Flammulina velutipes variety X129 as well as identification method and application thereof

Through the molecular fingerprint identification method of the Enoki mushroom variety X129, the problems of inaccurate variety identification and production confusion have been solved, and a new variety with high yield, disease resistance and excellent appearance has been provided, which is suitable for factory production and meets market demand.

CN120607971AActive Publication Date: 2025-09-09SHANGHAI XUERONG BIOTECH
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510835945.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-20
Publication Date
2025-09-09
Estimated Expiration
2045-06-20

AI Technical Summary

Technical Problem

Existing varieties of Flammulina velutipes have the phenomenon of homonyms, serious production confusion, and the phenotypic traits between varieties are similar and difficult to distinguish. The market demand for quality is increasing, and traditional identification methods are inaccurate and easily affected by the environment, leading to production problems such as premature opening of the cap and loosening after harvesting.

Method used

The enoki mushroom variety X129 and its identification method were developed, using a molecular fingerprint consisting of 8 specific MNP marker sites for identification. Combined with high-throughput sequencing technology, the genotype was determined through PCR amplification and sequencing, providing a new variety with strong disease resistance, high yield and good appearance.

Benefits of technology

It has achieved accurate identification of the Enoki mushroom variety X129, improved the variety's commercial characteristics and quality, met market demand, made it suitable for factory production, reduced production confusion, and provided technical support for variety intellectual property protection and market supervision.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120607971A_ABST
    Figure CN120607971A_ABST
Patent Text Reader

Abstract

The invention discloses a flammulina velutipes variety X129 and an identification method and application thereof. The flammulina velutipes variety is X129, the strain is preserved in the China General Microbiological Culture Collection Center (the address is No.3, No.1 Yard, Beichen West Road, Chaoyang District, Beijing, China) on June 6, 2025, and the biological preservation number of the flammulina velutipes strain is CGMCC No.42022. The flammulina velutipes strain is named as flammulina velutipes. The flammulina velutipes variety X129 is thick in pileus, free of umbrella opening, thick and strong in stipe, small in bud number, small in cross section pore and rice-white in cut root.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of Flammulina velutipes breeding and strain molecular identification, and particularly relates to a Flammulina velutipes variety X129 and an identification method and application thereof. Background Art

[0002] Enoki mushroom (Flammulina filiformis) is the first edible mushroom variety to achieve factory production in my country. Its production climbed to 1.8738 million tons in 2023, ranking first among factory-cultivated edible mushroom varieties. It has also become one of the most industrialized and fiercely competitive varieties. China's seed industry, particularly the white enoki mushroom, lags significantly behind developed countries, and its dependence on foreign sources for key seed sources is extremely high. Currently, the main varieties cultivated by domestic companies are primarily the 'T' series of white spawn imported from Japan's Chikuma Company through a "strain royalty" system. Tissue (matrix) isolation is a widely used method for obtaining strains in the edible mushroom industry. This has led to a large number of "synonyms" (different names for the same strain) in production, causing confusion among production seeds and compromising the rights of breeders. Problems in Enoki mushroom production, such as abnormal primordium formation, patchy buds, premature cap opening, and water mushrooms, have severely impacted yield and marketability, affecting the economic benefits of companies. In addition, with the development of the market, the market and consumers have higher and higher requirements for the quality of enoki mushrooms, and traditional enoki mushroom varieties are difficult to meet market consumption needs. Summary of the Invention

[0003] The purpose of the present invention is to provide a Flammulina filiformis variety X129 and an identification method thereof in view of the shortcomings of existing variety identification technologies.

[0004] Another object of the present invention is to provide a Flammulina filiformis variety X129 with a thick cap and no cap opening and an identification method thereof to address the problem of premature cap opening in the production of Flammulina filiformis.

[0005] Another object of the present invention is to provide a Flammulina filiformis variety X129 with a thick stipe, few buds, small cross-sectional pores, and off-white cut roots, and an identification method thereof, in order to address the problems of loose and yellowing cut roots in existing enoki mushroom production.

[0006] The first aspect of the present application provides a thread-capped shiitake mushroom (Flammulina filiformis) variety X129, which was deposited on June 6, 2025 at the General Microbiology Center of the China Culture Collection Administration (address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China), and its biological preservation number is: CGMCC No. 42022.

[0007] In some embodiments, the Flammulina filiformis variety X129 fruiting body has the characteristics of being off-white in color, having a thick cap without an open cap, a thick stipe, a relatively small number of buds, a compact root, and slightly yellow cut roots.

[0008] The aforementioned Flammulina velutipes variety X129 was bred through a single spore hybridization of parent X69 (independently bred by Shanghai Xuerong Biotechnology Co., Ltd.) and parent X70 (independently bred by Shanghai Xuerong Biotechnology Co., Ltd.). On PDA medium, the mycelium of Flammulina velutipes X129 is white, robust, and not densely packed, with a slight pale outer layer. It lacks pollen spores, and has a round, fuzzy colony with long tips. The optimal culture temperature for mycelium is 19°C-20°C. At harvest, the fruiting body has a small, round, thick, and inward-curling cap, with a mountain-shaped apex in longitudinal section. The stipe is columnar, robust, and slightly yellowish. It has few buds, a compact root, and small holes and pores in cross section. The root appears off-white after cutting. Overall commercial properties and quality are excellent.

