Barley HvPHR1 gene and application of barley HvPHR1 gene in aspect of increasing phosphorus content of barley

Abstract

According to the barley HvPHR1 gene and the application thereof in the aspect of increasing the phosphorus content of barley, rice PHR2 homologous protein serves as bait, homologous comparison means is utilized, it is found that two PHR proteins HvPHR1 and HvPHR2 exist in barley, and it is found that in a normal phosphorus concentration (200m NH4H2PO4) and a low phosphorus concentration (10m NH4H2PO4) hydroponic HvPHR1 overexpression strain and a wild type control (GP), the overexpression HvPHR1 gene can remarkably increase the inorganic phosphorus content of barley leaves. In conclusion, the function of the HvPHR1 gene in barley low phosphorus stress is defined, and a theoretical basis is provided for cultivation of new phosphorus-efficient barley varieties.

Description

Technical Field

[0001] The present invention relates to barley HvPHR1 The field of genetic research, particularly in barley HvPHR1 Genes and their application in improving phosphorus content in barley. Background Art

[0002] Barley has excellent characteristics such as resistance to barrenness, salt and alkali, and strong adaptability. It is an important raw material for the beer and feed industries. Phosphorus is a macronutrient necessary for the growth and development of barley. Although the total phosphorus content in the soil is rich, it mainly exists in the form of chelated or organic forms that cannot be directly absorbed and utilized. The inorganic phosphorus (H2PO4 - and HPO4 2- ) accounts for only 1% of soil phosphorus (Shen, Yuan et al. 2011). Excessive phosphorus fertilizer is often applied to meet barley growth needs, but barley's phosphorus utilization rate is less than 30% (Jez, Lee et al. 2016). Excessive phosphorus fertilizer application not only wastes resources but also causes environmental problems. Barley has evolved a complex and sophisticated regulatory network for low-phosphorus stress (Xia Xue 2023). Discovering and utilizing genes that tolerate low-phosphorus stress and cultivating and promoting barley varieties with efficient phosphorus utilization are among the most effective approaches to addressing the hazards of low-phosphorus stress.

[0003] Plants have established a phosphorus stress regulatory pathway with the MYB family transcription factor PHR1 (Phosphate Starvation Response 1) as the core. PHR1 activates a large number of low-phosphorus stress responses by binding to the P1BS (PHR1 binding sites, GNATATNC) cis-acting element. PSI (Phosphate Starvation Induced) genes comprehensively regulate the plant's response to low-phosphorus stress (Wu, Shou et al. 2013, Guo, Ruan et al. 2015). IPS1The gene promoter contains a P1BS cis-acting element, and the transcription level is regulated by PHR. The gene encodes a long non-coding LncRNA (Martin, del Pozo et al. 2000). Although the phosphorus deficiency stress regulatory pathway is relatively conserved in plants, the barley reference genome is approximately 5G and repetitive sequences account for more than 85% of the genome, making it more difficult to assemble than in general plants. The chromosome-level reference genome was not released until 2017 (Mascher, Gundlach et al. 2017), 17 and 15 years later than the model plants Arabidopsis and rice, respectively. This has seriously hindered the analysis and utilization of functional genes involved in phosphorus deficiency stress in barley. Currently, the complete regulatory pathway of phosphorus deficiency stress in barley has not been established. Only downstream response genes of the regulatory pathway have been reported, such as phosphorus transporters (Huang, Shirley et al. 2011), microRNA399 / 827 (Hackenberg, Shi et al. 2013), and the ubiquitin-conjugating enzyme PHO2 (Sega, Kruszka et al. 2020). The role of PHR, the core transcription factor of the barley phosphorus deficiency stress regulatory pathway, in phosphorus deficiency regulation has not yet been reported.

