNA. For example, the conversion of aspartic acid to alanine (D10A) in the RuvC-like domain converts the Cas9-derived protein into a nickase. Similarly, the conversion of histidine to alanine (H840A or H839A) in the HNH domain converts the Cas9-derived protein into a nickase. Each nuclease domain can be modified using well-known methods, such as site-directed mutagenesis, PCR-mediated mutagenesis, and full gene synthesis, as well as other methods known in the art. Modification of these two domains results in inactivation of nuclease and nickase activity.

[0123] The RNA-guided endonuclease can comprise at least one nuclear localization signal (NLS). Typically, the NLS comprises a stretch of basic amino acids. Nuclear localization signals are known in the art (see, e.g., Lange et al., J. Biol. Chem., 2007, 282: 5101-5105). For example, in one embodiment, the NLS can be a monopartite sequence, such as PKKKRKV (SEQ ID NO: 30) or PKKKRRV (SEQ ID NO: 31). In another embodiment, the NLS can be a bipartite sequence. In yet another embodiment, the NLS can be KRPAATKKAGQAKKKK (SEQ ID NO: 32). The NLS can be located at the N-terminus, C-terminus, or an internal position of the RNA-guided endonuclease.

[0124] In some embodiments, the RNA-guided endonuclease may further include at least one cell-penetrating domain. In one embodiment, the cell-penetrating domain may be a cell-penetrating peptide sequence derived from HIV-1 TAT protein. For example, TAT cell-penetrating sequence may be GRKKRRQRRRPPQPKKKRKV (SEQ ID NO: 33). In another embodiment, the cell-penetrating domain may be TLM (PLSSIFSRIGDPPKKKRKV, SEQ ID NO: 34), a cell-penetrating peptide sequence derived from human hepatitis B virus). In yet another embodiment, the cell-penetrating domain may be MPG (GALFLGWLGAAGSTMGAPKKKRKV; SEQ ID NO: 35 or GALFLGFLGAAGSTMGAWSQPKKKRKV; SEQ ID NO: 36). In another embodiment, the cell-penetrating domain may be Pep-1 (KETWWETWWTEWSQPKKKRKV; SEQ ID NO: 37), VP22, a cell-penetrating peptide or a polyarginine peptide sequence from herpes simplex virus. The cell penetrating domain can be located at the N-terminus, C-terminus, or an internal location of the protein.

[0125] In other embodiments, the RNA-guided endonuclease may further comprise at least one marker domain. Non-limiting examples of marker domains include fluorescent proteins, purification tags, and epitope tags. In some embodiments, the marker domain may be a fluorescent protein. Non-limiting examples of suitable fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, EGFP, Emerald, Azami Green, monomeric Azami Green, CopGFP, AceGFP, ZsGreen1), yellow fluorescent proteins (e.g., YFP, EYFP, Citrine, Venus, YPet, PhiYFP, ZsYellow 1), blue fluorescent proteins (e.g., EBFP, EBFP2, Azurite, mKalama1, GFPuv, Sapphire, T-Sapphire), cyan fluorescent proteins (e.g., ECFP, Cerulean, CyPet, AmCyan1, Midoriishi-Cyan), red fluorescent proteins (mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed monomer, HcRed-Tandem, HcRed1, AsRed2, eqFP), In some embodiments, the marker domain may be a purification tag and / or an epitope tag. Examples of the marker domain include, but are not limited to, glutathione-S-transferase (GST), chitin binding protein (CBP), maltose binding protein, thioredoxin (TRX), poly (NANP), tandem affinity purification (TAP) tags, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, HA, nus, Softag 1, Softag 3, Strep, SBP, Glu-G lu, HSV, KT3, S, S1, T7, V5, VSV-G, 6xHis, (SEQ ID NO: 44)), biotin carboxyl carrier protein (BCCP), and calmodulin.

[0126] In certain embodiments, the RNA-guided endonuclease can be part of a protein-RNA complex comprising a gRNA. The gRNA interacts with the RNA-guided endonuclease to guide the endonuclease to a specific target site, wherein, for example, the 5' end of the guide RNA base pairs with a specific protospacer sequence.

[0127] (II) Fusion protein

[0128] Another aspect of the present disclosure provides a fusion protein comprising a CRISPR / Cas-like protein or a fragment thereof and, for example, one or more SSBs or one or more UGIs. The CRISPR / Cas-like protein is directed to a target site via a gRNA, where the effector modifies or affects the targeted nucleic acid sequence. In the present invention, an "effector domain" is a linked deaminase. The fusion protein may further comprise at least one additional domain selected from a nuclear localization signal, a cell penetrating domain, or a tagging domain.

[0129] (a) CRISPR / Cas-like proteins

[0130] The fusion protein comprises a CRISPR / Cas-like protein or a fragment thereof. CRISPR / Cas-like proteins are described in detail in Section (I) above. The CRISPR / Cas-like protein can be located at the N-terminus, C-terminus, or an internal position of the fusion protein.

[0131] In some embodiments, the CRISPR / Cas-like protein of the fusion protein can be derived from the Cas9 protein. The protein derived from Cas9 can be wild type, modified, or a fragment thereof. In some embodiments of the present invention, the protein derived from Cas9 is modified to inactivate two functional nuclease domains (RuvC-like or HNH-like nuclease domains). In some embodiments, both the RuvC-like nuclease domain and the HNH-like nuclease domain can be modified or eliminated so that the protein derived from Cas9 cannot produce a gap in double-stranded nucleic acid or cut double-stranded nucleic acid. In other embodiments, all nuclease domains of Cas9-derived proteins can be modified or eliminated so that Cas9-derived proteins lack all nuclease activities. In addition, RuvC-like domains or HNH-like domains can be inactivated independently of each other.

[0132] In any of the above embodiments, any or all of the nuclease domains can be inactivated by one or more deletion mutations, insertion mutations, and / or substitution mutations using well-known methods (e.g., site-directed mutagenesis, PCR-mediated mutagenesis, and total gene synthesis), as well as other methods known in the art.

[0133] (III) Nucleic acid encoding RNA-guided endonuclease or fusion protein

[0134] Another aspect of the present disclosure provides nucleic acids encoding any of the RNA-guided endonucleases or fusion proteins described above in Sections (I) and (II), respectively. The nucleic acid can be RNA or DNA. In one embodiment, the nucleic acid encoding the RNA-guided endonuclease or fusion protein is mRNA. The mRNA can be 5' capped and / or 3' polyadenylated. In another embodiment, the nucleic acid encoding the RNA-guided endonuclease or fusion protein is DNA. The DNA can be present in a vector (see below).

[0135] The nucleic acid encoding the RNA-guided endonuclease or fusion protein can be codon-optimized to effectively translate into the protein in the cell, plant, or animal of interest. For example, codons can be optimized for expression in humans, mice, rats, hamsters, cattle, pigs, cats, dogs, fish, amphibians, plants, yeast, insects, etc. Programs for codon optimization are available as free software. Commercial codon optimization programs are also available.

[0136] In some embodiments, the DNA of the nuclease or fusion protein of coding RNA guidance can be operably connected with at least one promoter control sequence.In some iterations, the DNA coding sequence can be operably connected with the promoter control sequence for expression in eukaryotic cells or animals of interest.Promoter control sequence can be constitutive, regulated or tissue-specific.Suitable constitutive promoter control sequence includes but is not limited to cytomegalovirus immediate early promoter (CMV), simian virus (SV40) promoter, adenovirus major late promoter, Rous sarcoma virus (RSV) promoter, mouse mammary tumor virus (MMTV) promoter, phosphoglycerate kinase (PGK) promoter, elongation factor (EF1)-α promoter, ubiquitin promoter, actin promoter, tubulin promoter, immunoglobulin promoter, its fragment or the combination of any one of the foregoing.The example of suitable regulation promoter control sequence includes but is not limited to those regulated by heat shock, metal, steroid, antibiotic or alcohol. Non-limiting examples of tissue-specific promoters include B29 promoter, CD14 promoter, CD43 promoter, CD45 promoter, CD68 promoter, desmin promoter, elastase-1 promoter, endoglin promoter, fibronectin promoter, Flt-1 promoter, GFAP promoter, GPIIb promoter, ICAM-2 promoter, INF-β promoter, Mb promoter, Nphs1 promoter, OG-2 promoter, SP-B promoter, SYN1 promoter and WASP promoter. The promoter sequence can be wild type, or can be modified to express more effectively or efficiently. In an exemplary embodiment, the encoding DNA can be operably linked to a CMV promoter for constitutive expression in mammalian cells.

[0137] In certain embodiments, the sequence of the endonuclease or fusion protein guided by the coding RNA can be operably connected with the promoter sequence identified by phage RNA polymerase for in vitro mRNA synthesis. In such embodiments, the RNA of in vitro transcription can be purified for the method described in detail below in (IV) and (V) sections. For example, the promoter sequence can be a variant of T7, T3 or SP6 promoter sequence or T7, T3 or SP6 promoter sequence. In an exemplary embodiment, the DNA encoding the fusion protein is operably connected with the T7 promoter for in vitro mRNA synthesis using T7 RNA polymerase.

[0138] In alternative embodiments, the sequence encoding the RNA-guided endonuclease or fusion protein can be operably linked to a promoter sequence for in vivo expression of the RNA-guided endonuclease or fusion protein in bacteria or eukaryotic cells. In such embodiments, the expressed protein can be purified for use in the methods described in detail below in sections (IV) and (V). Suitable bacterial promoters include, but are not limited to, the T7 promoter, the lac operon promoter, the trp promoter, variants thereof, and combinations thereof. An exemplary bacterial promoter is tac, which is a hybrid of the trp and lac promoters. Non-limiting examples of suitable eukaryotic promoters are listed above.