[0009] In a second aspect, the present application provides an identification method for the Flammulina filiformis variety X129 described in any one of the above embodiments, wherein the identification method uses a molecular fingerprint consisting of 8 specific MNP labeling sites for identification.

[0010] In some embodiments, the primer sequences for the eight specific MNP labeling sites are as follows:

[0011] MNP 1 forward primer (5'-3') SEQ ID NO. 1:

[0012] CAAGATGGCATCTTCTTGGGAA;

[0013] Reverse primer (5'-3') SEQ ID NO.2:

[0014] GATGAATGGAGAAAGCCGTATGTAC;

[0015] Forward primer (5'-3') of MNP 2 SEQ ID NO.3:

[0016] GAAATAGACACTGCCGTCAACTTC;

[0017] Reverse primer (5'-3') SEQ ID NO.4:

[0018] TCGATAAGCAAGTTGGTCTCCAA;

[0019] Forward primer (5'-3') of MNP 3 SEQ ID NO.5:

[0020] TTTTCAACCTGGAGACGAAGATTGA;

[0021] Reverse primer (5'-3') SEQ ID NO.6:

[0022] AACAATACGCAATCGATACCAAGAC;

[0023] Forward primer (5'-3') of MNP 4 SEQ ID NO.7:

[0024] GTAAACATTGAGGCTATCATACCGC;

[0025] Reverse primer (5'-3') SEQ ID NO.8:

[0026] GGGTATATCATTCGCTAGATGCAGA;

[0027] Forward primer (5'-3') of MNP 5 SEQ ID NO.9:

[0028] GTCAATCATGAAGTGGCTGAAGTG;

[0029] Reverse primer (5'-3') SEQ ID NO.10:

[0030] AGAATACCTGGACAAGAAAGCTGTC;

[0031] Forward primer (5'-3') of MNP 6 SEQ ID NO.11:

[0032] GTATAAAGCCCACAGCCTTCTTACT;

[0033] Reverse primer (5'-3') SEQ ID NO.12:

[0034] AACACGGATGACAAGATCCATATCT;

[0035] MNP 7 forward primer (5'-3') SEQ ID NO.13:

[0036] CATTGACAGGAACAGCAACACC;

[0037] Reverse primer (5'-3') SEQ ID NO.14:

[0038] GAGAAAAAGTTCTATGAACCAGCCC;

[0039] Forward primer (5'-3') of MNP 8 SEQ ID NO.15:

[0040] CATAGCATAGGTGGATAAAATGCGG;

[0041] Reverse primer (5'-3') SEQ ID NO.16:

[0042] GTCTTGAAGATGGCAACCAATCTG.

[0043] In some embodiments, the method for identifying the Flammulina filiformis variety X129 comprises the following steps:

[0044] (1) Extracting total genomic DNA from the mycelia of all tested Flammulina velutipes samples;

[0045] (2) using the total genomic DNA as a template, performing PCR amplification using primers such as MNP1 to MNP8;

[0046] (3) Sequencing each amplified product to obtain sequencing data;

[0047] (4) Based on the sequencing data, the genotypes of the eight sites in each of the tested Flammulina velutipes mycelium samples are determined. When the genotypes corresponding to the eight sites are heterozygous sequences, the Flammulina velutipes to be tested is of the X129 variety; if not, the Flammulina velutipes to be tested is of a non-X129 variety.

[0048] In some embodiments, in the method for identifying the Flammulina filiformis variety X129, a kit is used to extract total genomic DNA from the mycelia of all Flammulina filiformis samples to be tested.

[0049] In some embodiments, in the method for identifying Flammulina filiformis variety X129, the PCR amplification system comprises:

[0050] 0.2 μM 4 μL primer set;

[0051] 4 μL of 20 ng / μL to 30 ng / μL DNA template;

[0052] GenoPlexs 3×T Master Mix 10μL;

[0053] ddH2O 12μL.

[0054] In some embodiments, the PCR amplification reaction procedure is: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 20 seconds, annealing at 60°C for 4 minutes, 15 cycles; extension at 72°C for 4 minutes; and storage at 10°C.

[0055] In some embodiments, in the method for identifying the Flammulina filiformis variety X129, each amplification product is sequenced using Illumina Next Seq550.

[0056] In a third aspect, the present application provides an application of the Flammulina filiformis variety X129 described in any one of the above embodiments in Flammulina filiformis breeding.

[0057] In a fourth aspect, the present application provides an application of the Flammulina filiformis variety X129 described in any of the above embodiments in food production.

[0058] The enoki mushroom variety X129 in this application is an excellent factory-produced variety with a short growth cycle, strong disease resistance, high yield, good appearance, good taste and high nutritional quality, which provides a basis for breaking the difficulties faced by the enoki mushroom industry and for the transformation and upgrading of the industry.

