Recombinant escherichia coli for producing Porphyra 334 and preparation method thereof

Abstract

The invention discloses recombinant escherichia coli for producing Porphyra 334 and a preparation method of the recombinant escherichia coli. The invention belongs to the field of synthetic biology, and particularly relates to recombinant escherichia coli for producing Porphyra 334 and a preparation method of the recombinant escherichia coli. The recombinant strain provided by the invention can be used for synthesizing the mycosporine-like amino acid Porphyra 334 by using glucose as a raw material, the capability of producing the Porphyra 334 is obviously improved, and the recombinant strain can be used for large-scale preparation of the mycosporine-like amino acid Porphyra 334. Compared with the traditional method for extracting from algae, the microbial fermentation method disclosed by the invention has the advantages of short production period, no restriction by climate and environment, high yield and the like.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a recombinant Escherichia coli for synthesizing Porphyra 334, a construction method and an application thereof. Background Art

[0002] Ultraviolet (UV) rays are categorized by wavelength as UV-A (315–400 nm), UV-B (280–315 nm), and UV-C (100–280 nm). UV-A and UV-B can penetrate the ozone layer, causing long-term, cumulative damage to the skin and ecosystems. Long-wave UV-A penetrates deeply into the dermis, inducing photooxidative reactions and collagen degradation, leading to skin aging and photodamage. Medium-wave UV-B primarily causes sunburn in the epidermis and the formation of cyclobutane pyrimidine dimers in DNA, which can lead to genetic mutations and skin cancer risk. Commonly used chemical sunscreens (such as avobenzone and octocrylene) and physical sunscreens (titanium dioxide and zinc oxide) suffer from poor photostability, residual white film, allergic reactions, and environmental accumulation. There is an urgent need for safer, more environmentally friendly, and effective natural UV protection ingredients.

[0003] Porphyra 334, a highly effective, natural, and stable UV-absorbing molecule, has become a core ingredient in the next generation of sunscreen and skin care products due to its exceptional photophysical properties and bioactivity. Its absorption peak is located at approximately 334 nm, and it possesses an extremely high molar extinction coefficient. It dissipates light energy into heat through a non-radiative transition within femtoseconds, thereby preventing free radical formation and biomacromolecule damage. Porphyra 334 exhibits excellent photothermal stability across a wide pH range (1-11) and at elevated temperatures (≤100°C). It also possesses antioxidant properties, activating the Keap1–Nrf2 pathway and alleviating UV-induced oxidative stress and inflammatory responses.

[0004] Traditional extraction of Porphyra 334 from red algae such as Porphyra umbilicalis requires large-scale seaweed cultivation, harvesting, and multiple organic solvent extraction and column chromatography purification steps. This process is characterized by long cycle times, high solvent consumption, and low yields (≤0.1% dry weight). Chemical synthesis, due to the molecule's numerous chiral centers and rich functional groups, requires a 10-step synthetic route with an overall yield of less than 5%, making it prohibitively expensive. Furthermore, the chemical synthesis process requires harsh conditions and metal catalysts, raising concerns about environmental pollution and post-processing.

[0005] In recent years, metabolic engineering strategies have reproduced the MAA (Mycosporine-Like AminoAcids) biosynthesis pathway in a variety of microorganisms. However, due to the lack of effective regulatory optimization strategies, it is currently impossible to synthesize Porphyra-334 at high levels in microbial strains. Porphyra-334 yields are low (294.2 mg / L in shake flasks and 1.21 g / L in fed-batch fermentation). (Efficient production of natural sunscreens shinorine, porphyra-334, and mycosporine-2-glycine in Saccharomyces cerevisiae. Metab Eng. 2023 Jul;78:137-147.) Practical experiments require the addition of expensive intermediates such as L-methionine, glycine, and L-threonine, making these technologies difficult to implement. This method, which uses glucose as the sole raw material for the synthesis of Porphyra 334, offers the advantages of a broad raw material supply, a short production cycle, environmental friendliness, and manageable costs, laying a solid foundation for the industrial production and widespread application of Porphyra 334. Summary of the Invention

[0006] The problem to be solved by the present invention is how to improve the synthesis yield and efficiency of Porphyra 334.

[0007] In order to solve the above technical problems,

[0008] In a first aspect, the present invention provides a recombinant Escherichia coli, wherein the recombinant Escherichia coli comprises the following characteristics:

[0009] A1), does not contain the transaldolase B (talB) gene;

[0010] A2), does not contain the transaldolase A (talA) gene;

[0011] A3) containing substances that regulate the expression of the 6-phosphate glucose dehydrogenase (zwf) gene or the activity or content of 6-phosphate glucose dehydrogenase;

[0012] A4), does not contain the glucose-6-phosphate isomerase (pgi) gene;

[0013] A5) containing substances that regulate the expression of the transketolase A (tktA) gene or regulate the activity or content of transketolase A;

[0014] A6) containing substances that regulate the expression of the transketolase B (tktB) gene or regulate the activity or content of transketolase B;

[0015] A7), genes encoding the mycosporin-like amino acid Porphyra 334 synthesis gene cluster (NlmysABCD);

[0016] Furthermore, in the recombinant Escherichia coli, the recombinant Escherichia coli also includes the following characteristics:

[0017] A8), does not contain the methionine synthesis transcription factor (metJ) gene;

[0018] A9) containing substances that regulate the expression of the methionine adenosyltransferase (metK) gene or the activity or content of methionine adenosyltransferase;

[0019] A10), does not contain the pyruvate formate lyase (pflB) gene;

[0020] A11) Substances that contain S-adenosylhomocysteine ​​nucleosidase (mtn) gene expression and / or regulate S-adenosylhomocysteine ​​nucleosidase activity or content;

[0021] A12) Substances that contain S-ribosylhomocysteine ​​lyase (luxS) gene expression and / or regulate the activity or content of S-ribosylhomocysteine ​​lyase;

[0022] Furthermore, in the recombinant Escherichia coli, the recombinant Escherichia coli also includes the following characteristics:

[0023] A13) substances containing the expression of phosphogluconate dehydratase (edd) gene or regulating the activity or content of phosphogluconate dehydratase;

[0024] A14), does not contain the pyruvate oxidase (poxB) gene;

[0025] A15) Substances that contain homoserine dehydrogenase (thrA) gene expression or regulate homoserine dehydrogenase activity or content;

[0026] A16) Substances that contain homoserine kinase (thrB) gene expression or regulate homoserine kinase activity or content;

[0027] A17) Substances that contain threonine synthetase (thrC) gene expression or regulate the activity or content of threonine synthetase;

[0028] Furthermore, in the recombinant Escherichia coli, the recombinant Escherichia coli also includes the following characteristics:

[0029] A18) substances that contain threonine aldolase (ltaE) gene expression or regulate the activity or content of threonine aldolase;

[0030] A19) substances that contain acetaldehyde dehydrogenase (eutE) gene expression or regulate the activity or content of acetaldehyde dehydrogenase;

[0031] A20), substances containing isocitrate lyase (aceA) gene expression or regulating the activity or content of isocitrate lyase;

[0032] A21), containing the gene encoding glycine dehydrogenase (gdh);

[0033] A22) Substances that contain the expression of the aminomethyltransferase (gcvT) gene or regulate the activity or content of aminomethyltransferase.

[0034] Furthermore, in the recombinant Escherichia coli, the regulation may be upregulation, promotion or improvement.

[0035] Furthermore, in the recombinant Escherichia coli, the substances described in A3) and A9) are promoters, and the promoter is P 119 .

[0036] Furthermore, in the recombinant Escherichia coli, the substances described in A5), A6), A11), A12), A15), A16), A17), A18), A19), and A20) are promoters, and the promoter is P CPA1 ;

[0037] Furthermore, in the recombinant Escherichia coli, the substance described in A13) is a promoter, and the promoter is P J23105 ;

[0038] Furthermore, in the recombinant Escherichia coli, the substance described in A22) is a promoter, and the promoter is P J23110 ;

[0039] Furthermore, in the recombinant Escherichia coli, the P CPA1 The nucleotide sequence is SEQ ID No.1.

[0040] Furthermore, in the recombinant Escherichia coli, the P 119 The nucleotide sequence is SEQ ID No.2.

[0041] Furthermore, in the recombinant Escherichia coli, the P J23105 The nucleotide sequence is SEQ ID No.3.

[0042] Furthermore, in the recombinant Escherichia coli, the P J23110 The nucleotide sequence is SEQ ID No.7.

[0043] Furthermore, in the recombinant Escherichia coli, A5) the mycosporin-like amino acid Porphyra 334 synthesis gene cluster may be derived from Nostoc linkia NIES-25.

[0044] Furthermore, in the recombinant Escherichia coli, A19) the glycine dehydrogenase gene may be derived from Mycobacterium tuberculosis.

[0045] In a second aspect, the present invention provides a method for preparing the above-mentioned recombinant Escherichia coli, wherein the method uses Escherichia coli as a recipient bacterium and comprises the following preparation steps:

[0046] M1), knocking out the transaldolase B (talB) gene of claim 1 in the recipient bacteria;

[0047] M2), knocking out the transaldolase A (talA) gene of claim 1 in the recipient bacteria;

[0048] M3), knock out the wild-type promoter that drives the expression of the above-mentioned 6-phosphate glucose dehydrogenase (zwf) gene in the recipient bacteria and replace it with the above-mentioned P 119 .

[0049] M4), knocking out the glucose-6-phosphate isomerase (pgi) gene of claim 1 in the recipient bacteria;

[0050] M5), knock out the wild-type promoter that drives the expression of the transketolase A (tktA) gene in the recipient bacteria and replace it with the P CPA1 ;

[0051] M6), knock out the wild-type promoter that drives the expression of the transketolase B (tktB) gene in the recipient bacteria and replace it with the P CPA1 ;

[0052] M7), introducing the mycosporin-like amino acid Porphyra 334 synthesis gene cluster (NlmysABCD) genes into the recipient bacteria;

[0053] Furthermore, in the method described above, the method further comprises the following preparation steps:

[0054] M8), knocking out the above-mentioned methionine transcription factor (metJ) gene in the recipient bacteria;

[0055] M9), the wild-type promoter that drives the expression of the methionine adenosyltransferase (metK) gene in the recipient bacteria was knocked out and replaced with the P 119 ;

[0056] M10), knocking out the pyruvate formate lyase (pflB) gene in the recipient strain and replacing it with the S-adenosylhomocysteine ​​nucleosidase (mtn) and S-ribosylhomocysteine ​​lyase (luxS) genes;

[0057] Furthermore, in the method described above, the S-adenosylhomocysteine ​​nucleosidase (mtn) and S-ribosylhomocysteine ​​lyase (luxS) described in M10) are produced by P CPA1 The promoter initiates expression.