[0139] In other aspects, the DNA encoding the RNA-guided endonuclease or fusion protein can also be linked to a polyadenylation signal (e.g., SV40 polyA signal, bovine growth hormone (BGH) polyA signal, etc.) and / or at least one transcription termination sequence. In addition, the sequence encoding the RNA-guided endonuclease or fusion protein can also be linked to a sequence encoding at least one nuclear localization signal, at least one cell penetrating domain, and / or at least one tagging domain, which are described in detail in Section (I) above.

[0140] In various embodiments, the DNA encoding the RNA-guided endonuclease or fusion protein can be present in a vector. Suitable vectors include plasmid vectors, plasmids, cosmids, artificial / minichromosomes, transposons, and viral vectors (e.g., lentiviral vectors, adeno-associated viral vectors, etc.). In one embodiment, the DNA encoding the RNA-guided endonuclease or fusion protein is present in a plasmid vector. Non-limiting examples of suitable plasmid vectors include pUC, pBR322, pET, pBluescript, and variants thereof. The vector can contain additional expression control sequences (e.g., enhancer sequences, Kozak sequences, polyadenylation sequences, transcription termination sequences, etc.), selection marker sequences (e.g., antibiotic resistance genes), replication origins, etc. Additional information can be found in the following literature: "Current Protocols in Molecular Biology" Ausubel, et al., John Wiley & Sons, New York, 2003 or "Molecular Cloning: A Laboratory Manual" Sambrook & Russell, Cold Spring Harbor Press, Cold Spring Harbor, NY, 3 rd edition,2001.

[0141] In some embodiments, the expression vector comprising a sequence encoding an RNA-guided endonuclease or fusion protein may further comprise a sequence encoding a gRNA. The sequence encoding the gRNA is typically operably linked to at least one transcriptional control sequence for expression of the gRNA in cells or embryos of interest. For example, the DNA encoding the gRNA can be operably linked to a promoter sequence recognized by RNA polymerase III (Pol III). Examples of suitable Pol III promoters include, but are not limited to, mammalian U6, U3, H1, and 7SL RNA promoters.

[0142] (IV) Method for modifying chromosomal sequences using RNA-guided endonucleases

[0143] Another aspect of the present disclosure includes a method for modifying the chromosomal sequence in a eukaryotic cell or embryo. The method includes introducing into a eukaryotic cell or embryo (i) at least one enzymatically inactivated RNA-guided endonuclease (or encoding nucleic acid), it includes at least one nuclear localization signal or encodes the nucleic acid of at least one RNA-guided endonuclease, the RNA-guided endonuclease includes at least one nuclear localization signal, (ii) at least one gRNA or the DNA encoding at least one gRNA, and optionally present (iii) at least one cytosine deaminase, (iv) uracil DNA glycosylase inhibitor (UGI). The method also includes culturing cells or embryos so that each gRNA guides the enzymatically inactivated RNA-guided endonuclease to the target site in the chromosomal sequence, wherein cytosine deaminase converts cytosine into uracil at the target site, and repairs (i.e., converts) uracil by a DNA repair process so that the chromosomal sequence is modified.

[0144] Thus, as discussed herein, the targeted chromosomal sequence can be modified or inactivated. For example, a single nucleotide change (SNP) can produce an altered protein product or introduce a "stop" codon into the reading frame of a coding sequence, thereby inactivating or "knocking out" the sequence so that no protein product is produced.

[0145] In other embodiments, the method may include introducing two (or more) RNA-guided endonucleases (or encoding nucleic acids) and two gRNAs (or encoding DNA) into cells or embryos, wherein the RNA-guided endonucleases modify two cytosine bases. The cytosines can be within a few base pairs, within tens of base pairs, or can be separated by thousands of base pairs.

[0146] (a) RNA-guided endonucleases

[0147] The method includes introducing at least one RNA-guided endonuclease into a cell or embryo, wherein the endonuclease comprises at least one nuclear localization signal or a nucleic acid encoding at least one RNA-guided endonuclease, and the endonuclease comprises at least one nuclear localization signal. Such RNA-guided endonucleases and nucleic acids encoding RNA-guided endonucleases are described in sections (I) and (III) above, respectively. Such RNA-guided endonucleases can be pre-loaded with gRNA.

[0148] In some embodiments, RNA-guided endonucleases can be introduced into cells or embryos as isolated proteins. In such embodiments, RNA-guided endonucleases can further comprise at least one cell-penetrating domain that promotes the cellular uptake of proteins. In other embodiments, RNA-guided endonucleases can be introduced into cells or embryos as mRNA molecules. In other embodiments, RNA-guided endonucleases can be introduced into cells or embryos as DNA molecules. Typically, the DNA sequence encoding the fusion protein is operably connected to a promoter sequence that will work in the cell of interest or the embryo. The DNA sequence can be linear, or the DNA sequence can be a part of a vector. In other embodiments, the fusion protein can be introduced into cells or embryos as an RNA-protein complex comprising a fusion protein and gRNA.

[0149] In an alternative embodiment, the DNA encoding the RNA-guided endonuclease may further comprise a sequence encoding a gRNA. Typically, each sequence encoding the RNA-guided endonuclease and gRNA is operably connected to an appropriate promoter control sequence that allows the RNA-guided endonuclease and gRNA to be expressed in cells or embryos, respectively. The DNA sequence encoding the RNA-guided endonuclease and gRNA may further comprise additional expression control, regulation, and / or processing sequences. The DNA sequence encoding the RNA-guided endonuclease and gRNA may be linear or may be part of a vector.

[0150] (b) Guide RNA (gRNA)

[0151] The method further comprises introducing into the cell or embryo at least one guide RNA (gRNA) or DNA encoding at least one gRNA, wherein the gRNA interacts with the enzymatically inactivated RNA-guided endonuclease to guide the endonuclease to a specific target site in the chromosomal sequence.

[0152] Each gRNA can contain three regions: a first region complementary to the target site in the chromosomal sequence, a second internal region forming a stem-loop structure, and a third region that essentially remains single-stranded. The first region of each gRNA is different so that each gRNA guides the fusion protein to a specific target site. The second and third regions of each gRNA can be the same in all gRNAs.

[0153] The first region of gRNA (referred to as spacer) is complementary to the sequence at the target site in the chromosome sequence (i.e., pre-spacer sequence) so that the first region of gRNA can be base-paired with the target site. In various embodiments, the first region of gRNA can include about 10 nucleotides to more than about 25 nucleotides. For example, the length of the base-pairing region between the target site in the first region of gRNA and the chromosome sequence can be about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 23, 24, 25 or more than 25 nucleotides. In an exemplary embodiment, the length of the first region of gRNA is about 19, 20, 21, 22 or 23 nucleotides.

[0154] The gRNA also includes a second region forming a secondary structure. In some embodiments, the secondary structure includes a stem (or hairpin) and a loop. The length of the loop and the stem can vary. For example, the length of the loop can be about 3 to about 10 nucleotides, and the length of the stem can be about 6 to about 20 base pairs. The stem can include one or more projections of 1 to about 10 nucleotides. Therefore, the total length of the second region can be within the length range of about 16 to about 60 nucleotides. In an exemplary embodiment, the length of the loop is about 4 nucleotides, and the stem includes about 12 base pairs.

[0155] The gRNA may also include a third region that remains substantially single-stranded. Thus, the third region has no complementarity with any chromosomal sequence in the cell of interest and has no complementarity with the rest of the gRNA. The length of the third region may vary. Typically, the length of the third region is greater than about 4 nucleotides. For example, the length of the third region may be in the range of about 5 to about 60 nucleotides.

[0156] The combined length of the second and third regions (also referred to as universal or scaffold regions) of the gRNA can be in the range of about 20 to about 120 nucleotides in length. In one aspect, the combined length of the second and third regions of the gRNA is in the range of about 20 to about 100 nucleotides in length.

[0157] In some embodiments, gRNA comprises a single molecule containing all three regions, referred to as sgRNA. In other embodiments, gRNA can comprise two separate molecules. The first RNA molecule can comprise half of the "stem" of the first region of the gRNA and the second region of the gRNA, referred to as crRNA. The second RNA molecule can comprise the other half of the "stem" of the second region of the gRNA and the third region of the gRNA, referred to as tracrRNA. Therefore, in this embodiment, the first and second RNA molecules each contain nucleotide sequences that are complementary to each other. For example, in one embodiment, the first and second RNA molecules each contain a sequence (about 6 to about 20 nucleotides) that is base-paired with another sequence to form a functional gRNA.

[0158] In some embodiments, the gRNA can be introduced into a cell or embryo as an RNA molecule. The RNA molecule can be transcribed in vitro. Alternatively, the RNA molecule can be chemically synthesized.

[0159] In other embodiments, gRNA can be introduced into cells or embryos as a DNA molecule. In this case, the DNA encoding the gRNA can be operably connected to a promoter control sequence for expressing the gRNA in cells or embryos of interest. For example, the RNA coding sequence can be operably connected to a promoter sequence recognized by RNA polymerase III (Pol III). Examples of suitable Pol III promoters include but are not limited to mammalian U6 or H1 promoters. In exemplary embodiments, the RNA coding sequence is connected to a mouse or human U6 promoter. In other exemplary embodiments, the RNA coding sequence is connected to a mouse or human H1 promoter.

[0160] The DNA molecule encoding the gRNA can be linear or circular. In some embodiments, the DNA sequence encoding the gRNA can be a part of a vector. Suitable vectors include plasmid vectors, plasmids, cosmids, artificial / minichromosomes, transposons and viral vectors. In an exemplary embodiment, the DNA encoding the gRNA is present in a plasmid vector. Non-limiting examples of suitable plasmid vectors include pUC, pBR322, pET, pBluescript and variants thereof. The vector can include other expression control sequences (e.g., enhancer sequences, Kozak sequences, polyadenylation sequences, transcription termination sequences, etc.), selection marker sequences (e.g., antibiotic resistance genes), origins of replication, etc.