[0059] The Flammulina velutipes variety X129, described in this application, has an average yield of 555g / bottle (1500mL) after factory-grown in bottles, exceeding both its parent X69 (545g / bottle) and its parent X70 (500g / bottle). Its growth cycle is one day faster than its parent X69 and two days slower than its parent X70. The X129 variety has a thick cap, averaging 6.73mm in diameter, 1.64mm in thickness, and 4.23mm in height. The stipe has an average diameter of 3.5mm and a length of 16.6mm. The fruiting bodies of the X129 variety are off-white in appearance; the cap is small, round, thick, and inward-curling, with a mountain-shaped top in longitudinal section. The stipe is thicker, resulting in uniform fruiting. The cap is slightly larger than that of its parent X69, with a more inward curl, less tendency to open, and a slightly yellowish color. The stipe is thicker than that of its parent X70, with fewer lateral buds, better firmness, and a lighter color. The excellent traits of the Flammulina velutipes variety X129 meet diverse market demands, making it suitable for year-round factory-based bottle cultivation and promising prospects for application and promotion. The MNP fingerprint of the Flammulina velutipes variety X129 is specific and reliable for identifying the species, offering advantages over morphological identification, such as intuitive results, reduced error, and unaffected by production conditions. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments, wherein:

[0061] Figure 1 This is a comparison chart of the mycelial antagonism test between the Flammulina velutipes variety X129 and its parents X69 and X70;

[0062] Figure 2 This is the mycelial growth diagram of the Flammulina velutipes variety X129, its parents X69 and X70, and the main cultivated varieties;

[0063] Figure 3 This is the shake bottle growth chart of Flammulina velutipes variety X129, its parents X69 and X70, and the main cultivated varieties;

[0064] Figure 4 This is a front view of the fruiting bodies of the Flammulina velutipes variety X129, its parents X69 and X70, and the main cultivated varieties at harvest time;

[0065] Figure 5 This is a side morphological diagram of the fruiting bodies of the Flammulina velutipes variety X129, its parents X69 and X70, and the main cultivated varieties at harvest time;

[0066] Figure 6 This is a diagram of the root cutting morphology of the fruiting bodies of the Enoki mushroom variety X129, its parents X69 and X70, and the main cultivated varieties during harvest. DETAILED DESCRIPTION

[0067] To make the above-mentioned objects, features, and advantages of the present invention more clearly understood, the specific embodiments of the present invention are described in detail below with reference to the following examples. Many specific details are set forth in the following description to facilitate a full understanding of the present invention. However, the present invention can be implemented in many other ways than those described herein, and those skilled in the art can make similar modifications without violating the scope of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0068] In the description of the present invention, “several” means more than one, “multiple” means more than two, “greater than”, “less than”, “exceed”, etc. are understood to exclude the number itself, and “above”, “below”, “within”, etc. are understood to include the number itself.

[0069] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention pertains. The terms used herein in the specification of the present invention are for the purpose of describing specific embodiments only and are not intended to limit the present invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0070] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with specific embodiments.

[0071] Flammulina velutipes strain X69 is a cultivar of Flammulina velutipes independently bred by Shanghai Xuerong Biotechnology Co., Ltd. On PDA medium, the strain exhibits dense white mycelium with a lighter inner ring, slow growth, and prominent powdery spores. When cultured in shake flasks, the strain exhibits slow growth, low bacterial count, small pellets, short spines with a few fragments, and a thick clear layer. When grown in a growing room, the mycelium grows slowly, with no bud dropout. At harvest, the fruiting bodies exhibit thick caps, robust, compact stipes, and whiter roots after cutting. The biological conversion rate is 150% to 160%. However, scratching can lead to clogging of the pores, resulting in failure. During the fruiting stage in the growing room, the buds may be patchy, few in number, and the caps of the fruiting bodies may partially open.

[0072] The Flammulina velutipes strain X70 is a cultivar of Flammulina velutipes independently bred by Shanghai Xuerong Biotechnology Co., Ltd. On PDA medium, the strain exhibits dense white mycelium with a lighter outer ring and no pollen spores. When cultured in Erlenmeyer flasks, the strain exhibits rapid growth, small balls, short spines, and a small clear layer. During the fruiting stage in the growing room, the strain grows rapidly; during the harvest period, the fruiting bodies exhibit a small, thick, and unopened cap, a thin stipe, and an overall yellowish color. The bioconversion rate is 145% to 155%. However, there are some drawbacks, such as a small amount of bud dropout during emergence, poor fruiting body uniformity, a large number of lateral buds, numerous crystal mushrooms, and average fruiting body density.

[0073] One embodiment of the present application provides a Flammulina filiformis variety X129, which was deposited on June 6, 2025 at the General Microbiology Center of the China Culture Collection Administration (address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China), and its biological deposit number is: CGMCC No. 42022.