[0058] Furthermore, in the method described above, the method further comprises the following preparation steps:

[0059] M11), the wild-type promoter that drives the expression of the phosphogluconate dehydratase (edd) gene in the recipient bacteria is knocked out and replaced with the P J23105 ;

[0060] M12), knocking out the pyruvate oxidase (poxB) gene in the recipient bacteria and replacing it with the homoserine dehydrogenase (thrA), homoserine kinase (thrB), and threonine synthase (thrC) genes;

[0061] Furthermore, in the method described above, the homoserine dehydrogenase (thrA), homoserine kinase (thrB) and threonine synthetase (thrC) described in M12) are produced by P CPA1 The promoter initiates expression.

[0062] Furthermore, in the method described above, the method further comprises the following preparation steps:

[0063] M13), knock out the wild-type promoter that drives the expression of the above-mentioned threonine aldolase (ltaE) gene in the recipient bacteria and replace it with the promoter P CPA1 .

[0064] M14), knock out the wild-type promoter that drives the expression of the acetaldehyde dehydrogenase (eutE) gene in the recipient bacteria and replace it with the promoter P CPA1 .

[0065] M15), knocking out the isocitrate lyase (aceA) gene in the recipient bacteria and replacing it with gene cluster 2, which consists of the isocitrate lyase (aceA) gene and the glycine dehydrogenase (gdh) gene;

[0066] Furthermore, in the method described above, the gene cluster 2 described in M15) is composed of P CPA1 The promoter initiates expression.

[0067] M16), knock out the wild-type promoter that drives the expression of the aminomethyltransferase (gcvT) gene in the recipient bacteria and replace it with the promoter P J23110 .

[0068] In a third aspect, the present invention provides the recombinant Escherichia coli prepared by the above method.

[0069] In a fourth aspect, the present invention provides the use of the above-mentioned recombinant Escherichia coli in C1) or C2).

[0070] C1) Application in the production of Porphyra 334;

[0071] C2) Application in the preparation of Porphyra 334 products.

[0072] The product may be a bacterial agent containing the recombinant Escherichia coli and / or a culture of the recombinant Escherichia coli.

[0073] In a fifth aspect, the present invention provides a bacterial agent comprising the aforementioned recombinant Escherichia coli or a culture comprising the aforementioned recombinant Escherichia coli.

[0074] The term "culture" refers to any liquid or solid product (i.e., fermentation product) containing a microbial population after artificial inoculation and cultivation. This refers to a product obtained by growing and / or amplifying microorganisms. It can be a biologically pure culture of the microorganism or contain a certain amount of culture medium, metabolites, or other components produced during the cultivation process.

[0075] In a sixth aspect, the present invention provides a method for preparing Porphyra 334, comprising preparing Porphyra 334 using the above-mentioned recombinant Escherichia coli.

[0076] Furthermore, the method includes culturing the recombinant Escherichia coli in a growth medium to allow the recombinant Escherichia coli to grow.

[0077] Furthermore, the method includes transforming the recombinant Escherichia coli with a transformation medium to prepare Porphyra 334 from the recombinant Escherichia coli cells, wherein the transformation medium contains glucose, glycine, L-threonine, methionine or glucose, glycine, L-threonine or glucose, glycine or glucose.

[0078] In a specific embodiment of the present invention, the transformation medium comprises:

[0079] 1) Composition and final concentrations of Medium B: 48 mM Na2HPO4, 22 mM KH2PO4, 8.6 mM NaCl, 187 mM NH4Cl, 100 g / L glucose, 25 g / L glycine, 25 g / L L-threonine, 10 g / L L-methionine.

[0080] 2) Composition and final concentrations of C medium: 48 mM Na2HPO4, 22 mM KH2PO4, 8.6 mM NaCl, 187 mM NH4Cl, 100 g / L glucose, 25 g / L glycine, 25 g / L L-threonine.

[0081] 3) Composition and final concentrations of D medium: 48 mM Na2HPO4, 22 mM KH2PO4, 8.6 mM NaCl, 187 mM NH4Cl, 100 g / L glucose, 25 g / L glycine.

[0082] 4) Composition and final concentrations of E medium: 48 mM Na2HPO4, 22 mM KH2PO4, 8.6 mM NaCl, 187 mM NH4Cl, 100 g / L glucose.

[0083] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the 6-phosphate glucose dehydrogenase (zwf) is AKT72612.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the zwf is Gene ID: 946370 (2024.7.6).

[0084] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the transaldolase A (hereinafter referred to as talA) is NP_416959.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the transaldolase A is Gene ID: 947006 (2024.7.6).

[0085] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the transaldolase B (hereinafter referred to as talB) is NP_414549.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the transaldolase B is Gene ID: 944748 (2024.7.6).

[0086] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the transketolase A (hereinafter referred to as tktA) is YP_026188.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the transketolase A is Gene ID: 947420 (2024.7.6).

[0087] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the transketolase B (hereinafter referred to as tktB) is NP_416960.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the transketolase B is Gene ID: 945865 (2024.7.6).

[0088] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the glucose-6-phosphate isomerase (hereinafter referred to as pgi) is NP_418449.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the encoding gene is Gene ID: 948535 (2024.7.6).

[0089] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the methionine adenosyltransferase (hereinafter referred to as metK) is NP_417417.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the methionine adenosyltransferase is Gene ID: 945389 (2024.7.6).

[0090] In the present invention, the NCBI Reference Sequence number (NCBI Reference Sequence) of the Porphyra 334 synthetic gene cluster (hereinafter referred to as NlmysABCD) is AP018223.1 (2022.11.15).

[0091] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the methionine biosynthesis transcription factor (hereinafter referred to as metJ) is NP_418373, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 948435 (2024.7.6).

[0092] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the pyruvate formate lyase (hereinafter referred to as pflB) is NP_415423.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the pyruvate formate lyase is Gene ID: 945514 (2024.7.6).

[0093] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the S-adenosylhomocysteine ​​nucleosidase (hereinafter referred to as mtn) is NP_414701.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of its encoding gene is Gene ID: 948542 (2024.7.6).

[0094] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the S-ribosylhomocysteine ​​lyase (hereinafter referred to as luxS) is NP_417172.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 947168 (2024.7.6).

[0095] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the phosphogluconate dehydratase (hereinafter referred to as edd) is NP_416365.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 946362 (2024.7.6).

[0096] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the pyruvate oxidase (hereinafter referred to as poxB) is CAD6018048.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the pyruvate oxidase is Gene ID: 946132 (2024.7.6).

[0097] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the homoserine dehydrogenase (hereinafter referred to as thrA) is NP_414543.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the homoserine dehydrogenase is Gene ID: 945803 (2024.7.6).

[0098] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the homoserine kinase (hereinafter referred to as thrB) is NP_414544.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 947498 (2024.7.6).

[0099] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the threonine synthetase (hereinafter referred to as thrC) is NP_414545.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 945198 (2024.7.6).

[0100] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the L-threonine aldolase (hereinafter referred to as ltaE) is NP_415391.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the L-threonine aldolase is Gene ID: 944955 (2024.7.6).

[0101] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the acetaldehyde dehydrogenase (hereinafter referred to as eutE) is NP_416950.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the acetaldehyde dehydrogenase is Gene ID: 946943 (2024.7.6).

[0102] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the isocitrate lyase (hereinafter referred to as aceA) is NP_418439.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the isocitrate lyase is Gene ID: 948517 (2024.7.6).

[0103] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the glycine dehydrogenase (hereinafter referred to as gdh) is NP_216348.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the glycine dehydrogenase is Gene ID: 885716 (2024.7.6).

[0104] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the aminomethyltransferase (hereinafter referred to as gcvT) is NP_417381.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 947390 (2024.7.6).

[0105] The present invention transforms the recipient bacteria including 1), 2), 3) and 4):

[0106] 1) Knock out the genes for transaldolase A, transaldolase B, and glucose-6-phosphate isomerase in biological cells, and enhance the genes for glucose-6-phosphate dehydrogenase, transketolase A (transketolase1), and transketolase B (transketolase 2) in biological cells.

[0107] 2) Introduce or enhance the Porphyra 334 synthetic gene cluster into biological cells.

[0108] 3) Knock out the gene of the DNA-binding transcriptional repressor MetJ in the biological cells, strengthen the gene of methionine adenosyltransferase in the biological cells, and replace the gene encoding pyruvate formate-lyase with genes encoding S-adenosylhomocysteine ​​nucleosidase and S-ribosylhomocysteine ​​lyase.

[0109] 4) Strengthen the phosphogluconate dehydratase gene in biological cells and replace the gene encoding pyruvate oxidase with genes encoding homoserine dehydrogenase 1, homoserine kinase, and threonine synthase.

[0110] 5) Strengthen the genes for threonine aldolase, acetaldehyde dehydrogenase, and aminomethyltransferase in biological cells, and replace the isocitrate lyase gene with gene cluster 2 consisting of the isocitrate lyase gene and the glycine dehydrogenase gene.

[0111] In the methods described herein, method 1) blocks glycolysis, enhances the pentose phosphate pathway, and blocks the pathway of sedoheptulose-7-phosphate, thereby improving substrate utilization efficiency. Method 2) provides microorganisms with the ability to synthesize Porphyra 334 from glucose, glycine, L-threonine, and methionine. Method 3) provides or enhances the ability of microorganisms to synthesize Porphyra 334 from glucose, glycine, and L-threonine. Method 4) provides or enhances the ability of microorganisms to synthesize Porphyra 334 from glucose and glycine. Method 5) provides or enhances the ability of microorganisms to synthesize Porphyra 334 from glucose.

[0112] The beneficial technical effects achieved by the present invention are as follows:

[0113] The recombinant bacteria of the present invention have significantly improved their ability to produce the mycosporin-like amino acid Porphyra 334, enabling large-scale production of the amino acid. Compared to traditional algae extraction methods, the microbial fermentation method of the present invention offers advantages such as a shorter production cycle, unrestricted climate, and higher yields. BRIEF DESCRIPTION OF THE DRAWINGS

[0114] Figure 1 Comparison of the ability of recombinant strains MP6-1 and MP6-0 to produce Porphyra 334.

[0115] Figure 2Comparison of the ability of recombinant strains MP9-1, MP9-0 and MP6-1 to produce Porphyra 334.

[0116] Figure 3 Comparison of the ability of recombinant strains MP11-1, MP11-0 and MP9-1 to produce Porphyra 334.

[0117] Figure 4 Comparison of the ability of recombinant strains MP15-1, MP15-0 and MP11-1 to produce Porphyra 334. DETAILED DESCRIPTION

[0118] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0119] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0120] The quantitative tests in the following examples were repeated three times unless otherwise specified, and the results were averaged.

[0121] Escherichia coli BW25113 (CGSC#: 7636), plasmid pKD46 (CGSC#: 7739), and pCP20 (CGSC#: 7629) were purchased from the Yale Escherichia coli Genetic Collection (CGSC). Escherichia coli MC02 (CGMCC No. 34378) was also obtained from CGMCC.

[0122] The primer information used in the present invention is shown in Table 1.