[0161] In embodiments where both the RNA-guided endonuclease and the gRNA are introduced into the cell as DNA molecules, each can be part of different molecules (e.g., one vector containing the coding sequence for the fusion protein and a second vector containing the coding sequence for the gRNA), or both can be part of the same molecule (e.g., one vector containing the coding (and regulatory) sequences for both the fusion protein and the gRNA).

[0162] (c) Target site

[0163] The RNA-guided endonuclease is combined with gRNA to guide the target site in the chromosomal sequence, wherein the RNA-guided endonuclease (enzymatic inactivation) is combined with the chromosomal sequence. Except for the sequence next to the consensus sequence, the target site has no sequence restrictions. The consensus sequence is also referred to as the pre-spaced adjacent motif (PAM). The example of PAM includes but is not limited to NGG (SEQ ID NO: 38), NGGNG (SEQ ID NO: 39) and NNAGAAW (SEQ ID NO: 40) (wherein N is defined as any nucleotide, and W is defined as A or T). As described in detail above in part (IV) (b), the spacer of gRNA is complementary to the pre-spacer sequence of the target sequence. Typically, the spacer length of gRNA is about 19 to 21 nucleotides. Therefore, in some aspects, the sequence of the target site in the chromosomal sequence is 5'-N 19-21 -NGG-3'.

[0164] The target site can be in the coding region of a gene, in an intron of a gene, in a control region of a gene, in a non-coding region between genes, etc. The gene can be a protein coding gene or an RNA coding gene. The gene can be any gene of interest.

[0165] (d) Introducing cells or embryos

[0166] RNA-targeted endonucleases (or encoding nucleic acids) and gRNA (or encoding DNA) can be introduced into cells or embryos in a variety of ways. In some embodiments, transfected cells or embryos. Suitable transfection methods include calcium phosphate-mediated transfection, nuclear transfection (or electroporation), cationic polymer transfection (e.g., DEAE-dextran or polyethyleneimine), viral transduction, virosome transfection, virion transfection, liposome transfection, cationic liposome transfection, immunoliposome transfection, non-liposomal lipid transfection, dendrimer transfection, heat shock transfection, magnetofection, lipofection, gene gun delivery, puncture transfection (impalefection), sonoporation, optical transfection, and proprietary agent-enhanced nucleic acid uptake. Transfection methods are well known in the art (see, for example, "Current Protocols in Molecular Biology" Ausubel et al., John Wiley & Sons, New York, 2003 or "Molecular Cloning: A Laboratory Manual" Sambrook & Russell, Cold Spring Harbor Press, Cold Spring Harbor, NY, 3 rd In other embodiments, the molecule is introduced into a cell or embryo by microinjection. Typically, the embryo is a fertilized, one-cell stage embryo of the species of interest. For example, the molecule can be injected into the pronucleus of a one-cell embryo.

[0167] RNA-targeted endonuclease (or encoding nucleic acid), gRNA (or DNA encoding gRNA) and optionally present uracil glycosylase inhibitor can be introduced into cells or embryos simultaneously or sequentially. The ratio of RNA-targeted endonuclease (or encoding nucleic acid) to gRNA (or encoding DNA) will generally be about stoichiometric so that they can form RNA-protein complexes. In one embodiment, the DNA encoding RNA-targeted endonuclease and the DNA encoding gRNA are delivered together in a plasmid vector.

[0168] (e) Cultured cells or embryos

[0169] The method further includes maintaining the cells or embryos under appropriate conditions such that the gRNA guides the cytosine base editor fusion protein to the target site in the chromosomal sequence, and the cytosine deaminase introduces at least one cytosine to uracil conversion in the chromosomal sequence, so that the chromosomal sequence is modified by substitution of at least one nucleotide.

[0170] In embodiments where a premature stop codon is introduced, the chromosomal sequence can be inactivated or “knocked out.” An inactivated protein-encoding chromosomal sequence does not produce the protein encoded by the wild-type chromosomal sequence.

[0171] In embodiments where the chromosomal sequence is modified without knocking out or inactivating the sequence, the encoded protein can be 1) modified to produce a protein with less or greater function, or 2) in the case of correcting a natural mutation, to restore or approximate the wild-type sequence and / or function. Typically, the cells are maintained under conditions suitable for cell growth and / or maintenance. Suitable cell culture conditions are well known in the art and are described in, for example, Santiago et al., (2008) PNAS 105: 5809-5814; Moehle et al., (2007) PNAS 104: 3055-3060; Urnov et al., (2005) Nature 435: 646-651; and Lombardo et al. (2007) Nat. Biotechnology 25: 1298-1306. It will be appreciated by those skilled in the art that methods for culturing cells are known in the art and can and will vary depending on the cell type. In all cases, conventional optimization can be used to determine the best technique for a particular cell type.

[0172] Embryo can be cultured in vitro (for example, in cell culture).Usually, in suitable temperature and suitable culture medium with necessary O2 / CO2 ratio culture embryo, to allow to be edited.Suitable non-limiting examples of culture medium include M2, M16, KSOM, BMOC and HTF medium.Technician will understand that culture condition can and can change according to the kind of embryo.In all cases, conventional optimization can be used to determine the best culture condition of specific embryo kind.In some cases, cell line can derive from the embryo (for example, embryonic stem cell line) of in vitro culture.

[0173] Alternatively, the embryo can be cultured in vivo by transferring the embryo into the uterus of a female host. Generally speaking, the female host is from a species identical or similar to the embryo. Preferably, the female host is pseudopregnant. Methods for preparing pseudopregnant female hosts are known in the art. In addition, the method for transferring the embryo into the female host is known. Cultivating the embryo in vivo allows embryonic development and can result in the live birth of an animal derived from the embryo. Such an animal will comprise the chromosomal sequence of the modification in each cell of the body.

[0174] (f) Cell and embryo types

[0175] A variety of eukaryotic cells and embryos are applicable to this method. For example, the cell can be a human cell, a non-human mammal cell, a non-mammalian vertebrate cell, an invertebrate cell, an insect cell, a plant cell, a yeast cell, a unicellular eukaryotic cell or a prokaryotic organism. Typically, the embryo is a non-human mammal embryo. In a specific embodiment, the embryo can be a unicellular non-human mammal embryo. Exemplary mammal embryos include unicellular embryos, including but not limited to mice, rats, hamsters, rodents, rabbits, cats, dogs, sheep, pigs, cattle, horses and non-human primate embryos. In other embodiments, the cell can be a stem cell. Suitable stem cells include but are not limited to embryonic stem cells, ES-like stem cells, fetal stem cells, adult stem cells, pluripotent stem cells, induced pluripotent stem cells, specialized stem cells, oligopotent stem cells, unipotent stem cells etc. In an exemplary embodiment, the cell is a mammalian cell.

[0176] Non-limiting examples of suitable mammalian cells include Chinese hamster ovary (CHO) cells, baby hamster kidney (BHK) cells; mouse myeloma NSO cells, mouse embryonic fibroblast 3T3 cells (NIH3T3), mouse B lymphoma A20 cells; mouse melanoma B16 cells; mouse myoblast C2C12 cells; mouse myeloma SP2 / 0 cells; mouse embryonic mesenchymal C3H-10T1 / 2 cells; mouse carcinoma CT26 cells, mouse prostate DuCuP cells; Mouse mammary EMT6 cells; mouse hepatocellular carcinoma Hepa1c1c7 cells; mouse myeloma J5582 cells; mouse epithelial MTD-1A cells; mouse myocardial MyEnd cells; mouse kidney RenCa cells; mouse pancreatic RIN-5F cells; mouse melanoma X64 cells; mouse lymphoma YAC-1 cells; rat glioblastoma 9L cells; rat B lymphoma RBL cells; rat neuroblastoma B35 cells; rat hepatoma cells (HTC); Buffalo rat liver BRL 3A cells; canine kidney cells (MDCK); canine mammary gland (CMT) cells; rat osteosarcoma D17 cells; rat monocyte / macrophage DH82 cells; monkey SV-40-transformed fibroblasts (COS7) cells; monkey kidney CVI-76 cells; African green monkey kidney (VERO-76) cells; human embryonic kidney cells (HEK293, HEK293T); human cervical carcinoma cells (HELA); human lung cells (W138); human liver cells (Hep G2); human U2-OS osteosarcoma cells, human A549 cells, human A-431 cells, and human K562 cells. An extensive list of mammalian cell lines can be found in the catalog of the American Type Culture Collection (ATCC, Manassas, VA).

[0177] (V) Methods for modifying chromosomal sequences or regulating the expression of chromosomal sequences using fusion proteins

[0178] Another aspect of the present disclosure includes a method for modifying a chromosomal sequence in a cell or embryo or regulating the expression of a chromosomal sequence in a cell or embryo. The method includes introducing (a) at least one cytosine base editor fusion protein or a nucleic acid encoding at least one fusion protein into a cell or embryo, wherein the fusion protein comprises a CRISPR / Cas-like protein or a fragment thereof and an effector domain or a tethered protein encoding a cytosine deaminase, and (b) at least one gRNA or a DNA encoding a gRNA, wherein the gRNA guides the CRISPR / Cas-like protein of the fusion protein to a target site in the chromosomal sequence, and the cytosine deaminase of the fusion protein modifies the chromosomal sequence or regulates the expression of the chromosomal sequence by modifying a regulatory sequence associated with the chromosomal sequence.