[0074] In this application, the breeding steps for the Flammulina velutipes variety X129 are as follows:

[0075] White Flammulina velutipes strains X69 and X70 were selected as parents. Spores from these two strains were collected and monosporic strains were selected. Thirteen X69 and seven X70 monosporic strains with normal mycelial growth and moderate growth rates were selected. These monosporic strains were then paired for single-sporic hybridization. Microscopic examination revealed 89 hybrid strains with lock-like unions. Sixty-two hybrid progenies were screened in the laboratory based on colony morphology, growth rate, and mycelial morphology in shake flasks, resulting in six hybrid strains with excellent performance. Fruiting was carried out at Shandong Xuerong Biotechnology Co., Ltd., and four hybrid strains with faster mycelial growth, shorter growth cycles, smaller caps, higher yields, and thicker stipes were rescreened. These rescreening results revealed two hybrid strains with yields exceeding those of both the parents and the main cultivated variety. Further pilot tests were conducted using the parent strain and the main production variety as controls. The results showed that the strain, designated X129, performed exceptionally well, achieving significantly higher yields than both the parent strain and the main production variety. Its fruiting bodies were slightly beige in color, with a normal-sized, round, and thick cap, a robust stipe, a few buds, and a firm root. The cross-section showed small holes and pores, and the root was off-white after cutting. Overall, its commercial properties and quality were excellent. This strain was named X129, and an application for a new plant variety right was filed.

[0076] In some embodiments, the Flammulina filiformis variety X129 fruiting body has the characteristics of being off-white in color, having a thick cap without an open cap, a thick stipe, a relatively small number of buds, a compact root, and slightly yellow cut roots.

[0077] The MNP fingerprint of Flammulina velutipes variety X129 is specific and specific for identifying Flammulina velutipes variety X129. The results are reliable and intuitive, with minimal error compared to morphological identification, and are unaffected by production environment conditions. The Flammulina velutipes variety X129 described in this application is a superior, factory-produced variety with a short growth cycle, strong disease resistance, high yield, excellent appearance, good taste, and high nutritional quality. This provides a foundation for addressing the challenges facing the Flammulina velutipes industry and for its transformation and upgrading.

[0078] The comparison chart of mycelial antagonism test between Flammulina velutipes variety X129 and its parents X69 and X70 is shown in Figure 1 shown.

[0079] The mycelial growth and shake flask growth of Flammulina velutipes variety X129, its parents X69 and X70, and the main cultivated varieties are shown in Figure 2 shown.

[0080] See the fruiting body morphology of Flammulina velutipes variety X129, its parents X69 and X70, and the main cultivated varieties. Figure 3 shown.

[0081] The aforementioned Flammulina velutipes variety X129 was bred through a single spore hybridization of parent X69 (independently bred by Shanghai Xuerong Biotechnology Co., Ltd.) and parent X70 (independently bred by Shanghai Xuerong Biotechnology Co., Ltd.). On PDA medium, the mycelium of Flammulina velutipes X129 is white, robust, and not densely packed, with a slight pale outer layer. It lacks pollen spores, and has a round, fuzzy colony with long tips. The optimal culture temperature for mycelium is 19-20°C. At harvest, the fruiting body has a small, round, thick, and inward-curling cap, with a mountain-shaped apex in longitudinal section. The stipe is columnar, robust, and slightly yellowish. It has few buds, a compact root, and small holes and pores in cross section. The root appears off-white after cutting. Overall commercial properties and quality are excellent.

[0082] Traditional companies primarily promote and produce enoki mushroom varieties with a narrow genetic base and highly similar phenotypic traits. Traditional morphological identification methods are unable to distinguish them, leading to frequent misidentifications and the resulting confusion of varieties. ISSR and RAPD methods rely on gel electrophoresis bands for identification, and PCR amplification results are often difficult to replicate due to mismatches, necessitating continuous optimization of the reaction system to improve the reliability of the results. With the rapid development of high-throughput sequencing technology, the development of highly reproducible and accurate variety identification technologies at the whole-genome level has become a new trend. In 2020, MNP markers were promulgated and implemented as a national standard, "MNP Marker Method for Plant Variety Identification" (GB / T 38551-2020). Therefore, developing an accurate, reliable, stable, low-workload, and high-throughput variety identification method would provide technical support for intellectual property protection, market supervision, and rapid identification in variety dispute arbitration in my country.

[0083] Based on this, one embodiment of the present application further provides an identification method for the Flammulina filiformis variety X129 described in any of the above embodiments, wherein the identification method uses a molecular fingerprint consisting of 8 specific MNP labeling sites for identification.

[0084] In some embodiments, the primer sequence for the specific MNP labeling site is as follows:

[0085] MNP 1 forward primer (5'-3') SEQ ID NO. 1:

[0086] CAAGATGGCATCTTCTTGGGAA;

[0087] Reverse primer (5'-3') SEQ ID NO. 2: GATGAATGGAGAAAGCCGTATGTAC; forward primer for MNP 2 (5'-3') SEQ ID NO. 3: GAAATAGACACTGCCGTCAACTTC;

[0088] Reverse primer (5'-3') SEQ ID NO. 4: TCGATAAGCAAGTTGGTCTCCAA; forward primer (5'-3') of MNP 3 SEQ ID NO. 5: TTTTCAACCTGGAGACGAAGATTGA; reverse primer (5'-3') SEQ ID NO. 6: AACAATACGCAATCGATACCAAGAC; forward primer (5'-3') of MNP 4 SEQ ID NO. 7: GTAAACATTGAGGCTATCATACCGC;

[0089] Reverse primer (5'-3') SEQ ID NO. 8: GGGTATATCATTCGCTAGATGCAGA; forward primer (5'-3') of MNP 5 SEQ ID NO. 9: GTCAATCATGAAGTGGCTGAAGTG;