[0123] Table 1. Primer information used in the present invention

[0124] Primer or sequence name Nucleotide sequence (5' to 3') use talB-1 ttgcgtcgtgatatcatcagggcagaccggttacatccccctaacaagctgtttaaagagaaatactatc-ATTCCGGGGATCCGTCGACC Amplify talB targeting fragment talB-2 ctgcgaagggagtgacagacaggcttcagaagaggtagcgtgaccgacttcccggtcacgctaagaatga -TGTAGGCTGGAGCTGCTTCG Amplify talB targeting fragment talB-3 AGGTACTTGATAACTTCTGCG Verification of talB knockout kan-R TTAGAAGAACTCGTCAAGAAGGCGATAGAA Verification of gene knockout or integration talA-1 TTAGCGAAATTTCTCAGAAGTGTGAATTAACGCACTCATCTAACACTTTACTTTTCAAGGAGTATTTCCT-ATTCCGGGGATCCGTCGACC Amplification of talA targeting fragment talA-2 cgcatccatactgagtgcgcgaatcgcattggcaaggtcttttcgggacatataacactccgtggctggt-TGTAGGCTGGAGCTGCTTCG Amplification of talA targeting fragment talA-3 GAGTCTACAGACTTTGAGC Verification of talA knockout zwf up catgatcagtgtcagatttttacccaatggaaaacgatgatttttttatcagttttgccgcactttgcgc zwf upstream homology arm zwf down atggcggtaacgcaaacagcccaggcctgtgacctggtcattttcggcgcgaaaggcgaccttgcgcgtc Zwf downstream homology arm zwf-1 catgatcagtgtcagatttttac Amplify the zwf targeting fragment zwf-2 gacgcgcaaggtcgccttt Amplify the zwf targeting fragment zwf-3 ctcaaatgttccagctgagactgg Verification of zwf promoter replacement pgi-1 Tcacatttttctgtgactggcgctacaatcttccaaagtcacaattctcaaaatcagaagagtattgcta-ATTCCGGGGATCCGTCGACC Amplify the pGI targeting fragment pgi-2 ccgcgtcgcatcaggcatcggttgccggatgcggcgtgaacgccttatccggcctacatatcgacgatga-TGTAGGCTGGAGCTGCTTCG Amplify the pGI targeting fragment pgi-3 ATAAAGGGTGAGCGGGGCGGT Validation of PGI knockout tktA up ataaggaaaagcgcagcggacgggcgagtagattgcgcaacatgcgagcatgatccagagatttctgaag tktA upstream homology arm tktA down atgtcctcacgtaaagagcttgccaatgctattcgtgcgctgagcatggacgcagtacagaaagccaaat tktA downstream homology arm tktA-1 ataaggaaaagcgcagcggac Amplification of tktA targeting fragment tktA-2 ATTTGGCTTTCTGTACTG Amplification of tktA targeting fragment tktA-3 AGGTGAATCGACGCTCAGTCTC Validation of tktA promoter replacement tktB up gtctgaaggcattcgtctgttcgccgttgatcaacgcaaactggaagatcttcttgccgccaaactataa tktB upstream homology arm tktB down atgtcccgaaaagaccttgccaatgcgattcgcgcactcagtatggatgcggtacaaaaagccaactctg tktB downstream homology arm tktB-1 gtctgaaggcattcgtctgttcg Amplification of tktB targeting fragment tktB-2 cagagttggctttttgtacc Amplification of tktB targeting fragment tktB-3 GTTTCGCCAGTGGTACGT Validation of tktB promoter replacement NlmysABCD-01F <![CDATA[ AATTTCACACAGGAAACAGA gtgagcattgttcaaacaaaact]]> Amplification of NlmysABCD NlmysABCD-01R <![CDATA[ GCATGCCTGCAGGTCGACTC ctaaatcatttgtgaaagc]]> Amplification of NlmysABCD pTrc99a-01F GAGTCGACCTGCAGGCATGCAAGCTTGGCT Amplification vector pTrc99a-01R TCGTTTCCTGTGTGAAATTGTTATCCGCT Amplification vector metK up ttaacctgcagagtcgtggtaggatccgctaccacagaaaatccacacaacagtttgagctaaccaaatt metK upstream homology arm metK down atggcaaaacacctttttacgtccgagtccgtctctgaagggcatcctgacaaaattgctgaccaaattt metK downstream homology arm metK-1 ttaacctgcagagtcgtggtag Amplification of metK targeting fragment metK-2 aaatttggtcagcaattttgtca Amplification of metK targeting fragment metK-3 ATTTCCAGCCACGTTTTTAAC Validation of metK promoter replacement metJ-1 tttacggtcagtacccacatcaactgtgtggtctggtctcaatttattgacgaagaggattaagtatctc-ATTCCGGGGATCCGTCGACC Amplify metJ targeting fragment metJ-2 agcaaaaaagagcggcgcggagtggaatcgcctgatgcgctacgcttatcaggcctacgtcatattgcaa-TGTAGGCTGGAGCTGCTTCG Amplify metJ targeting fragment metJ-3 caccagagtaaacattgtg Validation of metJ knockout pflB up aaacgaccaccattaatggttgtcgaagtacgcagtaaataaaaaatccacttaagaaggtaggtgttac pflB upstream homology arm pflB down ttagatttgactgaaatcgtacagtaaaaagcgtacaataaaggctccacgaaagtggggccttttttag pflB downstream homology arm pflB-1 AAACGACCACCATTAATGGTTGTCGAAG Amplification of the pflB targeting fragment pflB-2 CTAAAAAAGGCCCCACTTTCGTGGAGC Amplification of the pflB targeting fragment pflB-3 CCGGAAAATTTTTCTCACCTGACC Verification of pflB site modification edd up cgttgcctcggtggcgatgattacccgtgatggtcgttcctggaatgagtttgagtaatatctgcgctta edd upstream homology arm edd down atgaatccacaattgttacgcgtaacaaatcgaatcattgaacgttcgcgcgagactcgctctgcttatc edd downstream homology arm edd-1 cgttgcctcggtggcgatgattac Amplify the edd targeting fragment edd-2 gataagcagagcgagtctcg Amplify the edd targeting fragment edd-3 gctgctggaaaccatgcgtgg Verification of edd promoter replacement poxB up tcccatcccttccccctccgtcagatgaactaaacttgttaccgttatcacattcaggagatggagaacc poxB upstream homology arm poxB down aaagggtggcatttcccgtcataataaggacatgccatgattgatttacgcagtgataccgttacccgac poxB downstream homology arm poxB-1 tcccatcccttccccctccgtcaga Amplify the poxB targeting fragment poxB-2 gtcgggtaacggtatcactgcgtaa Amplify the poxB targeting fragment poxB-3 tttaaccgttagtgcctcctttctc Verification of poxB site modification ltaE up gctgcgcgcaatcatcagcggacgcggtgatgaagtgatcgaactggcgaaaacaaactggctaaggtaa ltaE upstream homology arm ltaE down ggagagagacgtgccgcaacgcattttagttctcggtgccagtggctacattggtcagcatctggtgcgc ltaE downstream homology arm ltaE-1 cgtgcggcattacgggtatccg Amplify the ltaE targeting fragment ltaE-2 gatatcctgcaacagggccgg Amplify the ltaE targeting fragment ltaE-3 gtacttcacgtagcgcatcg Verification of ltaE promoter replacement eutE up ggtcgatctgtgcgtgattggcattgtcgatgaggtggtgtctggcggtcaggtaattttccacaaataa eutE upstream homology arm eutE down atgaatcaacaggatattgaacaggtggtgaaagcggtactgctgaaaatgcaaagcagtgacacgccgt eutE downstream homology arm eutE-1 ggtcgatctgtgcgtgattggcatt Amplify the eutE targeting fragment eutE-2 acggcgtgtcactgctttgcatttt Amplify the eutE targeting fragment eutE-3 aggcgcataaaagcgaaacgtcacc Verification of eutE promoter replacement aceA up ttgatttcctgaccctgccaggctaccgcctgttagcgtaaaccaccacataactatggagcatctgcac aceA upstream homology arm aceA down gcaacaacaaccgttgctgactgtaggccggataaggcgttcacgccgcatccggcaatcggtgcacgat aceA downstream homology arm aceA-1 ttgatttcctgaccctgccaggcta Amplification of aceA targeting fragment aceA-2 atcgtgcaccgattgccggatgcgg Amplification of aceA targeting fragment aceA-3 cagatcaccacttccgatgagttaa Verification of aceA site modification gcvT up agctaatgtgatgatcaattttaccttatggttaacagtctgtttcggtggtaagttcaggcaaaagaga gcvT upstream homology arm gcvT down atggcacaacagactcctttgtacgaacaacacacgctttgcggcgctcgcatggtggatttccacggct gcvT downstream homology arm gcvT-1 agctaatgtgatgatcaattttacc Amplify the gcvT targeting fragment gcvT-2 agccgtggaaatccaccatgcgagc Amplify the gcvT targeting fragment gcvT-3 gcgatttttgcattttttaaccata Validation of gcvT promoter replacement

[0125] Table 2. Strains used in the present invention

[0126] Strain name describe source Escherichia coli MC02 The starting strain of the present invention is numbered MC02 Obtained from CGMCC MP1 Knockout of the talB gene in Escherichia coli MC02 The present invention MP2 Knockout of the talA gene in Escherichia coli MP1 The present invention MP3 Enhancing the expression of zwf gene in Escherichia coli MP2 The present invention MP4 Knockout of the pgi gene in Escherichia coli MP3 The present invention MP5 Enhancing the Expression of tktA Gene in Escherichia coli MP4 The present invention MP6 Enhancing the Expression of tktB Gene in Escherichia coli MP5 The present invention MP6-1 pTrc99a-NlmysABCD plasmid was introduced into E. coli MP6 The present invention MP6-0 pTrc99a plasmid was introduced into E. coli MP6 The present invention MP7 Enhancing the Expression of Metk Gene in Escherichia coli MP6 The present invention MP8 Knockout of metJ gene in Escherichia coli MP7 The present invention MP9 Knockout of the pflB gene in Escherichia coli MP8 and introduction of the mtn and luxS genes The present invention MP9-1 pTrc99a-NlmysABCD plasmid was introduced into Escherichia coli MP9 The present invention MP9-0 pTrc99a plasmid was introduced into E. coli MP9 The present invention MP10 Enhanced edd gene expression in Escherichia coli MP9 The present invention MP11 Knockout of the poxB gene in E. coli MP10 and introduction of the thrA, thrB, and thrC genes The present invention MP11-1 The pTrc99a-NlmysABCD plasmid was introduced into Escherichia coli MP11 The present invention MP11-0 pTrc99a plasmid was introduced into E. coli MP11 The present invention MP12 Enhanced expression of glyA and metH genes in Escherichia coli MP11 The present invention MP13 Enhanced expression of eutE gene in Escherichia coli MP12 The present invention MP14 Knockout of the aceA gene in Escherichia coli MP13 and introduction of the aceA and gdh gene clusters The present invention MP15 Enhanced gcvT expression in Escherichia coli MP14 The present invention MP15-1 The pTrc99a-NlmysABCD plasmid was introduced into Escherichia coli MP15 The present invention MP15-0 pTrc99a plasmid was introduced into E. coli MP15 The present invention

[0127] Example 1. Construction of recombinant Escherichia coli MP6-1 and production of Porphyra 334

[0128] 1. This example uses Escherichia coli MC02 as a starting point to generate a basic strain, MP6-1, for the production of mycosporin-like amino acids. It can synthesize Porphyra 334 from glucose, glycine, L-threonine, and methionine. This strain primarily blocks the sedoheptulose-7-phosphate consumption pathway, enhances the expression of several key enzymes in the pentose phosphate pathway, and blocks the conversion of glucose-6-phosphate to fructose-6-phosphate. The strain was constructed as follows; the primers used are listed in Table 1.