[0179] Fusion proteins comprising CRISPR / Cas-like proteins or fragments thereof and effector domains are described in detail in section (II) above. Typically, the fusion proteins disclosed herein may also include at least one nuclear localization signal. The nucleic acids encoding the fusion proteins are described in section (III) above. In some embodiments, the fusion protein can be introduced into cells or embryos with an isolated protein (which may further include a cell-penetrating domain). In addition, the isolated fusion protein can be part of a protein-RNA complex comprising a gRNA. In other embodiments, the fusion protein (which may be capped and / or polyadenylated) can be introduced into cells or embryos with an RNA molecule. In other embodiments, the fusion protein can be introduced into cells or embryos with a DNA molecule. For example, the fusion protein and gRNA can be introduced into cells or embryos as discrete DNA molecules or as part of the same DNA molecule. Such DNA molecules can be plasmid vectors.

[0180] (VI) Genetically modified cells and animals

[0181] The present disclosure encompasses genetically modified cells, non-human embryos, and non-human animals comprising at least one chromosomal sequence that has been modified using an enzymatically inactivated RNA-guided endonuclease-mediated or fusion protein-mediated process, such as that described herein. The present disclosure provides cells comprising at least one DNA or RNA molecule, at least one gRNA, and optionally one or more independent or fused uracil glycosylase inhibitors (UGIs), the DNA or RNA molecule encoding an RNA-guided endonuclease or fusion protein targeting a chromosomal sequence of interest. The present disclosure also provides non-human embryos comprising at least one DNA or RNA molecule, at least one gRNA, and optionally one or more UGIs, the at least one DNA or RNA molecule encoding an enzymatically inactivated RNA-guided endonuclease or fusion protein targeting a chromosomal sequence of interest.

[0182] The present disclosure provides genetically modified non-human animals, non-human embryos, or animal cells comprising at least one modified chromosomal sequence. The modified chromosomal sequence can be modified so that it (1) is inactivated or (2) has altered expression or produces an altered protein product. The chromosomal sequence is modified using the methods described herein using an RNA-guided endonuclease-mediated or fusion protein-mediated process.

[0183] As discussed, one aspect of the present disclosure provides genetically modified animals, wherein at least one chromosomal sequence has been modified. In one embodiment, the genetically modified animal comprises at least one inactivated chromosomal sequence. The modified chromosomal sequence can be inactivated so that the sequence is not transcribed and / or does not produce a functional protein product. Therefore, the genetically modified animal comprising an inactivated chromosomal sequence can be referred to as a "knockout." As a result of the mutation, the targeted chromosomal sequence is inactivated and does not produce a functional protein. The inactivated chromosomal sequence does not comprise an exogenously introduced sequence. Also included herein are genetically modified animals wherein two, three, four, five, six, seven, eight, nine or ten or more chromosomal sequences are inactivated.

[0184] In another embodiment, the chromosomal sequence of modification can be changed so that its encoding variant protein product.For example, the genetically modified animal comprising the chromosomal sequence of modification can include target mutation or other modifications so that the protein product produced is changed.In one embodiment, the chromosomal sequence can be modified so that at least one Nucleotide is changed and the protein expressed includes an amino acid residue (missense mutation) of a change.In another embodiment, the chromosomal sequence can be modified to include more than a missense mutation so that more than one amino acid is changed.Compared with wild-type protein (or compared with unmodified protein in the case of correction of natural gene mutation), changed or variant protein can have the property or activity of change, such as the substrate specificity of change, the enzymatic activity of change, the kinetic rate of change etc.

[0185] In another embodiment, the genetically modified animal can comprise at least one genetic alteration in which a non-expressed gene can be activated, which is referred to as a "knock-in." The sequence of the chromosomal modification can, for example, encode a protein that is similar to an orthologous protein, an endogenous protein, or a combination of both.

[0186] In another embodiment, the genetically modified animal can include at least one modified chromosomal sequence encoding a protein so that the expression pattern of the protein changes. For example, the regulatory region controlling protein expression, such as a promoter or transcription factor binding site, can be changed so that the protein is overproduced, or the tissue-specific or temporal expression of the protein changes, or a combination thereof. Alternatively, a conditional knockout system can be used in combination to change the expression pattern of the protein. Non-limiting examples of conditional knockout systems include the Cre-lox recombination system. The Cre-lox recombination system includes a Cre recombinase, which is a site-specific DNA recombinase that can catalyze the reorganization of the nucleic acid sequence between specific sites (lox sites) in a nucleic acid molecule. Methods for using this system to produce time and tissue-specific expression are known in the art. Typically, genetically modified animals produce lox sites located on both sides of the chromosomal sequence. Then a genetically modified animal comprising a chromosomal sequence flanked by lox can be hybridized with another genetically modified animal expressing the Cre recombinase. Then a homologous animal comprising a chromosomal sequence flanked by lox and a Cre recombinase is produced, and the chromosomal sequence flanked by lox is reorganized, resulting in a deletion or inversion of the chromosomal sequence encoding the protein. The expression of Cre recombinase can be temporally and conditionally regulated to achieve temporally and conditionally regulated recombination of chromosomal sequences.

[0187] In any of these embodiments, the genetically modified animals disclosed herein can be heterozygous for the modified chromosomal sequence. Alternatively, the genetically modified animals can be homozygous for the modified chromosomal sequence.

[0188] The genetically modified animals disclosed herein can be hybridized to produce animals comprising more than one modified chromosomal sequence or to produce animals homozygous for one or more modified chromosomal sequences. For example, two animals comprising the same modified chromosomal sequence can be hybridized to produce animals homozygous for the modified chromosomal sequence. Alternatively, animals comprising different modified chromosomal sequences can be hybridized to produce animals comprising two modified chromosomal sequences.

[0189] In other embodiments, the animal comprising the modified chromosomal sequence can be hybridized to combine the modified chromosomal sequence with other genetic backgrounds. As non-limiting examples, other genetic backgrounds can include wild-type genetic backgrounds, genetic backgrounds with deletion mutations, genetic backgrounds with targeted integration, and genetic backgrounds with non-targeted integration.

[0190] As used herein, the term "animal" refers to a human or non-human animal. The animal can be an embryo, an adolescent, or an adult. Suitable animals include vertebrates, such as mammals, birds, reptiles, amphibians, shellfish, and fish. Examples of suitable mammals include, but are not limited to, rodents, companion animals, livestock, and primates. Non-limiting examples of rodents include mice, rats, hamsters, gerbils, and guinea pigs. Suitable companion animals include, but are not limited to, cats, dogs, rabbits, hedgehogs, and ferrets. Non-limiting examples of livestock include horses, goats, sheep, pigs, cattle, llamas, and alpacas. Suitable primates include, but are not limited to, capuchin monkeys, chimpanzees, lemurs, macaques, marmosets, tamarins, spider monkeys, squirrel monkeys, and vervet monkeys. Non-limiting examples of birds include chickens, turkeys, ducks, and geese. Alternatively, the animal can be an invertebrate, such as an insect, nematode, or the like. Non-limiting examples of insects include fruit flies and mosquitoes. An exemplary animal is a rat. Non-limiting examples of suitable rat strains include Dahl Salt-Sensitive, Fischer 344, Lewis, Long Evans Hooded, Sprague-Dawley, and Wistar. In one embodiment, the animal is not a genetically modified mouse. In each of the aforementioned iterations of suitable animals of the present invention, the animal does not include exogenously introduced randomly integrated transposon sequences.

[0191] Another aspect of the present disclosure provides a genetically modified cell or cell line comprising at least one modified chromosome sequence. The genetically modified cell or cell line can be derived from any genetically modified animal disclosed herein. Alternatively, the chromosome sequence can be modified in cells as described above (in the paragraph describing the chromosome sequence modification in the animal) using the methods described herein. The present disclosure also encompasses lysates of the cells or cell lines.

[0192] In a preferred embodiment, the cell is a eukaryotic cell. Suitable host cells include fungi or yeasts, such as Pichia, Saccharomyces or Schizosaccharomyces; insect cells, such as SF9 cells from Spodoptera frugiperda or S2 cells from Drosophila melanogaster; and animal cells, such as mouse, rat, hamster, non-human primate or human cells. Exemplary cells are mammalian. Mammalian cells can be primary cells. Cells can be a variety of cell types, such as fibroblasts, myoblasts, T or B cells, macrophages, epithelial cells, etc.

[0193] The cell can be a eukaryotic cell or a prokaryotic cell. For example, cells from bacteria, protozoa, plants, animals, fungi are contemplated. Animals can include, but are not limited to, insects and mammals.

[0194] When using a mammalian cell line, the cell line can be any established cell line or primary cell type, or a cell line not yet described. The cell line can be adherent or non-adherent, or the cell line can be grown using standard techniques well known to those skilled in the art under conditions promoting adherent, non-adherent or organotypic growth. Non-limiting examples of suitable mammalian cells and cell lines are provided in this paper (IV) (g) section. In other embodiments, the cell can be a stem cell. Non-limiting examples of suitable stem cells are provided in (IV) (g) section.

[0195] The disclosure also provides the non-human embryo of the genetic modification of the chromosomal sequence comprising at least one modification. Methods as described herein can be used to modify the chromosomal sequence in embryo as described above (in the paragraph describing the chromosomal sequence modification in animals). In one embodiment, embryo is the unicellular stage embryo of the non-human fertilization of an animal species of interest. Exemplary mammalian embryos, including unicellular embryos, include but are not limited to mice, rats, hamsters, rodents, rabbits, cats, dogs, sheep, pigs, cattle, horses and primate embryos.

[0196] In addition, non-mammalian cells and cell lines, including but not limited to plant, insect and prokaryotic cells and cell lines, as known to those skilled in the art, can be used. Such cells can be newly developed for a specific purpose or can be easily obtained from, for example, ATCC (Bethesda, MD) and other sources known to those skilled in the art. In short, the compositions and methods of the present invention should be useful for base editing in any cell with nucleic acid and Cas-based repair pathways (including viruses) after infection into a host cell.