[0090] Reverse primer (5'-3') SEQ ID NO. 10: AGAATACCTGGACAAGAAAGCTGTC; forward primer (5'-3') of MNP 6 SEQ ID NO. 11: GTATAAAGCCCACAGCCTTCTTACT;

[0091] Reverse primer (5'-3') SEQ ID NO. 12: AACACGGATGACAAGATCCATATCT; forward primer (5'-3') of MNP 7 SEQ ID NO. 13: CATTGACAGGAACAGCAACACC;

[0092] Reverse primer (5'-3') SEQ ID NO. 14: GAGAAAAAAGTTCTATGAACCAGCCC; forward primer (5'-3') of MNP 8 SEQ ID NO. 15: CATAGCATAGGTGGATAAAATGCGG; reverse primer (5'-3') SEQ ID NO. 16: GTCTTGAAGATGGCAACCAATCTG.

[0093] In some embodiments, the method for identifying the Flammulina filiformis variety X129 comprises the following steps:

[0094] (1) Extracting total genomic DNA from the mycelia of all tested Flammulina velutipes samples;

[0095] (2) using the total genomic DNA as a template, performing PCR amplification using primers as described in MNP 1 to MNP 8;

[0096] (3) Sequencing each amplified product to obtain sequencing data;

[0097] (4) Based on the sequencing data, the genotypes of the eight sites in each of the tested Flammulina velutipes samples are determined. When the genotypes corresponding to the eight sites are heterozygous sequences, the tested Flammulina velutipes is of the X129 variety; if not, the tested Flammulina velutipes is of a non-X129 variety.

[0098] In some embodiments, in the method for identifying the Flammulina filiformis variety X129, a kit is used to extract total genomic DNA from the mycelia of all Flammulina filiformis samples to be tested.

[0099] In some embodiments, in the method for identifying Flammulina filiformis variety X129, the PCR amplification system comprises:

[0100] 0.2 μM 4 μL primer set;

[0101] 4 μL of 20 ng / μL to 30 ng / μL DNA template;

[0102] GenoPlexs 3×T Master Mix 10μL;

[0103] ddH2O 12μL.

[0104] In some embodiments, the PCR amplification reaction procedure is: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 20 seconds, annealing at 60°C for 4 minutes, 15 cycles; extension at 72°C for 4 minutes; and storage at 10°C.

[0105] In some embodiments, in the method for identifying the Flammulina filiformis variety X129, each amplification product is sequenced using Illumina Next Seq550.

[0106] One embodiment of the present application also provides a use of the Flammulina filiformis variety X129 described in any of the above embodiments in Flammulina filiformis breeding.

[0107] One embodiment of the present application also provides a use of the Flammulina filiformis variety X129 described in any of the above embodiments in food production.

[0108] The Flammulina velutipes variety X129, described in this application, has an average yield of 555g / bottle (1500mL) after factory-grown in bottles, exceeding its parent varieties X69 (545g / bottle) and X70 (500g / bottle). Its growth cycle is 1 day faster than its parental control, X69, and 2 days slower than its X70. The X129 variety has a thick cap, averaging 6.73mm in diameter, 1.64mm in thickness, and 4.23mm in height. The stipes have an average diameter of 3.5mm and a length of 16.6mm. The fruiting bodies of the X129 variety are off-white in appearance; the cap is small, round, thick, and inward-curling, with a mountain-shaped top in longitudinal section. The stipes are thicker, resulting in uniform fruiting. The cap is slightly larger than that of its parent, X69, with a more inward curl, less tendency to open, and a slightly yellowish color. The stipes are thicker, with fewer lateral buds, better firmness, and a lighter color than those of its parent, X70. The excellent traits of the Flammulina velutipes variety X129 meet diverse market demands, making it suitable for year-round factory-based bottle cultivation and promising prospects for application and promotion. The MNP fingerprint of the Flammulina velutipes variety X129 is specific and reliable for identifying the species, offering advantages over morphological identification, such as intuitive results, reduced error, and unaffected by production conditions.

[0109] Example 1

[0110] A method for identifying the Flammulina velutipes variety X129, which utilizes a molecular fingerprint consisting of eight specific MNP marker sites for identification, specifically comprising the following steps:

[0111] Test materials: There are 216 strains of Flammulina velutipes, including the test strain X129, its parents, and the main cultivated varieties.

[0112] (1) Mycelial culture: The Flammulina velutipes strain X129 was transferred to potato dextrose agar (PDA) solid medium and cultured at 19°C for 7 days before collecting the mycelia.

[0113] (2) Total genomic DNA extraction: The total genomic DNA of the above-mentioned Flammulina velutipes mycelium sample to be tested was extracted using a kit, and the purity of the DNA of the Flammulina velutipes mycelium sample to be tested was determined using a spectrophotometer. 1 μL of the DNA of the Flammulina velutipes mycelium sample to be tested was measured using a Qubit fluorescence quantification instrument, and the concentration of the sample DNA was adjusted to between 30 ng / μL and 50 ng / μL.

[0114] (3) Multiplex polymerase chain reaction (PCR): Multiplex PCR was used to amplify the MNP marker sites of the above-extracted Flammulina velutipes strain X129 sample to obtain multiplex PCR amplification products.