[0129] (1) Knockout of the transaldolase B (talB) gene

[0130] First, the transaldolase gene talB of Escherichia coli MC02 was knocked out to obtain the recombinant strain MP1. The specific steps are as follows:

[0131] (1-a) Preparation of the targeting fragment talB up-kan-talB down

[0132] PCR amplification was performed using talB-1 / talB-2 as primers and the frt-kan-frt (SEQ ID No. 4) screening marker fragment as a template to obtain the targeting fragment talB up-kan-talB down.

[0133] (1-b) Preparation of host bacteria containing the pKD46 plasmid

[0134] Plasmid pKD46 (from the Yale Genetic Collection of Escherichia coli CGSC) was transformed into E. coli MC02 using the calcium chloride method. After overnight culture at 30°C on LB plates containing ampicillin, clones were selected to obtain E. coli MC02-pKD46 containing plasmid pKD46. A single clone of MC02-pKD46 was inoculated into LB medium containing 100 μg / mL and 2 g / L L-arabinose and cultured to the logarithmic phase (OD 600nm =0.6-0.8), then washed with pre-chilled 10% glycerol to prepare MC02-pKD46 competent cells. After induction with L-arabinose, MC02-pKD46 expressed the three recombinant proteins Gam, Beta, and Exo of phage lambda, thereby enhancing its homologous recombination capacity.

[0135] (1-c) Homologous recombination

[0136] The targeting fragment talB up-kan-talB down prepared in (1-a) was transformed into the competent cells of MC02-pKD46 prepared in (1-b) by electroporation. The electroporated cells were plated on LB solid medium containing 50 µg / mL kanamycin and cultured overnight at 37°C. A single colony was then picked and identified using primers talB-3 and kan-R; the positive band was approximately 1400 bp in size. The selected positive colony was designated recombinant strain MP1-kan.

[0137] (1-d) Elimination of resistance

[0138] Plasmid pcP20 was transformed into M1-kan prepared in (1-c) using the calcium chloride method. The transformed cells were plated onto LB solid medium supplemented with 100 µg / mL ampicillin and cultured overnight at 30°C. A single colony was then picked and inoculated onto LB medium supplemented with 100 µg / mL ampicillin and 2 g / L L-arabinose and cultured at 30°C. The bacterial suspension was then streaked onto LB solid medium without antibiotics and onto LB solid medium supplemented with 50 µg / mL kanamycin and cultured overnight at 42°C. After confirming the elimination of kanamycin resistance, a single colony was picked from the LB solid medium without antibiotics and inoculated onto LB solid medium supplemented with 100 µg / mL ampicillin, 50 µg / mL kanamycin, or without antibiotics, and cultured overnight at 30°C. Positive clones were identified as those that grew in the medium without antibiotics but not in the medium supplemented with ampicillin or kanamycin. PCR amplification was performed using primers talB-3 and talB-2. The positive clone was about 400 bp. The positive clone obtained by screening was named recombinant strain MP1.

[0139] The recombinant strain MP1 is a strain in which the talB gene is knocked out. The NCBI Reference Sequence number of the transaldolase B (hereinafter referred to as talB) is NP_414549.1, and the NCBI Reference Sequence number of the encoding gene is Gene ID: 944748 (2023.7.6).

[0140] (2) Knockout of the transaldolase A (hereafter referred to as talA) gene

[0141] The recombinant strain MP1 obtained in step (1) was used as the starting strain, and the transaldolase gene talA was knocked out to obtain the recombinant strain MP2. The specific steps are as follows:

[0142] (2-a) Preparation of the targeting fragment talA up-kan-talA down:

[0143] PCR amplification was performed using talA-1 / talA-2 as primers and the frt-kan-frt (SEQ ID No. 4) screening marker fragment as a template to obtain the targeting fragment talA up-kan-talA down.

[0144] (2-b) Follow the steps in (1) (steps 1-b to 1-d), except that the primers talB-1 / talB-2 / talB-3 are replaced with talA-1 / talA-2 / talA-3. The target fragment talA up-kan-talA down is obtained, and the transformed strain is replaced by MP1 instead of MC02.

[0145] In step (2-c), PCR amplification and identification were performed using talA-3 / Kan-R as primers, and the amplified target band of about 1400 bp was considered positive;

[0146] In step (2-d), PCR amplification and identification were performed using talA-3 / talA-2 as primers, and the amplification of a target band of approximately 400 bp was considered positive.

[0147] The NCBI Reference Sequence number (NCBI Reference Sequence) of the transaldolase A (hereinafter referred to as talA) is NP_416959.1, and the NCBI Reference Sequence number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 947006 (2024.7.6).

[0148] (3) Enhancing the expression of 6-phosphate glucose dehydrogenase (hereinafter referred to as zwf) gene by promoter replacement The recombinant strain MP2 obtained in step (2) was used as the starting strain. Starting from the recombinant strain MP2, the promoter of the 6-phosphate glucose dehydrogenase zwf gene (GenBank: CP032667.1 (1936315-1936449)08-OCT-2018) in the strain was replaced with the constitutive promoter P of Escherichia coli. 119 (SEQ ID No. 2), and recombinant E. coli MP3 was obtained by the following steps:

[0149] (3-a) Targeting fragment zwf up-kan-P 119 Preparation of -zwf down:

[0150] The DNA fragments synthesized (GenScript) are as follows: from 5' to 3', they contain the 70 bp homology arm fragment upstream of the zwf gene (denoted as zwf up, see Table 1), the frt-kan-frt selection marker fragment (SEQ ID No. 4), the P 119 The promoter fragment (SEQ ID No. 2) and the first 70 bp fragment of the zwf gene (denoted as sequence zwf down, see Table 1) were amplified by PCR using zwf-1 / zwf-2 as primers and the gene-synthesized DNA fragment as template to obtain the targeting fragment zwf up-kan-P 119 -zwf down.

[0151] (3-b) Follow the steps of (1) (steps 1-b to 1-d), except that in step 1-c, the primers used for identification were changed to zwf-3 / Kan-R, and a positive clone of approximately 1400 bp was identified. In step 1-d, the primers used for identification were changed to zwf-3 / zwf-2, and a positive clone of approximately 400 bp was identified.

[0152] The NCBI Reference Sequence Number of the 6-phosphate glucose dehydrogenase (zwf)

[0153] The NCBI reference sequence number of the encoding gene is AKT72612.1, and the NCBI Reference Sequence number of the encoding gene is Gene ID: 946370 (2024.7.6).

[0154] (4) Knockout of the 6-phosphoglucose isomerase (pgi) gene

[0155] First, starting from the recombinant strain MP3, its 6-phosphate glucose isomerase gene pgi was knocked out to obtain the recombinant strain MP4. The specific steps are as follows:

[0156] (4-a) Preparation of the targeting fragment pGI up-kan-pGI down:

[0157] PCR amplification was performed using pgi-1 / pgi-2 as primers and the frt-kan-frt (SEQ ID No. 4) screening marker fragment as a template to obtain the targeting fragment pgi up-kan-pgi down.

[0158] (4-b) Follow the steps of (1) (steps 1-b to 1-d), except that the primers talB-1 / talB-2 / talB-3 are replaced with pgi-1 / pgi-2 / pgi-3. The target fragment pgi up-kan-pgi down is obtained, and the transformed strain is replaced with MP3 instead of MC02.

[0159] In step (4-c), PCR amplification and identification were performed using pgi-3 / Kan-R as primers, and the amplified target band of about 1400 bp was considered positive;

[0160] In step (4-d), PCR amplification and identification were performed using pgi-3 / pgi-2 as primers, and the amplified target band of about 400 bp was considered positive.

[0161] The NCBI Reference Sequence number (NCBI Reference Sequence) of the glucose-6-phosphate isomerase (hereinafter referred to as pgi) is NP_418449.1, and the NCBI Reference Sequence number (NCBI Reference Sequence) of its encoding gene is Gene ID: 948535 (2024.7.6).

[0162] (5) Enhanced expression of the transketolase A (hereafter referred to as tktA) gene by promoter replacement

[0163] Referring to the steps in (3), based on the recombinant strain MP4, the promoter of the transketolase A (tktA) gene (GenBank: NC_000913.3 (3083616-3083767) 09-MAR-2022) was replaced with the Escherichia coli constitutive promoter P CPA1 , and obtain recombinant E. coli MP5. The specific steps are as follows:

[0164] (5-a) Targeting fragment tktA up-kan- P CPA1 Preparation of -tktA down:

[0165] The DNA fragments synthesized (GenScript) are as follows: from 5' to 3', they contain the 70 bp homology arm fragment upstream of the tktA gene (denoted as tktA up, see Table 1), the frt-kan-frt selection marker fragment (SEQ ID No. 4), the P CPA1The promoter fragment (SEQ ID No. 1) and the first 70 bp fragment of the tktA gene (denoted as sequence tktA down, see Table 1) were amplified by PCR using tktA-1 / tktA-2 as primers and the gene synthesized DNA fragment as template to obtain the targeting fragment tktA up-kan-P CPA1 -tktA down.

[0166] (5-b) The subsequent steps are as described in Example 1 (3) (steps 3-b to 3-d), except that the primers zwf-1 / zwf-2 / zwf-3 are replaced with tktA-1 / tktA-2 / tktA-3. The target fragment tktA up-kan-P is obtained. CPA1 -tktA down, and the transformed strain was replaced by MP2 to MP4.

[0167] In step (5-c), PCR amplification and identification were performed using tktA-3 / Kan-R as primers, and the amplified target band of about 1400 bp was considered positive;

[0168] In step (5-d), PCR amplification and identification were performed using tktA-3 / tktA-2 as primers, and the amplified target band of about 400 bp was considered positive.

[0169] The NCBI Reference Sequence number (NCBI Reference Sequence) of the transketolase A (hereinafter referred to as tktA) is YP_026188.1, and the NCBI Reference Sequence number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 947420 (2024.7.6).