[0197] (VII) Kit

[0198] Yet another aspect of the present disclosure provides a kit for implementing the above method.

[0199] The kits provided herein typically include instructions for carrying out the above-mentioned methods. The instructions included in the kit can be fixed to the packaging material, can be included as a packaging insert or a downloadable file. Although the instructions are typically written or printed materials, they are not limited thereto. The present disclosure contemplates any medium capable of storing such instructions and transmitting them to an end user. Such media include, but are not limited to, electronic storage media (e.g., disks, tapes, cassettes, chips), optical media (e.g., CD ROMs), etc. As used herein, the term "instructions" may include the address of an internet site providing the instructions.

[0200] As various changes could be made in the above methods and kits without departing from the scope of the invention, it is intended that all matter contained in the above description and following examples shall be interpreted as illustrative and not in a limiting sense. Example

[0201] Example 1. CBEs with N-terminal SSB fusions produce narrower editing windows than CBEs without SSB domains

[0202] Cytosine base editor (CBE) proteins (SEQ ID NOs: 4 and 5) were constructed by fusing the C-terminal domain of human APOBEC3A or human APOBEC3B to the amino terminus of the SpCas9 nickase protein and fusing two uracil glycosylase inhibitor (UGI) domains to the C-terminus. Novel CBE proteins (SEQ ID NOs: 6-9) were constructed by fusing the single-stranded DNA binding protein (SSB) domain from T4 or T7 phage to the amino terminus of the above CBE. All proteins were expressed and purified from Escherichia coli BL21AI by autoinduction and nickel column chromatography and stored at -80°C in a buffer containing 10% glycerol, 300mM KCl, 20mM HEPES (pH 7.5) and 1mM DTT before use. Synthetic single guide RNAs (sgRNAs) targeting four human genomic sites were purchased from MilliporeSigma. The spacer sequences of the sgRNAs are given in Table 1. Each experimental condition was tested in two technical replicates.

[0203] Table 1. sgRNA spacer sequences and PCR primer sequences

[0204]

[0205] The ribonucleoprotein (RNP) complex was prepared by incubating 15 μg of CBE protein and 200 pmol of sgRNA in a buffer (20 mM HEPES, 100 mM KCl, 0.5 mM DTT, 0.1 mM EDTA (pH 7.5)) at room temperature for 15 minutes in a final volume of 10 μL. The molar ratio of CBE to sgRNA was approximately 1:3. The RNP was kept on ice until transfection. HEK293 cells were obtained from ATCC and grown in DMEM supplemented with 10% FBS, 2 mM L-glutamine, 1 mM sodium pyruvate, and 0.1 mM non-essential amino acids at 37°C and 5% CO2. Two days before transfection, 1.67 × 10 4 cells / cm 2At the time of transfection, cells were trypsinized to obtain a single-cell suspension, washed twice with Hank's balanced salt solution, and plated at 2.5 x 10 cells / 100 μL. 5 Cells were resuspended in Nucleofector Solution V (Lonza, Basel, CH). 100 μL of the prepared cell suspension was mixed with 10 μL of complexed CBE RNPs by pipetting six times and then transferred to a cuvette for electroporation. Nucleofection was performed on a Nucleofector 2b machine using program Q-001. The nucleofected cells were immediately transferred to a 6-well plate containing 2 mL of prewarmed culture medium per well and grown for 3 days before harvesting.

[0206] Genomic DNA was harvested by trypsinizing the transfected cells and resuspending them in 75 μL QuickExtract reagent (Lucigen). The suspension was incubated at 60°C for 15 min and at 95°C for 15 min. The genomic region targeted by CBE was amplified by PCR using JumpStart Taq ReadyMix (MilliporeSigma, Burlington, MA) and the following cycling conditions: 94°C / 2 min; 25 cycles of 94°C / 30 s, 62°C / 30 s, 72°C / 45 s; 72°C / 5 min. Primers are listed in Table 1. PCR products were amplified in a second round using Illumina index primers and JumpStart Taq ReadyMix and the following conditions: 95°C / 3 min; 9 cycles of 95°C / 30 s, 55°C / 30 s, 72°C / 30 s; 72°C / 5 min. Index PCR products were purified by Select-a-Size DNA Clean & Concentrator MagBeads (Zymo, Irvine, CA) using 1.2x beads by volume, quantified by PicoGreen (ThermoFisher, Waltham, MA), and pooled according to DNA content. Pools were diluted to 4 nM. Sequencing was performed on an Illumina MiSeq instrument using a 300-cycle kit to obtain single-end reads. FASTQ files for each sample were analyzed using custom analysis scripts.

[0207] The results are shown in Figure 1. Figures 1A-1DIn the figure, the percentage of sequencing reads containing C-to-T substitutions at each cytosine residue in each target site is plotted. Positions are indicated by their distance from the 5' end of the target sequence. Values ​​are the mean ± standard deviation of two replicates. All transfections were performed on the same day using the same cells. The results show that absolute and relative editing efficiencies are target specific. The editing profiles show that the editing window of CBE variants with N-terminal SSB fusions is shifted from the PAM relative to the editing window of CBEs without SSB fusions.

[0208] exist Figure 1E In the figure, for each variant tested, the percentage of C-to-T substitutions that fall within a window of a given width is plotted against the width of the window. The results show that, regardless of whether the deaminase used is APOBEC3A (open symbols, solid line) or APOBEC3B (filled symbols, dashed line), CBE variants with N-terminal SSB fusions (filled and open diamonds and filled and open triangles) have narrower editing windows than CBE variants without SSB fusions (filled and open circles). Variants with N-terminal SSB fusions generate 50% C-to-T substitutions within a 4nt window, while variants without SSB require at least 5nt to contain the same fraction of edits. In addition, CBE variants with N-terminal SSB fusions generate 67% C-to-T substitutions within a window of approximately 5nt, while CBE variants without SSB require a 7nt window to contain the same fraction of edits.

[0209] Example 2: CBE RNPs without 2xUGI have higher editing activity than CBE RNPs with C-terminal 2xUGI fusions

[0210] A minimal cytosine base editor (CBE) protein without UGI was constructed by fusing the C-terminal domain of human APOBEC3B to the amino terminus of the SpCas9 nickase protein (SEQ ID NO: 10). The minimal CBE was further modified to contain a T4 phage SSB (SEQ ID NO: 11) at the amino terminus of the CBE. The CBE protein with 2x UGI used in this example is as described in Example 1. The protein was expressed and purified from Escherichia coli as in Example 1. Synthetic single guide RNAs (sgRNAs) targeting four human genomic sites were purchased from MilliporeSigma. The spacer sequences of the sgRNAs are given in Table 1. Each experimental condition was tested in two technical replicates. Ribonucleoprotein (RNP) complexes were prepared by incubating 40 pmol CBE protein and 120 pmol sgRNA in a buffer (20 mM HEPES, 100 mM KCl, 0.5 mM DTT, 0.1 mM EDTA (pH 7.5)) at room temperature for 15 min in a final volume of 10 μL. RNPs were kept on ice until transfection. Transfection was performed in HEK293 cells as described in Example 1. Genomic DNA was purified, the genomic target site was amplified, and the library was prepared, sequenced, and analyzed as described in Example 1.

[0211] The results are shown in Figures 2A-2D The percentage of sequencing reads containing substitutions at each cytosine residue in the protospacer sequence is plotted for CBE variants with and without a 2×UGI fusion. The results show that for all targets tested, CBE variants without UGI as part of the fusion protein have higher substitution rates than CBE variants containing 2×UGI. The editing rate of the CBE variant without UGI is 3.7 times that of the 2xUGI variant. The proportion of C-to-T substitutions is similar for CBE variants with and without a 2×UGI fusion, indicating that the fused UGI domain does not act to limit C-to-A and C-to-G substitutions, as seen in the plasmid-delivered format.

[0212] Example 3. Dose-dependent reduction of indel formation and CA and CG substitutions by co-transfection with uracil glycosylase inhibitor protein and CBE RNP

[0213] The cytosine base editor (CBE) protein was constructed by fusing the C-terminal domain of human APOBEC3B to the amino terminus of the SpCas9 nickase protein and fusing two uracil glycosylase inhibitor (UGI) domains to the C-terminus. The CBE also contains a single-stranded DNA binding protein (SSB) domain from T4 phage, which is fused to the N-terminus of the final structure of N-SSB-deaminase-nCas9-C, where N and C represent the amino and carboxyl termini of the protein as described in Example 1. Recombinant UGI (SEQ ID NO: 3) containing Bacillus phage UGI, c-MYC nuclear localization signal (NLS) and SV40 large T antigen NLS was purified from Escherichia coli. The CBE protein was purified from Escherichia coli as in Example 1. Synthetic single guide RNAs (sgRNAs) targeting four human genomic sites were purchased from MilliporeSigma. The spacer sequences of the sgRNAs are given in Table 1. Each experimental condition was tested in two technical replicates.

[0214] Ribonucleoprotein (RNP) complexes were prepared by incubating at room temperature for 15 minutes: 15 μg CBE protein, 200 pmol sgRNA, and 0-15 μg (0-1185 pmol) UGI buffer (20 mM HEPES, 100 mM KCl, 0.5 mM DTT, 0.1 mM EDTA (pH 7.5)) in a final volume of 10 μL. The molar ratio of CBE to sgRNA was approximately 1:3. RNPs were kept on ice until transfection. Transfection was performed in HEK293 cells as described in Example 1. Genomic DNA was purified, genomic target sites were amplified, and libraries were prepared and sequenced as described in Example 1. FASTQ files for each sample were analyzed using custom analysis scripts and the CRIS.py software package (Connelly & Pruett-Miller, Sci. Rep., 2019).