[0115] (3-1) The multiplex PCR amplification system was prepared in a total volume of 30 μL, including: 4 μL of primer set (each primer, 0.2 μM concentration), 4 μL of total genomic DNA (20 ng / μL to 30 ng / μL) of the tested Flammulina velutipes mycelium sample, 10 μL of GenoPlexs 3×T Master Mix (manufacturer: Shijiazhuang Boridi Biotechnology Co., Ltd.), and 12 μL of ddH2O. The mixture was shaken and mixed to obtain a mixture for PCR amplification.

[0116] (3-2) PCR amplification reaction program: 95°C, 3 min; (95°C, 20 s; 60°C, 4 min) × 15 cycles; 72°C, 4 min; storage at 10°C. Purify the multiplex PCR amplification products.

[0117] (4) Construction of high-throughput sequencing library and sequencing: Perform high-throughput sequencing on the high-throughput sequencing library obtained from multiplex PCR amplification according to the operating instructions of the high-throughput sequencing kit and high-throughput sequencer. The average coverage of high-throughput sequencing is set to be greater than 700 times, and the sequencing length is not less than 300 bp.

[0118] (4-1) Construction of high-throughput sequencing library: Add 10 μL GenoPlexs 3×T Master Mix, 2 μL 5 μM P5 primer, 2 μL 5 μM P7 barcode primer (primers contain sample barcodes), and 16 μL ddH2O to the multiplex PCR amplification products, shake to mix, and centrifuge briefly.

[0119] The multiplex PCR amplification reaction program was as follows: 95°C, 3 min; (95°C, 15 s; 58°C, 15 s; 70°C, 30 s) × 8 cycles; 72°C, 5 min; and storage at 10°C. The amplified products were purified to obtain sequencing libraries.

[0120] (4-2) Sequencing: High-throughput sequencing was performed using an Illumina Next Seq550 sequencer to sequence the sequencing library and obtain sequencing data of the tested Flammulina velutipes mycelium sample. Detailed sequencing steps are provided in the instruction manual of the sequencer.

[0121] (5) Data alignment: The sequencing data of Flammulina velutipes strain X129 were aligned to the DNA sequence of the MNP marker site on the Flammulina velutipes reference genome, and the average coverage of the detected marker site was calculated. The genotype of the detected MNP marker site was recorded as all the detected alleles at that site, where the detected allele refers to the detected DNA fragment consisting of the first to the last base of the marker, and different detected alleles are separated by " / ".

[0122] Using the data alignment software Bowtie2 (version 2.1.0), the sequencing data of the Flammulina velutipes mycelium samples were aligned to the Flammulina velutipes reference genome to obtain the MNP-labeled DNA sequence for each Flammulina velutipes mycelium sample. The alignment results were saved in the Sequence Alignment / Map (SAM) format. The eight MNP-labeled loci and primer information for Flammulina velutipes cultivar X129 are shown in Table 1.

[0123] Table 1 List of 8 MNP marker sites and primer information of Flammulina velutipes variety X129

[0124]

[0125] Multiplex PCR amplification and sequencing of 216 enoki mushroom varieties revealed that at the eight MNP loci, the genotype corresponding to X129 was heterozygous, while the remaining genotypes were homozygous. This suggests significant differences in the DNA fingerprints of X129 from its parent and the main cultivated varieties.

[0126] (6) Calculation of genetic similarity: Based on the principle that different strains of Flammulina velutipes are considered different if at least one SNP differs in the alleles of the same MNP marker locus, the number of differential MNP markers between the different Flammulina velutipes strains is counted. Based on the differential MNP marker loci, marker loci that can significantly distinguish any Flammulina velutipes strain are screened. When the genetic similarity (GS) between the tested Flammulina velutipes mycelium sample and the control sample is less than 97%, they are judged as "different strains."

[0127] Genetic similarity GS = n / N × 100%, where N is the number of MNP sites amplified jointly by the tested strain and the X129 variety, and n is the number of MNP sites with exactly the same genotype among the MNP sites amplified jointly by the tested strain and the X129 variety. The genetic similarity results between the Flammulina velutipes variety X129 and the other 215 Flammulina velutipes strains are shown in Table 2.

[0128] Table 2 Genetic similarity (GS) between Flammulina velutipes X129 and 215 other Flammulina velutipes strains

[0129]

[0130]

[0131]

[0132]

[0133]

[0134]

[0135] As shown in Table 2, the genetic similarity between Flammulina velutipes cultivar X129 and the other 215 strains was as high as 89.44% and as low as 0%. It also shared 82.46% genetic similarity with its parent, X69 (test number: JZG221224126), 80.00% genetic similarity with its parent, X70 (test number: JZG221224127), and 81.34% genetic similarity with the main production strain (test number: JZG220608004). These results indicate that X129 exhibits significant genetic differences from its parent, the main production strain, and other strains, demonstrating that the MNP marker constructed in this study can effectively identify X129.

[0136] Example 2

[0137] This example is used to conduct a variety comparison cultivation test for factory production of the Flammulina velutipes variety X129 obtained in Example 1.