[0170] (6) Enhanced expression of the transketolase B (hereafter referred to as tktB) gene by promoter replacement

[0171] Referring to the steps in (3), based on the recombinant strain MP5, the promoter of the transketolase A (tktB) gene (GenBank: NC_000913.3 (2579617-2579635) 09-MAR-2022) was replaced with the Escherichia coli constitutive promoter P CPA1 , and obtain recombinant E. coli MP6. The specific steps are as follows:

[0172] (6-a) Targeting fragment tktB up-kan- P CPA1 Preparation of -tktB down:

[0173] The DNA fragments synthesized (GenScript) are as follows: from 5' to 3', they contain the 70 bp homology arm fragment upstream of the tktB gene (denoted as tktB up, see Table 1), the frt-kan-frt selection marker fragment (SEQ ID No. 4), the P CPA1 The promoter fragment (SEQ ID No. 1) and the first 70 bp fragment of the tktB gene (denoted as sequence tktB down, see Table 1) were amplified by PCR using tktB-1 / tktB-2 as primers and the gene-synthesized DNA fragment as a template to obtain the targeting fragment tktB up-kan-P CPA1 -tktB down.

[0174] (6-b) The subsequent steps were similar to those in Example 1 (3) (steps 3-b to 3-d), except that the primers zwf-1 / zwf-2 / zwf-3 were replaced with tktB-1 / tktB-2 / tktB-3. The target fragment tktB up-kan-P was obtained. CPA1 -tktB down, and the transformed strain was replaced by MP2 to MP5.

[0175] In step (10-c), PCR amplification and identification were performed using tktB-3 / Kan-R as primers, and the amplified target band of about 1400 bp was considered positive;

[0176] In step (10-d), PCR amplification and identification were performed using tktB-3 / tktB-2 as primers, and the amplified target band of about 400 bp was considered positive.

[0177] The NCBI Reference Sequence number (NCBI Reference Sequence) of the transketolase B (hereinafter referred to as tktB) is NP_416960.1, and the NCBI Reference Sequence number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 945865 (2024.7.6).

[0178] (7) Construction of an expression vector for the mycosporin-like amino acid synthesis gene from Nostoc linkia NIES-25.

[0179] A codon-optimized gene cluster for the mycosporin-like amino acid Porphyra 334 from Nostoc linkia NIES-25 (nucleotide sequence shown in SEQ ID No. 6) was synthesized in Escherichia coli. Expression of this gene cluster yielded Porphyra 334 as the primary product. The target fragment, NlmysABCD, was amplified by PCR using primers NlmysABCD-01F and NlmysABCD-01R from the synthesized gene cluster. The target fragment, NlmysABCD, was recovered by agarose gel electrophoresis. The large vector pTrc was amplified by PCR using primers pTrc99a-01F and pTrc99a-01R, using plasmid pTrc99a (Beijing Zhuangmeng International Biogene Technology Co., Ltd., Cat. No. ZK1610) as a template. The pTrc and NlmysABCD fragments were Gibson ligated using the Gibson assembly method (Gibson DG, Young L, et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. methods. 2009; 6(5):343-345). The cells were then transformed into competent Escherichia coli DH5α cells (purchased from Beijing Qingke Biotechnology Co., Ltd., product catalog TSC-C01). After recovery, the cells were evenly plated onto the corresponding resistant LB plates and cultured overnight at 37°C. Clones were selected and verified for successful assembly by PCR amplification using primers RV-M and pTrcHis-R. Sequencing was then performed. Positive clones were screened and the plasmid was extracted and named pTrc99a-NlmysABCD.

[0180] (8) Construction of production strain MP6-1

[0181] The plasmid pTrc99a-NlmysABCD constructed in step (11) of Example 1 was transferred to the recombinant strain MP6 obtained in step (10) of Example 1 by the calcium chloride transformation method. After overnight culture at 37°C on an LB plate containing 100 μg / mL ampicillin, clones were selected to obtain a production strain containing the plasmid pTrc99a-NlmysABCD, which was named recombinant strain MP16-1.

[0182] (9) Construction of strain MP6-0

[0183] Plasmid pTrc99a was transferred into the recombinant bacteria M12 obtained in step (12) of Example 1 by the calcium chloride transformation method. After overnight culture at 37°C on an LB plate containing 100 µg / mL ampicillin, clones were selected to obtain a recombinant bacteria containing plasmid pTrc99a but not containing the Porphyra 334 synthetic gene. This strain was used as a control and was named recombinant bacteria MP6-0.

[0184] 2. Preparation of Porphyra 334 using glucose, glycine, L-threonine, and L-methionine as substrates

[0185] 1. Preparation of culture medium:

[0186] Composition and final concentrations of medium A: 5 g / L yeast extract, 5 g / L glycerol, 25 mM Na2HPO4, 25 mM KH2PO4, 50 mM NH4Cl, 5 mM Na2SO4, 2 mM MgSO4, 50 μM FeCl3, 20 μM CaCl2, 10 μM MnCl2, 10 μM ZnSO4, 2 μM CoCl2, 2 μM NiCl2, 2 μM Na2Mo4, 2 μM Na2SeO3 and 2 μM H3BO3.

[0187] The composition and final concentrations of medium B are: 48 mM Na2HPO4, 22 mM KH2PO4, 8.6 mM NaCl, 187 mM NH4Cl, 100 g / L glucose, 25 g / L glycine, 25 g / L L-threonine, and 10 g / L L-methionine.

[0188] 2. Preparation of Porphyra 334

[0189] The experiment was repeated three times, and the specific steps for each experimental repetition were as follows:

[0190] 2.1 Culture of bacteria and induction of related enzymes

[0191] The strain MP6-1 obtained in step 1 was cultured overnight and inoculated into 20 ml of medium A (medium A containing ampicillin at a final concentration of 50 mg / L) at a 1% inoculum size. The culture was then incubated at 30°C and 220 rpm for 3-4 h until the OD 600nm After the cell viability was 0.6-0.8, IPTG was added to a final concentration of 0.5 mM, and the cells were cultured at 30°C and 220 rpm for 16 h. The cells were collected by centrifugation at 10,000 g for 10 min to obtain MP6-1 cells.

[0192] According to the above method, MP6-0 was cultured and collected using A medium (A medium containing ampicillin at a final concentration of 50 mg / L) to obtain MP6-0 cells.

[0193] 2.2 Whole-cell catalytic production of Porphyra 334

[0194] The 30 mg (i.e. 1 x 10 11 The dry weight of MP6-1 and MP6-0 bacteria (100 cfu) was resuspended in a shake flask containing 20 mL of medium B and cultured at 37°C for 24 h.

[0195] 2.3 Product collection and testing

[0196] Centrifuge 0.5 ml of the whole-cell catalytic sample obtained in step 2.2 at 4000 g and 4°C for 20 min. Collect the extracellular product using the following steps:

[0197] Take 350 μL of the supernatant obtained after centrifugation and vacuum dry it, then add 700 μL of methanol for reconstitution, and then centrifuge at 10,000 g for 10 min. Take 600 μL of the supernatant and vacuum dry it, then add 300 μL of deionized water for reconstitution, centrifuge the reconstituted solution at 18,000 g for 2 min, and filter the supernatant with a 0.22 μm filter to obtain the filtrate, which is the sample to be tested.

[0198] The content of Porphyra 334 in the samples was determined by high-performance liquid chromatography (HPLC). HPLC analysis was performed using an Agilent Eclipse XDB-C18 column (5 μm, 4.6 × 250 mm) with a mobile phase consisting of methanol and water (methanol:water, 84:16, by volume) at a column temperature of 30°C and a flow rate of 1 mL / min. UV detection was used.

[0199] The results showed that the yield of Porphyra 334 from the recombinant strain MP6-0 was 0, while the average yield of Porphyra 334 from the engineered strain MP6-1 was 22.66 ± 1.76 g / L, as shown in Figure 1. Therefore, the engineered strain MP6-1 can synthesize Porphyra 334 from glucose, L-methionine, glycine, and L-threonine.

[0200] Example 2: Construction of recombinant Escherichia coli MP9-1 and production of Porphyra 334

[0201] 1. This example uses Escherichia coli MP6 as a starting point to generate a strain MP9-1 for the production of mycosporine-like amino acids. This strain can synthesize mycosporine-like amino acids Porphyra 334 from glucose, glycine, and L-threonine. This strain primarily enhances the L-methionine cycle. The strain was constructed as follows; the primers used are listed in Table 1.

[0202] (1) Enhancement of L-methionine adenosyltransferase (metK) gene expression by promoter replacement

[0203] Referring to step (3) in Example 1, on the basis of the recombinant strain MP6, the promoter of the L-methionine adenosyltransferase (metK) gene (GenBank: NC_000913.3 (3086686-3086705) 09-MAR-2022) was replaced with the Escherichia coli constitutive promoter P 119 , and recombinant E. coli MP7 was obtained. The difference is that the gene synthesis fragments are as follows: from 5' to 3', they are composed of metk up, frt-kan-frt screening marker fragment, P 119 Promoter fragment (SEQ ID No. 2), metk down, primer combination zwf-1 / zwf-2 / zwf-3 were replaced with metk-1 / metk-2 / metk-3 in sequence, and host strain MP2 was replaced with MP6.

[0204] The sequence of the upstream homology arm of metk is metk up, see Table 1; the sequence of the downstream homology arm of metk is metk down, see Table 1;

[0205] PCR amplification was performed using metk-3 / Kan-R as primers, and the amplified target band of about 1400 bp was considered positive;

[0206] PCR amplification and identification were performed using metk-2 / metk-3 as primers, and the amplified target band of about 400 bp was considered positive.

[0207] The NCBI Reference Sequence Number (NCBI Reference Sequence) of the L-methionine adenosyltransferase (hereinafter referred to as metK) is NP_417417.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the L-methionine adenosyltransferase is Gene ID: 945389 (2024.7.6).

[0208] (2) Knockout of the L-methionine synthesis transcription factor (hereafter referred to as metJ) gene

[0209] Referring to the step (1) in Example 1, based on MP7, the metJ gene, a transcription factor for L-methionine synthesis, was knocked out to obtain the recombinant strain MP8.

[0210] The differences are that the host strain MC02 was replaced with MP7, and the primer combination talB-1 / talB-2 / talB-3 was replaced with metJ-1 / metJ-2 / metJ-3. The resulting targeting fragment was metj up-kan-metj down; the relevant primer sequences are shown in Table 1.

[0211] PCR amplification was performed using metJ-2 / Kan-R as primers, and the amplified target band of about 1400 bp was considered positive;

[0212] PCR amplification and identification were performed using metJ-2 / metJ-3 as primers, and the amplified target band of about 400 bp was considered positive.

[0213] The NCBI Reference Sequence number (NCBI Reference Sequence) of the L-methionine biosynthesis transcription factor (hereinafter referred to as metj) is NP_418373, and the NCBI Reference Sequence number (NCBI Reference Sequence) of its encoding gene is Gene ID: 948435 (2024.7.6).