[0215] The results are shown in Figure 3. Figure 3A The percentage of sequencing reads containing insertions or deletions is plotted for four targets edited with CBE RNPs. Values ​​are the mean ± standard deviation of two replicates. Cotransfection of UGI proteins with the RNP complex resulted in a dose-dependent reduction in indel rates. At the highest dose of UGI, indel rates were at least 40% lower than in control transfections without UGI (target HBB03) and up to 80% lower than in controls (targets EMX1-15 and RNF2).

[0216] exist Figure 3BThe percentage of C-to-T cytosine substitutions is plotted. Values ​​are the mean ± standard deviation of two replicates. Co-transfection of UGI proteins with RNP complexes resulted in a dose-dependent increase in the proportion of C-to-T cytosine substitutions and, consequently, a decrease in the proportion of undesirable C-to-A and C-to-G substitutions. For the highest dose of UGI, the C-to-T ratio was at least 20% higher than in control transfections without UGI (EMX1-15) and up to 4-fold higher than in controls (HEKS ite2).

[0217] exist Figure 3C In the Figure 5, the percentage of reads containing at least one C-to-T substitution within the protospacer is plotted. Values ​​are the mean ± standard deviation of two replicates. Co-transfection of UGI proteins with the RNP complex minimally reduced the C-to-T editing rate. For the target HEKS ite2, co-transfection of UGI proteins resulted in a dose-dependent increase in the C-to-T editing rate, accompanied by an increase in the proportion of C-to-T substitutions. This indicates that the reduction in C-to-A and C-to-G substitutions, as well as the reduction in indels, is not due to reduced editing activity.

[0218] Example 4: Addition of dextran sulfate to the co-transfection of uracil glycosylase inhibitor protein and CBE RNP enhances the CT substitution rate

[0219] A cytosine base editor (CBE) protein was minimally constructed by fusing the C-terminal domain of human APOBEC3B to the amino terminus of the SpCas9 nickase protein. The CBE variant used in this example was constructed by further fusing the single-stranded DNA binding protein (SSB) domain from T4 phage to the N-terminus of the above CBE. CBE and phage uracil glycosylase inhibitor (UGI) protein were expressed and purified from Escherichia coli as in Examples 1 and 3, respectively. Synthetic single guide RNAs (sgRNAs) targeting four human genomic sites were purchased from MilliporeSigma. The spacer sequences of the sgRNAs are given in Table 1. Each experimental condition was tested in two technical replicates.

[0220] Prepare ribonucleoprotein (RNP) complexes by incubating at room temperature for 15 minutes: CBE protein, sgRNA, and 0 or 7 μg UGI in buffer (20 mM HEPES, 100 mM KCl, 0.5 mM DTT, 0.1 mM EDTA, pH 7.5) in a final volume of 10 μL. For CBE variants without SSB, use 80 pmol protein and 200 pmol sgRNA; for CBE variants with SSB, use 40 pmol protein and 120 pmol sgRNA. Keep RNPs on ice until transfection.

[0221] Dextran sulfate sodium salt (product number D8906) with an average molecular weight greater than 500 kDa was purchased from MilliporeSigma. A dextran sulfate solution was prepared by dissolving the chemical in water at 50 μg / μL and sterilizing by filtering through a 0.22 μm filter. The stock solution was diluted with water to prepare a 1 μg / μL working solution.

[0222] HEK293 cells were obtained from ATCC and grown in DMEM supplemented with 10% FBS, 2 mM L-glutamine, 1 mM sodium pyruvate, and 0.1 mM non-essential amino acids at 37°C and 5% CO2. Two days before transfection, 1.67 × 10 4 cells / cm 2 Cells were seeded onto the tissue culture surface area. The cells were trypsinized to obtain a single cell suspension, washed twice with Hank's balanced salt solution, and plated at approximately 2.5 x 10 cells / 100 μL. 5 The cells were resuspended in Nucleofector Solution V (Lonza). Dextran sulfate solution was added to the cell suspension to a final concentration of 0.5 μg / 100 μL and mixed thoroughly by vortexing. 100 μL of the prepared cell suspension was mixed with 10 μL of complexed CBE RNP by pipetting six times and then transferred to a cuvette for electroporation on a Nucleofector 2b machine using program Q-001 for nucleofection. The nucleofected cells were immediately transferred to a 6-well plate containing 2 mL of pre-warmed culture medium per well and grown for 3 days before harvesting.

[0223] Genomic DNA was purified, genomic target sites were amplified, and libraries were prepared and sequenced as described in Example 1. The FASTQ files of each sample were analyzed using custom analysis scripts and the BE-Analyzer web-based analysis tool (Hwang et al., BMC Bioinformatics, 2018).

[0224] The results are shown in Table 2 and Figure 4. Table 2 provides the percentage of reads with any C-to-T substitution for each CBE variant, each target, and each transfection condition as determined using the BE-Analyzer. Values ​​are mean ± standard deviation. The data show that while UGI and dextran sulfate alone increase the probability of target editing, as evidenced by an increase in the percentage of reads containing at least one C-to-T substitution, the combination of UGI and dextran sulfate produces a higher probability of editing than either alone. In many cases, the effect is greater than additive.

[0225] Table 2

[0226]

[0227] exist Figures 4A-4H In the Figures, the percentage of reads with substitutions at each cytosine in the protospacer is plotted, with C-to-T in gray, C-to-G in white, and C-to-A in black. (A) & (E) Targets EMX1-15; (B) & (F) Targets HEKSite2; (C) & (G) Targets HBB03; (D) & (H) Targets RNF2. Panels AD contain data for the minimal CBE variant, which does not contain an SSB domain; Panels EH contain data for the CBE variant with an N-terminal SSB domain. The data further confirm that the combination of UGI and dextran sulfate produces higher C-to-T conversion rates at positions within the editing window than either component alone. In addition, the combination of UGI and dextran sulfate produces reduced rates of undesired C-to-G and C-to-A substitutions compared to dextran sulfate alone.

[0228] Example 5. Adding dextran sulfate to the co-transfection of uracil glycosylase inhibitor protein and CBE RNP enhances the reduction of CA and CG substitutions by uracil glycosylase inhibitor

[0229] The cytosine base editor (CBE) protein was constructed and purified as in Example 4. The bacteriophage uracil glycosylase inhibitor (UGI) was purified as in Example 3. Synthetic single guide RNA (sgRNA) targeting four human genomic sites was purchased from MilliporeSigma. The spacer sequences of the sgRNAs are given in Table 1. Each experimental condition was tested in two technical replicates. Ribonucleoprotein (RNP) complexes and dextran sulfate solutions were prepared as in Example 4. HEK293 cells were cultured and transfected as in Example 4. Genomic DNA was purified, the genomic target sites were amplified, and the libraries were prepared, sequenced, and analyzed as described in Example 1.

[0230] The results are shown in Figure 5 For each CBE variant, RNPs were transfected alone and co-transfected with UGI protein, dextran sulfate, or both. The percent reduction in the proportion of C-to-A or C-to-G substitutions by UGI is plotted for transfections with (dark gray) and without (light gray) dextran sulfate. The data show that the effect of UGI on reducing C-to-A and C-to-G substitutions was enhanced when dextran sulfate was included in the transfection. When 40 pmol of CBE variants containing N-terminal SSB fusions were used, the effect of UGI was enhanced by 5-15%. When 80 pmol of CBE variants without SSB fusions were used, the effect of UGI was enhanced by 20-35%.

[0231] Example 6: Increasing the length of sgRNA to move the editing window further away from the PAM

[0232] Cytosine base editor (CBE) protein was constructed and purified as in Example 4. Synthetic single guide RNA (sgRNA) with spacers targeting three human genomic sites of length measurement of 20nt, 21nt, and 22nt was purchased from MilliporeSigma. The spacer sequences of sgRNA are given in Table 3. Each experimental condition was tested in two technical replicates. Dextran sulfate solution was prepared as in Example 4.

[0233] Table 3. sgRNA spacer sequences

[0234] Sequence (5'–3') SEQ ID NO. EMX1-15 20nt spacer GCTCCCATCACATCAACCGG 12 EMX1-15 21nt spacer GGCTCCCATCACATCAACCGG 24 EMX1-15 22nt spacer GGGCTCCCATCACATCAACCGG 25 HBB03 20nt spacer CTTGCCCCACAGGGCAGTAA 13 HBB03 21nt spacer CCTTGCCCCACAGGGCAGTAA 26 HBB03 22nt spacer ACCTTGCCCCACAGGGCAGTAA 27 RNF2 20nt spacer GTCATCTTAGTCATTACCTG 15 RNF2 21nt spacer AGTCATCTTAGTCATTACCTG 28 RNF2 22nt spacer CAGTCATCTTAGTCATTACCTG 29

[0235] Ribonucleoprotein (RNP) complexes were prepared by incubating 40 pmol of CBE protein and 120 pmol of sgRNA in a buffer (20 mM HEPES, 100 mM KCl, 0.5 mM DTT, 0.1 mM EDTA, pH 7.5) at room temperature for 15 minutes in a final volume of 10 μL. Transfection was performed in HEK293 cells as described in Example 4. Genomic DNA was purified, the genomic target site was amplified, and the library was prepared, sequenced, and analyzed as described in Example 3. PCR primers are listed in Table 1.

[0236] The results are shown in Figure 6. Figures 6A-6C In the Figures, the percentage of reads with a C-to-T substitution at each cytosine in the protospacer is plotted. In these figures, the protospacer cytosine is represented as the distance from the PAM (e.g., position -3 is three nucleotides upstream of the PAM). Values ​​are the mean ± standard deviation of two replicates. The data show that editing increases at positions farther from the PAM as sgRNA length increases. In the case of target HBB03, this includes a cytosine residue at position -23, which is outside the targeting sequence of even the longest guided sg RNA tested. 6A-6C show the percentage of reads with C-to-T substitutions for three targets and three spacer lengths: (A) targets EMX1-15; (B) target RNF2; (C) target HBB03.