[0138] Variety comparison test strain: X129, main production variety

[0139] Experimental location: Shandong Xuerong Biotechnology Co., Ltd. (hereinafter referred to as Shandong Xuerong Company).

[0140] Experimental Arrangements: The experimental strains were uniformly prepared and cultivated in factory-scale bottles (1500 mL, 353 g / bottle (dry material)) according to the production management methods of Shandong Xuerong Company. Specific cultivation information is shown in Table 3.

[0141] Table 3 Comparison of multiple batches of products in cultivation test

[0142]

[0143] As can be seen from Table 3,

[0144] (1) The average growth period of the velvet mushroom variety X129 was 25.5 days, while the average growth period of the main cultivated varieties was 26.5 days. The growth period of the velvet mushroom variety X129 was 1 day shorter than that of the main cultivated varieties.

[0145] (2) The average single-bottle yield of the vellum variety X129 was 555g, and the average single-bottle yield of the main cultivated varieties was 545g. The average single-bottle yield of the vellum variety X129 was 1.83% higher than that of the control main cultivated varieties (the difference was significant).

[0146] (3) In terms of commercial properties, the cap of the fruiting body of the Flammulina velutipes variety X129 is thicker and less likely to open than that of the main cultivated varieties in the control production. The stipe is thicker and more compact than that of the main cultivated varieties in the control production. The cross section after root cutting is delicate and not easy to loosen, and it is resistant to storage.

[0147] The results show that X129 has excellent overall performance, is in line with the factory cultivation production model of Enoki mushrooms and market quality requirements, and has huge market potential.

[0148] The enoki mushroom variety X129 and the main cultivated varieties were subjected to multiple batches of cultivation tests, and the test results are shown in Table 4.

[0149] Table 4 Results of multiple batches of cultivation tests

[0150]

[0151] Note: '**' indicates P < 0.01, extremely significant difference; '*' indicates P < 0.05, significant difference; ' / ' indicates no significant difference.

[0152] Example 3

[0153] This embodiment provides a cultivation method for the Flammulina velutipes variety X129.

[0154] The cultivation method of the Flammulina velutipes variety X129 comprises the following steps:

[0155] (1) Ingredients: Mix the culture material accurately according to the formula requirements and stir it thoroughly. Add water until the water content reaches 67.5%-69.5% and the pH value reaches 6.5-7.0. Adjust the stirring time according to seasonal changes to prevent the mixture from becoming rancid. Stir until the mixture is bottled.

[0156] (2) Bottling: Use 1500mL high-temperature resistant plastic bottles on a bottling machine to complete the bottling process. The bottles should be tight at the top and loose at the bottom, with the difference in the filling between bottles less than 50g. The filling height should be 1cm to 1.5cm from the bottle shoulder, and a hole should be punched in the middle to the bottom of the bottle. The bottle cap should be put on immediately after bottling.

[0157] (3) Sterilization: After bottling, high-pressure and high-temperature sterilization should be carried out immediately, maintaining the temperature at 100°C for 60 minutes, then raising the temperature to 121°C and maintaining the temperature for 60 minutes. All microorganisms and spores in the culture medium must be completely killed.

[0158] (4) Cooling: After sterilization, the bottle baskets are pushed into the cooling room to be cooled to below 22°C. Purification devices and refrigeration equipment are installed in the cooling room and inoculation room.

[0159] (5) Inoculation: Liquid culture inoculation. During inoculation, the temperature in the bottle should be controlled below 22°C, and a microscope should be used to check to ensure that the liquid culture is free of contamination and has strong vitality before it can be used for inoculation and cultivation. When using liquid culture, the inoculation volume of each cultivation bottle is 35mL to 37mL of culture liquid, of which the wet weight of mycelium is about 1.15g / 10mL and the number of viable bacteria is about 18,300 cfu / mL.

[0160] (6) Cultivation: The temperature in the incubation room is controlled at 16°C to 18°C, the humidity is maintained at approximately 80%, and the CO2 concentration is controlled at 2000 ppm to 3000 ppm. The incubation time is 20 to 22 days.

[0161] (7) Scraping: After the culture is completed, the filled cultivation bottles are scratched with a scratching machine. The scratching depth should be 1cm to 1.5cm. The old mushroom blocks on the surface are removed and the material surface is kept flat. After adding water, the bottles are placed in the growth room for fruiting.

[0162] (8) Fruiting body growth: 7 to 8 days after the mycelium recovers and sprouts, the temperature is controlled at 14℃ to 16℃, the relative humidity is 95%-100%, the CO2 concentration is less than 2000ppm, and there is no light. After sprouting, the temperature is adjusted according to the growth of the mushroom body, and the control range is 4℃ to 15℃, the relative humidity is controlled at 85%-95%, the CO2 concentration is controlled at 2000ppm to 8000ppm, and the light intensity is 5Lux to 20Lux.

[0163] (9) Harvesting and packaging: Harvest when the mushroom body reaches the height of the sleeve paper, the cap has not opened, and the cap diameter is 0.5cm to 1cm; when harvesting, pick the whole bunch of Enoki mushrooms, cut off the bottom culture medium with a knife, and put them into cold storage after packaging. The temperature of the cold storage should be controlled at 3℃ to 5℃.