[0214] (3) The gene encoding pyruvate formate lyase (hereinafter referred to as pflB) was replaced with genes encoding S-adenosylhomocysteine ​​nucleosidase (hereinafter referred to as mtn) and S-ribosylhomocysteine ​​lyase (hereinafter referred to as luxS).

[0215] Using strain MP8 as the starting strain, the pflB gene was replaced with mtn and luxs genes, and the constitutive promoter P CPA1 To express the mtn and luxs genes and obtain the recombinant strain MP9, the specific steps are as follows:

[0216] (3-a) Targeting fragment pflB up-kan- P CPA1 -mtn-luxS-pflB down build:

[0217] The DNA fragments synthesized (GenScript) are as follows: from 5' to 3', they contain the 70 bp homology arm fragment upstream of the pflB gene (denoted as pflB up, see Table 1), the frt-kan-frt selection marker fragment (SEQ ID No. 4), the P CPA1The promoter fragment (SEQ ID No. 2), mtn gene, luxs gene, TrrnB terminator fragment (SEQ ID No. 5), and 70 bp downstream fragment of pflB gene (denoted as sequence pflB down, see Table 1) were amplified by PCR using pflB-1 / pflB-2 as primers and the gene-synthesized DNA fragment as template to obtain the targeting fragment pflB up-kan-P CPA1 -mtn-luxS-pflB down. The above targeting fragment can be used to replace the pflB gene with the mtn and luxs genes, and use the promoter P CPA1 To express mtn and luxs genes.

[0218] (3-b) The subsequent steps were similar to those in Example 1 (1) (steps 1-b to 1-d), except that the primers talB-1 / talB-2 / talB-3 were replaced with pflB-1 / pflB-2 / pflB-3.

[0219] PCR amplification was performed using pflB -3 / Kan-R as primers, and the amplified target band of about 1400 bp was considered positive;

[0220] PCR amplification and identification were performed using pflB-2 / pflB-3 as primers, and the amplified target band of about 1500 bp was considered positive.

[0221] The NCBI Reference Sequence number (NCBI Reference Sequence) of the pyruvate formate lyase (hereinafter referred to as pflB) is NP_415423.1, and the NCBI Reference Sequence number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 945514 (2024.7.6).

[0222] The NCBI Reference Sequence Number (NCBI Reference Sequence) of the S-adenosylhomocysteine ​​nucleosidase (hereinafter referred to as mtn) is NP_414701.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of its encoding gene is Gene ID: 948542 (2024.7.6).

[0223] The NCBI reference sequence number (NCBI Reference Sequence) of the S-ribosylhomocysteine ​​lyase (hereinafter referred to as luxS) is NP_417172.1, and the NCBI reference sequence number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 947168 (2024.7.6).

[0224] (4) Construction of production strain MP9-1

[0225] Starting from the recombinant strain MP9, the plasmid pTrc99a-NlmysABCD containing the Porphyra 334 synthetic gene cluster was transferred. The specific steps were as described in Example 1 (12), and it was named MP9-1.

[0226] (5) Construction of strain MP9-0

[0227] Starting from the recombinant strain MP9, the plasmid pTrc99a was transferred. The specific steps were as described in Example 1 (13), and it was named MP9-0.

[0228] 2. Preparation of Porphyra 334 using glucose, glycine, and L-threonine as substrates

[0229] 1. Preparation of culture medium:

[0230] The composition and final concentration of medium A are the same as those of medium A in Example 1.

[0231] The composition and final concentrations of C medium are: 48 mM Na2HPO4, 22 mM KH2PO4, 8.6 mM NaCl, 187 mM NH4Cl, 100 g / L glucose, 25 g / L glycine, and 25 g / L L-threonine.

[0232] 2. Preparation of Porphyra 334

[0233] The experiment was repeated three times, and the specific steps for each experimental repetition were as follows:

[0234] 2.1 Culture of bacteria and induction of related enzymes:

[0235] The strain MP9-1 obtained in step 1 was cultured overnight and inoculated into 20 ml of medium A (medium A containing ampicillin at a final concentration of 50 mg / L) at a 1% inoculum size. The culture was then continued at 30°C and 220 rpm for 3-4 h until the OD 600nmAfter the cell density was 0.6-0.8, IPTG was added to a final concentration of 0.5 mM, and the cells were cultured at 30°C and 220 rpm for 16 h. The cells were collected by centrifugation at 10,000 g for 10 min to obtain MP9-1 cells.

[0236] According to the above method, MP9-0 and MP6-1 were cultured and collected using A medium (A medium containing ampicillin at a final concentration of 50 mg / L) to obtain MP9-0 and MP6-1 bacterial cells.

[0237] 2.2 Whole-cell catalytic production of Porphyra 334

[0238] The 30 mg (i.e. 1 x 10 11 The dry weight of MP9-1, MP9-0, and MP6-1 cells (100 cfu) was resuspended in shake flasks containing 20 mL of C medium and cultured at 37°C for 24 h.

[0239] 2.3 Product collection and testing

[0240] 0.5 ml of the whole-cell catalytic sample obtained in 2.2 was centrifuged at 4000 g and 4° C. for 20 min. The extracellular products were collected and detected in the same manner as in Example 1.

[0241] The results showed that the average yield of engineered strain MP9-0 Porphyra 334 was 0, the average yield of MP6-1 Porphyra 334 was 8.04±0.45 g / L, and the average yield of engineered strain MP9-1 Porphyra 334 was 24.92±2.56 g / L, as follows Figure 2 Therefore, the engineered strain MP9-1 can efficiently synthesize Porphyra 334 from glucose, glycine, and L-threonine without the need for additional L-methionine.

[0242] Example 3: Construction of recombinant Escherichia coli MP11-1 and production of Porphyra 334

[0243] 1. This example uses Escherichia coli MP9 to generate a basic strain, MP11-1, for the production of mycosporine-like amino acids. This strain can synthesize mycosporine-like amino acids Porphyra 334 from glucose and glycine. This strain primarily enhances the L-threonine biosynthesis pathway. The strain was constructed as follows; the primers used are listed in Table 1.

[0244] (1) Enhanced expression of the phosphogluconate dehydratase (edd) gene by promoter replacement

[0245] Referring to step (3) in Example 1, on the basis of the recombinant strain MP9, the promoter of the phosphogluconate dehydratase (edd) gene (GenBank: NC_000913.3 (1934605-1934826) 09-MAR-2022) was replaced with the Escherichia coli constitutive promoter P J23105 , and recombinant E. coli MP10 was obtained. The difference is that the gene synthesis fragments are as follows: from 5' to 3', they are composed of the following: edd up, frt-kan-frt screening marker fragment, P J23105 The promoter fragment (SEQ ID No. 3), edddown, and primer combinations zwf-1 / zwf-2 / zwf-3 were replaced with edd-1 / edd-2 / edd-3 in sequence, and the host strain MP2 was replaced with MP9.

[0246] The sequence of the upstream homology arm of edd is edd up, see Table 1; the sequence of the downstream homology arm of edd is edd down, see Table 1;

[0247] PCR amplification was performed using edd-3 / Kan-R as primers, and the amplified target band of about 1400 bp was considered positive;

[0248] PCR amplification and identification were performed using edd-2 / edd-3 as primers, and the amplified target band of about 400 bp was considered positive.

[0249] The NCBI Reference Sequence Number (NCBI Reference Sequence) of the phosphogluconate dehydratase (hereinafter referred to as edd) is NP_416365.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 946362 (2024.7.6).

[0250] (2) The gene encoding pyruvate oxidase (hereinafter referred to as poxB) was replaced with genes encoding homoserine dehydrogenase (hereinafter referred to as thrA), homoserine kinase (thrB), and L-threonine synthase (thrC).

[0251] Using strain MP10 as the starting strain, the poxB gene was replaced with thrA, thrB, and thrC genes, and the constitutive promoter P was used to express the gene. CPA1 To express thrA, thrB, and thrC genes, the recombinant strain MP11 was obtained. The specific steps are as follows:

[0252] (2-a) Targeting fragment poxB up-kan- P CPA1- Preparation of thrABC-poxB down:

[0253] The DNA fragments synthesized (GenScript) are as follows: from 5' to 3', they contain the 70 bp homology arm fragment upstream of the poxB gene (denoted as poxB up, see Table 1), the frt-kan-frt selection marker fragment (SEQ ID No. 4), the P CPA1 The promoter fragment (SEQ ID No. 1), thrA gene, thrB gene, thrC gene, TrrrnB gene (SEQ ID No. 5), and the 70 bp downstream fragment of the poxB gene (denoted as sequence poxB down, see Table 1) were amplified by PCR using poxB -1 / poxB -2 as primers and the gene-synthesized DNA fragment as template to obtain the targeting fragment poxB up-kan-P CPA1- thrABC-poxB down.

[0254] (2-b) The subsequent steps are as described in Example 1 (1) (steps 1-b to 1-d), except that the primers talB-1 / talB-2 / talB-3 are replaced with poxB-1 / poxB-2 / poxB-3. The targeting fragment poxB up-kan-P is obtained. CPA1- thrABC-poxB down, and the transformed strain was replaced by MC02 and MP10.

[0255] PCR amplification was performed using poxB-3 / Kan-R as primers, and the amplified target band of about 1400 bp was considered positive;

[0256] PCR amplification was performed using poxB-2 / poxB-3 as primers, and the amplified target band of about 5000 bp was considered positive.

[0257] The NCBI Reference Sequence Number (NCBI Reference Sequence) of the homoserine dehydrogenase (hereafter referred to as thrA) is NP_414543.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the homoserine dehydrogenase is Gene ID: 945803 (2024.7.6).

[0258] The NCBI Reference Sequence number (NCBI Reference Sequence) of the homoserine kinase (hereinafter referred to as thrB) is NP_414544.1, and the NCBI Reference Sequence number (NCBI Reference Sequence) of its encoding gene is Gene ID: 947498 (2024.7.6).

[0259] The NCBI Reference Sequence number (NCBI Reference Sequence) of the threonine synthetase (hereinafter referred to as thrC) is NP_414545.1, and the NCBI Reference Sequence number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 945198 (2024.7.6).

[0260] (3) Construction of production strain MP11-1

[0261] Starting from the recombinant strain MP11, the plasmid pTrc99a-NlmysABCD containing the Porphyra 334 synthetic gene cluster was transferred. The specific steps were as described in Example 1 (12), and it was named MP11-1.

[0262] (4) Construction of strain MP11-0

[0263] Starting from the recombinant strain MP11, the plasmid pTrc99a was transferred. The specific steps were as described in Example 1 (13), and it was named MP11-0.

[0264] 2. Preparation of Porphyra 334 using glucose and glycine as substrates

[0265] 1. Preparation of culture medium:

[0266] The composition and final concentration of medium A are the same as those of medium A in Example 1.