[0237] exist Figures 6D-6GIn the figure, the percentage of reads carrying the single-residue edited allele is plotted. Values ​​are the mean ± standard deviation of two replicates. The data indicate that extending the guide sequence leads to an increase in the absolute rate of the allele with a single C-to-T edit at a PAM-distal position and a concomitant decrease in the rate of the allele with a single C-to-T edit at a PAM-proximal position. When the target site contains multiple editable cytosines and the desired edit is PAM-distal, extending the guide can facilitate obtaining the desired edit. 6D-6G show the percentage of reads carrying the single-residue edited allele: (D) target EMX1-15 without SSB; (E) target RNF2 without SSB; (F) target EMX1-15 with T4 SSB; (G) target RNF2 with T4 SSB.

[0238] Example 7. In vitro transcription of T4 SSB containing a cytosine base editor and UGI mRNA improves base editing efficiency and precision

[0239] As described in Examples 2 and 3, plasmid vectors encoding an APOBEC3B-derived cytosine base editor (SEQ ID NO: 10; referred to herein as A3B), a T4 phage SSB containing an APOBEC3B-derived cytosine base editor (SEQ ID NO: 11; referred to herein as T4 SSB-A3B), and free UGI (SEQ ID NO: 3) were each constructed using human codon optimization. Each gene was preceded by a T7 RNA polymerase promoter for CleanCap (TriLink Biotechnologies, San Diego, CA) in vitro RNA transcription. Each plasmid was linearized by restriction digestion with PmeI (New England Biolabs, Ipswich, MA) and purified by two rounds of phenol / chloroform extraction. The linearized plasmid DNA was then used for mRNA production using the HiScribe T7 mRNA kit (New England Biolabs, Ipswich, MA) and CleanCap reagent AG (TirLink Bio).

[0240] Human K562 cells carrying the Y93H (T-to-C mutation in DNA) mutation in GFP integrated into the human EMX1 locus were used for the experiment. The mutation eliminates the formation of the GFP fluorophore, thereby inactivating the protein fluorescence activity. The cells were recovered from liquid nitrogen and cultured in Iscove's Modified Dulbecco's Medium (SigmaAldrich, St. Louis, MO) supplemented with 10% FBS and 2mM L-glutamine at 37°C and 5% CO2 for one week. The day before transfection, cells were cultured at 0.25x106 cells / mL and at the time of transfection, approximately 0.5 x 10 6 Cells were inoculated at 0.6 x 10 cells / mL. The cells were washed twice with Hank's balanced salt solution and then inoculated at 0.6 x 10 cells / mL per 100 μL. 6 Each cell was resuspended in Nucleofector Solution V (Lonza; Bend, OR). Each transfection sample contained 8 μg of base editor mRNA and 200 pmol of sgRNA with a guide sequence of 5'-CUGAAGGUCACGUACAAGAG-3' (SEQ ID NO: 41). A subset of samples also contained 4 μg of UGI mRNA. RNase-free water was used as a negative control. The molar ratio of UGI mRNA to base editor mRNA was approximately 5: 1. Nucleofection was performed by first mixing 100 μL of cells with the transfection sample, pipetting up and down gently without introducing bubbles, and then transferring to a cuvette for immediate electroporation on an Amaxa instrument (Lonza) using program T-016. After nucleofection, the cells were immediately transferred to a 6-well plate containing 2 mL of preheated culture medium per well and then grown at 37°C and 5% CO2.

[0241] Flow cytometric analysis was performed 5 days after transfection on a MACS Quantum Analyzer (Miltenyi Biotec, San Diego, CA), and data were analyzed using the FlowJo program (BD Biosciences, Franklin Lake, NJ). Genomic DNA was harvested from transfected cells 5 days after transfection using QuickExtract solution (Lucigen, Middleton, WI). The targeted genomic region was PCR amplified using a pair of NGS primers and the JumpStart TM Taq ReadyMix TMQuantitative PCR was performed using a JumpStart® kit (MilliporeSigma, Burlington, MA) with the following cycling conditions: 98°C / 2m; 98°C / 15s, 62°C / 30s, and 72°C / 45s for 34 cycles; and 72°C / 5m. The NGS primers were: 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNCCTGAAGTTCATCTGCACCACC-3' (SEQ ID NO: 42) (forward) and 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGNNNNNNCACGTTGTGGCTGTTGTAGTTGTA-3' (SEQ ID NO: 43) (reverse). Quantitative PCR was then performed using the JumpStart® kit (MilliporeSigma, Burlington, MA). TM Taq ReadyMix TM The primary PCR product was amplified using Illumina index primers with cycling conditions of 95°C / 3m, 95°C / 30s, 55°C / 30s, and 72°C / 30s for 8 cycles, and 72°C / 5m. The index PCR product was purified using the Select-aSize DNA Clean & Concentrator Kit (Zymo, Irvine, CA) and quantified using PicoGreen (ThermoFisher, Waltham, MA). The PCR products were then normalized and combined to prepare NGS libraries. NGS was performed using an Illumina MiSeq instrument and a 2x 300bp kit (San Diego, CA). The FASTQ files for each sample were analyzed using a custom analysis program.

[0242] The results are shown in Figures 7A-7E middle. Figure 7A Shown are the percentages of cells that became GFP-positive after transfection with two cytosine base editor mRNAs (A3B and T4 SSB-A3B) in the presence or absence of UGI mRNA. The results show that adding UGI mRNA to the transfection increased the number of GFP-positive cells by approximately 50%. Figures 7B-7D Positions analyzed by NGS from transfected cells are shown using C-to-T ( Figure 7B )、C-to-G( Figure 7C ) or C-to-A( Figure 7D ) Percentage of substituted sequencing reads. Figure 7EThe percentage of sequencing reads with indels from NGS analysis of transfected cells is shown. These results indicate that adding UGI mRNA to transfection increases C-to-T substitutions while reducing C-to-G or C-to-A substitutions and indel formation. These results further demonstrate that T4SSB containing base editor mRNA reduces off-target effects on two of the three unintended C nucleotides (C1, C11, and C15 within the protoplast) compared to base editor mRNA without the SSB domain, while both base editor mRNAs have similar C-to-T conversion efficiencies for the intended C9 nucleotide.

[0243] Example 8. UGI used with a nuclear localization sequence (NLS)

[0244] The cytosine base editor (CBE) protein was constructed by fusing the C-terminal domain of human APOBEC3B to the amino terminus of the SpCas9 nickase protein via a rigid peptide linker and fusing two uracil glycosylase inhibitor (UGI) domains to the C-terminus (SEQ ID NO: 12). Recombinant UGI was constructed by fusing Bacillus phage UGI, c-MYC nuclear localization signal (NLS), and SV40 large T antigen NLS (SEQ ID NO: 3). Recombinant UGI without NLS sequence was purchased from NEB (Cat. No. M0281). All proteins were expressed and purified from Escherichia coli BL21AI by autoinduction and nickel column chromatography and stored at -80°C in a buffer containing 10% glycerol, 300mM KCl, 20mM HEPES (pH 7.5), and 1mM DTT before use. Synthetic single guide RNA (sgRNA) targeting EMX1-15 and HEKS ite2 was purchased from MilliporeSigma. The spacer sequences of sgRNAs are given in Table 1. Each experimental condition was tested in two technical replicates.

[0245] Ribonucleoprotein (RNP) complexes were prepared by incubating 15 μg of CBE protein, 200 pmol sgRNA, and 158 to 1185 pmol UGI in a buffer (20 mM HEPES, 100 mM KCl, 0.5 mM DTT, 0.1 mM EDTA (pH 7.5)) at room temperature for 15 minutes in a final volume of 10 μL. The molar ratio of CBE to sgRNA was approximately 1:3. RNPs were kept on ice until transfection. HEK293 cells were obtained from ATCC and grown at 37°C and 5% CO2 in DMEM supplemented with 10% FBS, 2 mM L-glutamine, 1 mM sodium pyruvate, and 0.1 mM non-essential amino acids. Two days before transfection, 1.67 × 10 4 cells / cm 2At the time of transfection, cells were trypsinized to obtain a single-cell suspension, washed twice with Hank's balanced salt solution, and plated at 2.5 x 10 cells / 100 μL. 5 100 μL of the prepared cell suspension was resuspended in Nucleofector Solution V (Lonza). 100 μL of the prepared cell suspension was mixed with 10 μL of complexed CBE RNP by pipetting six times and then transferred to a cuvette for electroporation. Nucleofection was performed on a Nucleofector 2b machine (Lonza) using program Q-001. The nucleofected cells were immediately transferred to a 6-well plate containing 2 mL of pre-warmed culture medium per well and grown for 3 days before harvesting.

[0246] Genomic DNA was harvested by trypsinizing the transfected cells and resuspending them in 50 μL QuickExtract reagent (Lucigen). The suspension was incubated at 60°C for 15 min and at 95°C for 15 min. The genomic region targeted by CBE was amplified by PCR using JumpStart Taq ReadyMix (MilliporeSigma) and the following cycling conditions: 94°C / 2 min; 25 cycles of 94°C / 30 s, 62°C / 30 s, 72°C / 45 s; 72°C / 5 min. Primers are listed in Table 1. PCR products were amplified in a second round using Illumina index primers and JumpStart Taq ReadyMix and the following conditions: 95°C / 3 min; 9 cycles of 95°C / 30 s, 55°C / 30 s, 72°C / 30 s; 72°C / 5 min. Index PCR products were purified by Select-a-Size DNA Clean & Concentrator MagBeads (Zymo, Irvine, CA) using 1.2x beads by volume, quantified by PicoGreen (ThermoFisher, Waltham, MA), and pooled according to DNA content. The pool was diluted to 4 nM. Sequencing was performed on an Illumina MiSeq instrument using a 300-cycle kit to obtain single-end reads. FASTQ files for each sample were analyzed using the CRIS.py software package (Connelly & Pruett-Miller, Sci. Rep., 2019).