[0164] In the above embodiments, the description of each embodiment has its own focus. For parts that are not described in detail in a certain embodiment, reference can be made to the relevant descriptions of other embodiments.

[0165] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0166] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention shall be determined by the appended claims.

Claims

1. A Flammulina filiformis variety X129, characterized in that: The strain was deposited on June 6, 2025 at the General Microbiology Center of China Culture Collection Administration (Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China), and its biological deposit number is: CGMCC No.42022.

2. The Flammulina filiformis variety X129 according to claim 1, characterized in that The Flammulina filiformis variety X129 fruiting body has the characteristics of being off-white in color, having a thick cap without an open cap, a thick stipe, a relatively small number of buds, a compact root, and slightly yellow cut roots.

3. A method for identifying the Flammulina filiformis variety X129 according to claim 1 or 2, characterized in that: The identification method uses a molecular fingerprint consisting of 8 specific MNP labeling sites for identification.

4. The method for identifying the Flammulina filiformis variety X129 according to claim 3, wherein: The primer sequences of the 8 specific MNP labeling sites are as follows: MNP 1 forward primer (5'-3') SEQ ID NO. 1: CAAGATGGCATCTTCTTGGGAA; Reverse primer (5'-3') SEQ ID NO. 2: GATGAATGGAGAAAGCCGTATGTAC; Forward primer (5'-3') of MNP 2 SEQ ID NO.3: GAAATAGACACTGCCGTCAACTTC; Reverse primer (5'-3') SEQ ID NO. 4: TCGATAAGCAAGTTGGTCTCCAA; Forward primer (5'-3') of MNP 3 SEQ ID NO.5: TTTTCAACCTGGAGACGAAGATTGA; Reverse primer (5'-3') SEQ ID NO. 6: AACAATACGCAATCGATACCAAGAC; Forward primer (5'-3') of MNP 4 SEQ ID NO.7: GTAAACATTGAGGCTATCATACCGC; Reverse primer (5'-3') SEQ ID NO. 8: GGGTATATCATTCGCTAGATGCAGA; Forward primer (5'-3') of MNP 5 SEQ ID NO.9: GTCAATCATGAAGTGGCTGAAGTG; Reverse primer (5'-3') SEQ ID NO. 10: AGAATACCTGGACAAGAAAGCTGTC; Forward primer (5'-3') of MNP 6 SEQ ID NO.11: GTATAAAGCCCACAGCCTTCTTACT; Reverse primer (5'-3') SEQ ID NO. 12: AACACGGATGACAAGATCCATATCT; MNP 7 forward primer (5'-3') SEQ ID NO.13: CATTGACAGGAACAGCAACACC; Reverse primer (5'-3') SEQ ID NO. 14: GAGAAAAAAGTTCTATGAACCAGCCC; Forward primer (5'-3') of MNP 8 SEQ ID NO.15: CATAGCATAGGTGGATAAAATGCGG; Reverse primer (5'-3') SEQ ID NO. 16: GTCTTGAAGATGGCAACCAATCTG.

5. The method for identifying the Flammulina filiformis variety X129 according to claim 4, wherein: The steps include: (1) Extracting total genomic DNA from the mycelia of all tested Flammulina velutipes samples; (2) using the total genomic DNA as a template, performing PCR amplification using primers as described in MNP 1 to MNP 8; (3) Sequencing each amplified product to obtain sequencing data; (4) Based on the sequencing data, the genotypes of the eight sites in each of the tested Flammulina velutipes samples are determined. When the genotypes corresponding to the eight sites are heterozygous sequences, the tested Flammulina velutipes is of the X129 variety; otherwise, the tested Flammulina velutipes is of a non-X129 variety.

6. The method for identifying Flammulina filiformis variety X129 according to claim 5, wherein: In step (1), a kit is used to extract the total genomic DNA of all the Flammulina velutipes mycelium samples to be tested.

7. The method for identifying the Flammulina filiformis variety X129 according to claim 5, wherein: In step (1), the PCR amplification system includes: 0.2 μM 4 μL primer set; 4 μL of 20 ng / μL to 30 ng / μL DNA template; GenoPlexs 3×T Master Mix 10μL; ddH2O 12 μL; Optionally, the PCR amplification reaction program is: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 20 seconds, annealing at 60°C for 4 minutes, 15 cycles; extension at 72°C for 4 minutes; and storage at 10°C.

8. The method for identifying Flammulina filiformis variety X129 according to any one of claims 5 to 7, wherein: In step (2), each amplification product was sequenced using Illumina NextSeq550.

9. Use of the Flammulina filiformis variety X129 according to claim 1 or 2 in breeding of Flammulina filiformis.

10. Use of the Flammulina filiformis variety X129 according to claim 1 or 2 in food production.

Citation Information

Patent Citations

  • Pure white flammulina velutipes strain as well as molecular marker and application thereof

    CN117946862A

  • Yellow flammulina velutipes variety not prone to browning and MNP molecular identification method and application thereof

    CN119040145A

  • Flammulina velutipes variety with high sweet amino acid content as well as MNP molecular identification method and application of flammulina velutipes variety

    CN119040146A