[0267] The composition and final concentrations of D medium are: 48 mM Na2HPO4, 22 mM KH2PO4, 8.6 mM NaCl, 187 mM NH4Cl, 100 g / L glucose, and 25 g / L glycine.

[0268] 2. Preparation of Porphyra 334

[0269] The experiment was repeated three times, and the specific steps for each experimental repetition were as follows:

[0270] 2.1 Culture of bacteria and induction of related enzymes:

[0271] The strain MP11-1 obtained in step 1 was cultured overnight and inoculated into 20 ml of medium A (medium A containing ampicillin at a final concentration of 50 mg / L) at a 1% inoculum size. The culture was then incubated at 30°C and 220 rpm for 3-4 h until the OD 600nmAfter the cell density was 0.6-0.8, IPTG was added to a final concentration of 0.5 mM, and the cells were cultured at 30°C and 220 rpm for 16 h. The cells were collected by centrifugation at 10,000 g for 10 min to obtain MP11-1 cells.

[0272] According to the above method, MP11-0 and MP9-1 were cultured and collected using A medium (A medium containing ampicillin at a final concentration of 50 mg / L) to obtain MP11-0 and MP9-1 bacterial cells.

[0273] 2.2 Whole-cell catalytic production of Porphyra 334

[0274] The 30 mg (i.e. 1 x 10 11 The dry weight of MP11-1, MP11-0, and MP9-1 bacteria (100 cfu) was resuspended in a shake flask containing 20 mL of C medium and cultured at 37°C for 24 h.

[0275] 2.3 Product collection and testing

[0276] 0.5 ml of the whole-cell catalytic sample obtained in 2.2 was centrifuged at 4000 g and 4° C. for 20 min. The extracellular products were collected and detected in the same manner as in Example 1.

[0277] The results showed that the average yield of the engineered strain MP11-0 Porphyra 334 was 0, and the average yield of MP11-0 Porphyra334 was 0.85±0.11 g / L, which was much lower than the average yield of the engineered strain MP11-1 Porphyra 334, which was 29.23±3.22 g / L, as follows Figure 3 Therefore, the engineered strain MP11-1 can efficiently synthesize Porphyra 334 from glucose and glycine without the need for additional L-methionine and L-threonine.

[0278] Example 4. Construction of recombinant Escherichia coli MP15-1 and production of Porphyra 334

[0279] 1. This example uses Escherichia coli MP11 as a starting point to generate a basic strain, MP15-1, for the production of mycosporine-like amino acids. This strain can synthesize mycosporine-like amino acids Porphyra 334 from glucose. This strain primarily enhances the glycine biosynthesis pathway. The strain was constructed as follows; the primers used are listed in Table 1.

[0280] (1) Enhanced expression of the L-threonine aldolase (ltaE) gene by promoter replacement

[0281] Referring to step (3) in Example 1, on the basis of the recombinant strain MP11, the promoter of the L-threonine aldolase (ltaE) gene (GenBank: NC_000913.3 (909295-909330) 09-MAR-2022) was replaced with the Escherichia coli constitutive promoter P CPA1 , and recombinant E. coli MP12 was obtained. The difference is that the gene synthesis fragments are as follows: from 5' to 3', they are composed of: ltaE up, frt-kan-frt screening marker fragment, P CPA1 The promoter fragment (SEQ ID No. 1), ltaE down, the primer combination zwf-1 / zwf-2 / zwf-3 were replaced with ltaE -1 / ltaE -2 / ltaE -3 in sequence, and the host strain MP2 was replaced with MP11.

[0282] The sequence of the upstream homology arm of ltaE is ltaE up, see Table 1; the sequence of the downstream homology arm of ltaE is ltaE down, see Table 1;

[0283] PCR amplification was performed using ltaE -3 / Kan-R as primers, and the amplified target band of about 1400 bp was considered positive;

[0284] PCR amplification and identification were performed using ltaE-2 / ltaE-3 as primers, and the amplified target band of about 400 bp was considered positive.

[0285] The NCBI Reference Sequence number (NCBI Reference Sequence) of the L-threonine aldolase (hereinafter referred to as ltaE) is NP_415391.1, and the NCBI Reference Sequence number (NCBI Reference Sequence) of the gene encoding the L-threonine aldolase is Gene ID: 944955 (2024.7.6).

[0286] (2) Enhanced expression of the acetaldehyde dehydrogenase (eutE) gene by promoter replacement

[0287] Referring to step (3) in Example 1, on the basis of the recombinant strain MP12, the promoter of the acetaldehyde dehydrogenase (eutE) gene (GenBank: NC_000913.3 (2570337-2570347) 09-MAR-2022) was replaced with the Escherichia coli constitutive promoter P CPA1 , and recombinant E. coli MP13 was obtained. The difference is that the gene synthesis fragments are as follows: from 5' to 3', they are composed of: ltaE up, frt-kan-frt screening marker fragment, P CPA1The promoter fragment (SEQ ID No. 1), ltaE down, the primer combination zwf-1 / zwf-2 / zwf-3 were replaced with eutE -1 / eutE -2 / eutE -3 in sequence, and the host strain MP2 was replaced with MP12.

[0288] The sequence of the upstream homology arm of eutE is eutE up, see Table 1; the sequence of the downstream homology arm of eutE is eutE down, see Table 1;

[0289] PCR amplification was performed using eutE -3 / Kan-R as primers, and the amplified target band of about 1400 bp was considered positive;

[0290] PCR amplification and identification were performed using eutE -2 / eutE -3 as primers, and the amplified target band of about 400 bp was considered positive.

[0291] The NCBI Reference Sequence number (NCBI Reference Sequence) of the acetaldehyde dehydrogenase (hereinafter referred to as eutE) is NP_416950.1, and the NCBI Reference Sequence number (NCBI Reference Sequence) of the gene encoding the acetaldehyde dehydrogenase is Gene ID: 946943 (2024.7.6).

[0292] (3) Replace the isocitrate lyase gene with gene cluster 2 (containing the aceA gene and the glycine dehydrogenase gene (hereinafter referred to as gdh))

[0293] Referring to the step (2) in Example 3, on the basis of strain MP13, the aceA gene was replaced with gene cluster 2 (containing aceA and gdh genes), and the constitutive promoter P was used. CPA1 To express aceA and gdh, the recombinant strain MP14 was obtained. The difference is that the gene synthesis fragments are as follows: from 5' to 3', they are composed of the following: aceA up, frt-kan-frt selection marker fragment, P CPA1 The promoter fragment (SEQ ID No. 1), aceA, RBS (SEQ ID No. 8), gdh, and TrrnB (SEQ ID No. 5) were aceAdown, and the primer combination poxB-1 / poxB-2 / poxB-3 was replaced with aceA -1 / aceA -2 / aceA -3 in sequence, and the host strain MP10 was replaced with MP13.

[0294] The sequence of the upstream homology arm of aceA is aceA up, see Table 1; the sequence of the downstream homology arm of aceA is aceA down, see Table 1;

[0295] PCR amplification was performed using aceA -3 / Kan-R as primers, and the amplified target band of about 1400 bp was considered positive;

[0296] PCR amplification and identification were performed using aceA-2 / aceA-3 as primers, and the amplified target band of about 4400 bp was considered positive.

[0297] The NCBI Reference Sequence number (NCBI Reference Sequence) of the isocitrate lyase (hereinafter referred to as aceA) is NP_418439.1, and the NCBI Reference Sequence number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 948517 (2024.7.6).

[0298] The NCBI Reference Sequence number (NCBI Reference Sequence) of the glycine dehydrogenase (hereinafter referred to as gdh) is NP_216348.1, and the NCBI Reference Sequence number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 885716 (2024.7.6).

[0299] (4) Enhanced expression of the aminomethyltransferase (gcvT) gene by promoter replacement

[0300] Referring to step (3) in Example 1, on the basis of the recombinant strain MP14, the promoter of the aminomethyltransferase (gcvT) gene (GenBank: NC_000913.3 (3049473-3049572) 09-MAR-2022) was replaced with the Escherichia coli constitutive promoter P J23110 , and recombinant E. coli MP15 was obtained. The difference is that the gene synthesis fragments are as follows: from 5' to 3', they are composed of the following: gcvT up, frt-kan-frt screening marker fragment, P J23110 The promoter fragment (SEQ ID No. 7), gcvTdown, the primer combination zwf-1 / zwf-2 / zwf-3 were replaced with gcvT -1 / gcvT -2 / gcvT -3 in sequence, and the host strain MP2 was replaced with MP14.

[0301] The sequence of the gcvT upstream homology arm is gcvT up, see Table 1; the sequence of the gcvT downstream homology arm is gcvT down, see Table 1;

[0302] PCR amplification was performed using gcvT -3 / Kan-R as primers, and the amplified target band of about 1400 bp was considered positive;

[0303] PCR amplification and identification were performed using gcvT -2 / gcvT -3 as primers, and the amplified target band of about 400 bp was considered positive.

[0304] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the aminomethyltransferase (hereinafter referred to as gcvT) is NP_417381.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 947390 (2024.7.6).

[0305] (2) Construction of production strain MP15-1

[0306] Starting from the recombinant strain MP15, the plasmid pTrc99a-NlmysABCD containing the Porphyra 334 synthetic gene cluster was transferred. The specific steps were as described in Example 1 (12), and it was named MP15-1.

[0307] (3) Construction of strain MP15-0

[0308] Starting from the recombinant strain MP15, the plasmid pTrc99a was transferred. The specific steps were as described in Example 1 (13), and it was named MP15-0.

[0309] 2. Preparation of Porphyra 334 using glucose as substrate

[0310] 1. Preparation of culture medium

[0311] The composition and final concentration of medium A are the same as those of medium A in Example 1.

[0312] The composition and final concentrations of E medium are: 48 mM Na2HPO4, 22 mM KH2PO4, 8.6 mM NaCl, 187 mM NH4Cl, and 100 g / L glucose.

[0313] 2. Preparation of Porphyra 334

[0314] The experiment was repeated three times, and the specific steps for each experimental repetition were as follows:

[0315] 2.1 Culture of bacteria and induction of related enzymes:

[0316] The strain MP15-1 obtained in step 1 was cultured overnight and inoculated into 20 ml of medium A (medium A containing ampicillin at a final concentration of 50 mg / L) at a 1% inoculum size. The culture was then incubated at 30°C and 220 rpm for 3-4 h until the OD 600nmAfter the cell viability was 0.6-0.8, IPTG was added to a final concentration of 0.5 mM, and the cells were cultured at 30°C and 220 rpm for 16 h. The cells were collected by centrifugation at 10,000 g for 10 min to obtain MP15-1 cells.

[0317] According to the above method, MP15-0 and MP11-1 were cultured and collected using A medium (A medium containing ampicillin at a final concentration of 50 mg / L) to obtain MP15-0 and MP11-1 bacterial cells.