[0247] The results are shown in Figure 8A&8B. For each target: (A) EMX1-1; and (B) HEKS ite2; the percentage of reads with any C-to-T editing was plotted for each UGI condition, as described above and shown on the X-axis of the graph. Values ​​are the mean ± standard deviation of two replicates. For both target sites, co-delivery of UGI protein with NLS resulted in increased C-to-T editing rates. In contrast, NEB UGI without NLS exhibited editing rates similar to or lower than those of control samples without independent UGI protein.

Claims

1. A composition suitable for modifying cytosine residues in a DNA sequence, comprising: a single-stranded DNA binding domain (SSB), a deaminase, a catalytically modified Cas protein, a guide RNA, and optionally one or more free and / or fused uracil glycosylase inhibitors (UGIs) to form a base editing RNP complex optionally with a UGI.

2. The composition of claim 1, wherein the SSB is directly linked to the deaminase.

3. The composition of claim 1, wherein the SSB is indirectly linked to the deaminase.

4. The composition of any one of claims 1 to 3, wherein the SSB is not covalently linked to any of the deaminase, the catalytically modified Cas protein, the guide RNA, or the optional UGI.

5. The composition of any one of claims 1 to 4, wherein the deaminase is covalently linked to the catalytically modified Cas protein.

6. The composition of any one of claims 1 to 5, wherein the one or more UGIs are not covalently linked to any of the deaminase, the catalytically modified Cas protein, or the guide RNA.

7. The composition of any one of claims 1 to 6, wherein the one or more SSBs are derived from a virus.

8. The composition of any one of claims 1 to 6, wherein the one or more SSBs are derived from a prokaryotic organism.

9. The composition of any one of claims 1 to 6, wherein the one or more SSBs are from a eukaryotic organism.

10. The composition of any one of claims 1 to 9, wherein the deaminase is cytosine deaminase.

11. The composition according to any one of claims 1 to 9, wherein the adenosine deaminase.

12. according to the composition described in any one of claims 1 to 11, wherein the catalytically modified Cas protein contains a catalytically inactive RuvC nuclease domain.

13. according to the composition described in any one of claim 1 to 11, wherein the catalytically modified Cas protein contains a catalytically inactive RuvC nuclease domain and a catalytically inactive HNH nuclease domain.

14. The composition of any one of claims 1 to 13, wherein the catalytically modified Cas protein is Cas9.

15. The composition of any one of claims 1 to 13, wherein the catalytically modified Cas protein is Cas12.

16. At least one nucleic acid encoding one or more of the SSB, deaminase, catalytically modified Cas protein, guide RNA, and optionally one or more free and / or fused UGI of the composition of any one of claims 1 to 15.

17. At least one expression vector comprising a nucleic acid encoding at least one or more of the SSB, deaminase, catalytically modified Cas protein, guide RNA, and optionally one or more free and / or fused UGI of the composition of any one of claims 1 to 15.

18. The composition of any one of claims 1 to 17, further comprising a nuclear localization sequence (NLS).

19. A composition suitable for modifying cytosine residues in a DNA sequence, comprising: a deaminase, a catalytically modified Cas protein, a guide RNA, and one or more free UGIs to form a base editing RNP complex with free UGIs.

20. The composition of claim 19, wherein the deaminase is covalently linked to a catalytically modified Cas protein.

21. The composition according to any one of claims 19 to 20, wherein The one or more UGIs are not covalently linked to any of the deaminase, the catalytically modified Cas protein, or the guide RNA.

22. The composition of any one of claims 19 to 21, wherein the deaminase is cytosine deaminase.

23. The composition of any one of claims 19 to 21, wherein the deaminase is adenosine deaminase.

24. according to the composition described in any one of claim 19 to 23, wherein the catalytically modified Cas protein contains a catalytically inactive RuvC nuclease domain.

25. according to the composition described in any one of claim 19 to 23, wherein the catalytically modified Cas protein contains a catalytically inactive RuvC nuclease domain and a catalytically inactive HNH nuclease domain.

26. A composition according to any one of claims 19 to 25, wherein the catalytically modified Cas protein is Cas9.

27. A composition according to any one of claims 19 to 25, wherein the catalytically modified Cas protein is Cas12.

28. The composition of any one of claims 19 to 27, wherein the deaminase, the catalytically modified Cas protein, the guide RNA are encoded in one or more nucleic acids, and wherein the UGI is a peptide or is encoded in the one or more nucleic acids.

29. One or more expression vectors comprising one or more nucleic acids of claim 28.

30. The composition of any one of claims 19 to 29, further comprising a nuclear localization sequence (NLS).

31. A method for modifying a DNA sequence, the method comprising: a) providing 1) an RNP complex comprising a single-stranded DNA binding domain (SSB), a deaminase, a catalytically modified Cas protein and a guide RNA, and optionally; 2) one or more free uracil glycosylase inhibitors (UGIs); b) introducing the RNP complex and optionally the free UGI into a recipient cell; c) wherein at least one cytosine residue of the DNA of the recipient cell is converted to a thymine residue.

32. The method of claim 31 , wherein the SSB is directly linked to the deaminase.

33. The method of claim 31 , wherein the SSB is indirectly linked to the deaminase.

34. The method of any one of claims 31 to 33, wherein the deaminase is covalently linked to the catalytically modified Cas protein.

35. The method of any one of claims 31 to 33, wherein the one or more UGIs are not covalently linked to the deaminase, the catalytically modified Cas protein, or the guide RNA.

36. The method of any one of claims 31 to 33, wherein the one or more SSBs are from a virus.

37. The method of any one of claims 31 to 33, wherein the one or more SSBs are from a prokaryotic organism.

38. The method of any one of claims 31 to 33, wherein the one or more SSBs are from a eukaryotic organism.

39. The method of any one of claims 31 to 38, wherein the deaminase is cytosine deaminase.

40. The method of any one of claims 31 to 38, wherein the deaminase is adenosine deaminase.

41. according to the method described in any one of claim 31 to 38, wherein the catalytically modified Cas protein contains a catalytically inactive RuvC nuclease domain.

42. according to the method described in any one of claim 31 to 38, wherein the catalytically modified Cas protein contains a catalytically inactive RuvC nuclease domain and a catalytically inactive HNH nuclease domain.

43. The method of any one of claims 31 to 40, wherein the catalytically modified Cas protein is Cas9.

44. The method of any one of claims 31 to 40, wherein the catalytically modified Cas protein is Cas12.

45. The method of any one of claims 31 to 44, wherein the RNP complex and the UGI are introduced into the recipient cell as recombinant proteins.

46. ​​The method of any one of claims 31 to 44, wherein the RNP complex and the UGI are introduced into the recipient cell as RNA.

47. The method of any one of claims 31 to 44, wherein the RNP complex and the UGI are introduced into the recipient cell using at least one expression vector.

48. The method of any one of claims 31 to 45, wherein the recombinant protein is introduced into the recipient cell by electroporation in the presence of a sulfonated polysaccharide-based RNP electroporation enhancer.

49. The method of any one of claims 31 to 48, wherein the guide RNA has a target-complementary sequence that is 20 to 30 nucleotides long.

50. The method of any one of claims 31 to 49, further comprising a nuclear localization sequence (NLS).

51. A method for modifying a DNA sequence, the method comprising: a) providing 1) an RNP complex comprising a deaminase peptide, a catalytically modified Cas protein, and a guide RNA; 2) one or more free uracil glycosylase inhibitors (UGIs); b) introducing the RNP complex and the free UGI into a recipient cell; c) wherein at least one cytosine residue of the DNA of the recipient cell is converted to a thymine residue.

52. The method of claim 51, wherein the deaminase is covalently linked to a catalytically modified Cas protein.

53. The method of claim 51 , wherein the one or more UGIs are not covalently linked to the deaminase, the catalytically modified Cas protein, or the guide RNA.

54. The method of any one of claims 51 to 53, wherein the deaminase is cytosine deaminase.

55. The method of any one of claims 51 to 53, wherein the deaminase is adenosine deaminase.

56. according to the method described in any one of claim 51 to 52, wherein the catalytically modified Cas nuclease contains a catalytically inactive RuvC nuclease domain.

57. according to the method described in any one of claim 51 to 52, wherein the catalytically modified Cas protein contains a catalytically inactive RuvC nuclease domain and a catalytically inactive HNH nuclease domain.

58. The method of any one of claims 51 to 57, wherein the catalytically modified Cas protein is Cas9.

59. according to the method described in any one of claims 51 to 57, wherein the catalytically modified Cas protein is Cas12.

60. The method of any one of claims 51 to 53, wherein the RNP complex and the UGI are introduced into the recipient cell as recombinant proteins.

61. The method of any one of claims 51 to 53, wherein the recombinant protein is introduced into the recipient cell by electroporation in the presence of a sulfonated polysaccharide-based RNP electroporation enhancer.

62. The method of any one of claims 51 to 53, wherein the guide RNA has a target-complementary sequence that is 20 to 30 nucleotides long.

63. The method of any one of claims 51 to 62, further comprising a nuclear localization sequence (NLS).

64. A method for introducing UGI into a eukaryotic cell, the method comprising: a) at least one recipient cell and b) at least one UGI covalently linked to at least one NLS, wherein the at least one UGI covalently linked to at least one NLS forms a UGI-NLS molecule; b) transfecting the UGI-NLS molecule into the recipient cells.

65. The method of claim 64, wherein the UGI-NLS molecule is a recombinant protein.

Images