[0318] 2.2 Whole-cell catalytic production of Porphyra 334

[0319] The 30 mg (i.e. 1 x 10 11 The dry weight of MP15-1, MP15-0, and MP11-1 bacteria (100 cfu) was resuspended in a shake flask containing 20 mL of C medium and cultured at 37°C for 24 h.

[0320] 2.3 Product collection and testing

[0321] 0.5 ml of the whole-cell catalytic sample obtained in 2.2 was centrifuged at 4000 g and 4° C. for 20 min. The extracellular products were collected and detected in the same manner as in Example 1.

[0322] The results showed that the average yield of the engineered strain MP15-0 Porphyra 334 was 0, and the average yield of MP11-1 Porphyra334 was 0.98±0.11 g / L, which were much lower than the average yield of the engineered strain MP15-1 Porphyra 334, which was 32.85±3.88 g / L. Figure 4 Therefore, the engineered strain MP15-1 can efficiently synthesize Porphyra 334 from glucose without the need to add L-methionine, L-threonine, and glycine.

Claims

1. A method for constructing a recombinant bacterium, characterized in that: The method comprises transforming the recipient bacteria as follows: M1), knocking out the transaldolase B (talB) gene in the recipient bacteria; M2), knocking out the transaldolase A (talA) gene in the recipient bacteria; M3) Knock out the wild-type promoter that drives the expression of the 6-phosphate glucose dehydrogenase (zwf) gene in the recipient bacteria and replace it with the promoter P 119 ; M4), knocking out the glucose-6-phosphate isomerase (pgi) gene in the recipient bacteria; M5) Knock out the wild-type promoter that drives the expression of the transketolase A (tktA) gene in the recipient bacteria and replace it with promoter P CPA1 ; M6), knock out the wild-type promoter that drives the expression of the transketolase B (tktB) gene in the recipient bacteria and replace it with promoter P CPA1 ; M7) Introduce the mycosporine-like amino acid Porphyra 334 synthesis gene cluster (NlmysABCD) genes into the recipient bacteria.

2. The method according to claim 1, characterized in that The method further comprises transforming the recombinant bacteria as follows: M8), knocking out the L-methionine transcription factor (metJ) gene in the recipient bacteria; M9), knock out the wild-type promoter that drives the expression of the L-methionine adenosyltransferase (metK) gene in the recipient bacteria and replace it with promoter P 119 ; M10), knocking out the pyruvate formate lyase (pflB) gene in the recipient strain and replacing it with S-adenosylhomocysteine ​​nucleosidase (mtn) and S-ribosylhomocysteine ​​lyase (luxS) genes; Wherein the S-adenosylhomocysteine ​​nucleosidase (mtn) and S-ribosylhomocysteine ​​lyase (luxS) described in M10) are produced by P CPA1 The promoter initiates expression.

3. The method according to claim 1 or 2, characterized in that: The method further comprises transforming the recombinant bacteria as follows: M11), the wild-type promoter that drives the expression of the phosphogluconate dehydratase (edd) gene in the recipient bacteria was knocked out and replaced with the promoter P J23105 ; M12), knocking out the pyruvate oxidase (poxB) gene in the recipient bacteria and replacing it with homoserine dehydrogenase (thrA), homoserine kinase (thrB), and threonine synthase (thrC) genes; M12) described homoserine dehydrogenase (thrA), homoserine kinase (thrB) and threonine synthase (thrC) are produced by P CPA1 The promoter initiates expression.

4. The method according to any one of claims 1 to 3, characterized in that: The method further comprises transforming the recombinant bacteria as follows: M13), knock out the wild-type promoter that drives the expression of the threonine aldolase (ltaE) gene in the recipient bacteria and replace it with promoter P CPA1 ; M14), knock out the wild-type promoter that drives the expression of the acetaldehyde dehydrogenase (eutE) gene in the recipient bacteria and replace it with promoter P CPA1 ; M15), knocking out the isocitrate lyase (aceA) gene in the recipient bacteria and replacing it with a gene cluster consisting of the isocitrate lyase (aceA) gene and the glycine dehydrogenase (gdh) gene; M15) described in gene cluster 2 by P CPA1 The promoter initiates expression; M16), knock out the wild-type promoter that drives the expression of the aminomethyltransferase (gcvT) gene in the recipient bacteria and replace it with the promoter P J23110 .

5. The method according to any one of claims 1 to 4, characterized in that: 1) The NCBI reference sequence number of the glucose-6-phosphate dehydrogenase (zwf) is AKT72612.1, and the NCBI reference sequence number of the gene encoding it is Gene ID: 946370 (2024.7.6); 2) The NCBI reference sequence number of the transaldolase A (hereinafter referred to as talA) is NP_416959.1, and the NCBI reference sequence number of the gene encoding it is Gene ID: 947006 (2024.7.6); 3) The NCBI reference sequence number of the transaldolase B (hereinafter referred to as talB) is NP_414549.1, and the NCBI reference sequence number of the gene encoding it is Gene ID: 944748 (2024.7.6); 4) The NCBI reference sequence number of the transketolase A (hereinafter referred to as tktA) is YP_026188.1, and the NCBI reference sequence number of the gene encoding it is Gene ID: 947420 (2024.7.6); 5) The NCBI reference sequence number of the transketolase B (hereinafter referred to as tktB) is NP_416960.1, and the NCBI reference sequence number of the gene encoding it is Gene ID: 945865 (2024.7.6); 6) The NCBI reference sequence number of the glucose-6-phosphate isomerase (hereinafter referred to as pgi) is NP_418449.1, and the NCBI reference sequence number of the gene encoding it is Gene ID: 948535 (2024.7.6); 7) The NCBI reference sequence number of the methionine adenosyltransferase (hereafter referred to as metK) is NP_417417.1, and the NCBI reference sequence number of the gene encoding it is Gene ID: 945389 (2024.7.6); 8) The NCBI reference sequence number of the Porphyra 334 synthetic gene cluster (hereinafter referred to as NlmysABCD) is AP018223.1 (November 15, 2022); 9) The NCBI reference sequence number of the methionine biosynthesis transcription factor (hereafter referred to as metJ) is NP_418373, and the NCBI reference sequence number of its encoding gene is Gene ID: 948435 (2024.7.6); 10) The NCBI reference sequence number of the pyruvate formate lyase (hereinafter referred to as pflB) is NP_415423.1, and the NCBI reference sequence number of the gene encoding it is Gene ID: 945514 (2024.7.6); 11) The NCBI reference sequence number of the S-adenosylhomocysteine ​​nucleosidase (hereinafter referred to as mtn) is NP_414701.1, and the NCBI reference sequence number of its encoding gene is Gene ID: 948542 (2024.7.6); 12) The NCBI reference sequence number of the S-ribosylhomocysteine ​​lyase (hereinafter referred to as luxS) is NP_417172.1, and the NCBI reference sequence number of the gene encoding it is Gene ID: 947168 (2024.7.6); 13) The NCBI reference sequence number of the phosphogluconate dehydratase (hereinafter referred to as edd) is NP_416365.1, and the NCBI reference sequence number of the gene encoding it is Gene ID: 946362 (2024.7.6); 14) The NCBI reference sequence number of the pyruvate oxidase (hereinafter referred to as poxB) is CAD6018048.1, and the NCBI reference sequence number of the gene encoding it is Gene ID: 946132 (2024.7.6); 15) The NCBI reference sequence number of the homoserine dehydrogenase (hereafter referred to as thrA) is NP_414543.1, and the NCBI reference sequence number of the gene encoding it is Gene ID: 945803 (2024.7.6); 16) The NCBI reference sequence number of the homoserine kinase (hereafter referred to as thrB) is NP_414544.1, and the NCBI reference sequence number of its encoding gene is Gene ID: 947498 (2024.7.6); 17) The NCBI reference sequence number of the threonine synthase (hereafter referred to as thrC) is NP_414545.1, and the NCBI reference sequence number of the gene encoding it is Gene ID: 945198 (2024.7.6); 18) The NCBI reference sequence number of the L-threonine aldolase (hereinafter referred to as ltaE) is NP_415391.1, and the NCBI reference sequence number of the gene encoding it is Gene ID: 944955 (2024.7.6); 19) The NCBI reference sequence number of the acetaldehyde dehydrogenase (hereinafter referred to as eutE) is NP_416950.1, and the NCBI reference sequence number of the gene encoding it is Gene ID: 946943 (2024.7.6); 20) The NCBI reference sequence number of the isocitrate lyase (hereinafter referred to as aceA) is NP_418439.1, and the NCBI reference sequence number of the gene encoding it is Gene ID: 948517 (2024.7.6); 21) The NCBI reference sequence number of the glycine dehydrogenase (hereafter referred to as gdh) is NP_216348.1, and the NCBI reference sequence number of the gene encoding it is Gene ID: 885716 (2024.7.6); 22) The NCBI reference sequence number of the aminomethyltransferase (hereinafter referred to as gcvT) is NP_417381.1, and the NCBI reference sequence number of the gene encoding it is Gene ID: 947390 (2024.7.6); Among them, the P CPA1 A promoter is any of the following DNA molecules: 1) The nucleotide sequence of one chain is a DNA molecule having SEQ ID No: 1 in the sequence listing, 2) a DNA molecule that is more than 80% identical to the DNA molecule in 1) and has promoter function; The P 119 A promoter is any of the following DNA molecules: 3) The nucleotide sequence of one chain is a DNA molecule having SEQ ID No: 2 in the sequence listing, 4) a DNA molecule that is more than 80% identical to the DNA molecule in 3) and has promoter function; The P J23105 A promoter is any of the following DNA molecules: 5) A DNA molecule whose nucleotide sequence of one chain is SEQ ID No: 3 in the sequence listing, 6) A DNA molecule that is more than 80% identical to the DNA molecule in 5) and has promoter function; The P J23110 A promoter is any of the following DNA molecules: 7) A DNA molecule having a nucleotide sequence of one chain as SEQ ID No: 7 in the sequence listing, 8) A DNA molecule that has more than 80% identity with the DNA molecule of 7) and has promoter function.

6. The recombinant bacteria constructed according to any one of claims 1 to 5.

7. Use of the method according to any one of claims 1 to 5 in W1) or W2): W1) Application in the production of mycosporin-like amino acid Porphyra 334; W2) Application in the preparation of products producing mycosporin-like amino acid Porphyra 334.

8. Use of the recombinant Escherichia coli according to any one of claim 6 in W1) or W2): W1) Application in the production of mycosporin-like amino acid Porphyra 334; W2) Application in the preparation of products producing mycosporin-like amino acid Porphyra 334.

9. A method for preparing a mycosporin-like amino acid, comprising inoculating the recombinant bacterium according to claim 6 into a culture medium containing glucose, L-methionine, glycine, L-threonine and / or glucose, glycine and / or glucose as substrates, and catalyzing the production of the mycosporin-like amino acid Porphyra 334 by whole-cell catalysis.

Images