[0004] The present invention uses rice PHR2 homologous protein as bait and uses homology comparison to find that there are two PHR proteins in barley (named HvPHR1 and HvPHR2). HvPHR1 The expression in different tissues was significantly higher than HvPHR2 ,hint HvPHR1 The present invention uses molecular biological methods to clone the complete Golden Promise (GP) barley leaf RNA using PCR technology. HvPHR1 Gene coding sequence, using Gateway molecular biology technology, HvPHR1 The complete coding region of the gene was constructed into the binary expression vector pBract214 and the binary expression vector pH7WGF2 containing the GFP gene. The plasmid (HvPHR1-pBract214) and pSoup plasmid with the correct Sanger sequencing results were transformed into Agrobacterium AGL1, and the plasmid (HvPHR1-pH7WGF2) with the correct Sanger sequencing results were transformed into Agrobacterium AGL1. The HvPHR1 protein fused to GFP was expressed in tobacco leaves using an Agrobacterium-mediated transient expression system. Confocal microscopy showed that the HvPHR1 protein was localized in the cell nucleus. HvPHR1The overexpression vector (HvPHR1-pBract214) and the IPS1 promoter-driven luciferase reporter vector (POsIPS1::Luc) were used. The luciferase assay showed that HvPHR1 had transcription factor activity. The Agrobacterium-mediated barley (GP) immature embryo genetic transformation system was used to obtain HvPHR1 Overexpression lines; cultured in water for three weeks at normal phosphorus concentrations (200µM NH4H2PO4) and low phosphorus concentrations (10µM NH4H2PO4) HvPHR1 Overexpression lines and wild type control (GP) showed that overexpression HvPHR1 Gene can significantly increase the inorganic phosphorus content in barley leaves, overexpression HvPHR1 Genes can significantly improve HvIPS1 The transcriptional level of ubiquitin E2 enzyme was significantly reduced HvPHO2 In summary, the present invention clarifies HvPHR1 The function of the gene in barley low-phosphorus stress provides a theoretical basis for the breeding of new phosphorus-efficient barley varieties. Summary of the Invention

[0005] In order to solve the problems existing in the above-mentioned prior art, the present invention aims to provide barley HvPHR1 Genes and their application in increasing phosphorus content in barley To achieve the above object, the technical solution of the present invention is: The barley HvPHR1 gene is characterized by: The barley HvPHR1 gene sequence is shown in SEQ ID NO.1.

[0006] HvPHR1 gene overexpression transgenic intermediate vector HvPHR1-T, The primer sequences for HvPHR1 transcript amplification are: Transcript-HvPHR1-F: SEQ ID NO.2; Transcript-HvPHR1-R: SEQ ID NO.3.

[0007] Using the preserved HvPHR1-T plasmid as a template, primers for the overexpression vector with a linker were designed to amplify the ORF fragment of the HvPHR1 gene for BP reaction to obtain HvPHR1-pDONR (Zeo). The primer sequences are: BP-HvPHR1-F: SEQ ID NO.4 BP-HvPHR1-R:SEQ ID NO.5 The Gateway method was used to construct the HvPHR1 gene overexpression vector HvPHR1-pBract214 and the subcellular localization vector HvPHR1-pH7WGF2.

[0008] Application of barley HvPHR1 gene in improving phosphorus content in barley.

[0009] HvPHR1 regulates phosphorus homeostasis in barley and can increase the inorganic phosphorus content in barley leaves under low-phosphorus stress conditions.

[0010] Compared with the prior art, the present invention has the following beneficial effects: The present invention is to treat barley HvPHR1 Gene cloning, expression analysis, subcellular localization, transcription factor activity detection, and transgenic function verification were carried out, proving that HvPHR1 is a transcription factor that regulates the ubiquitin E2 conjugating enzyme in the phosphorus signaling pathway at the transcriptional level. HvPHO2 and long noncoding LncRNA HvIPS1 Overexpression of HvPHR1 Under low-phosphorus stress conditions (phosphorus content is 5% of normal conditions), the gene can increase the inorganic phosphorus content of the third to fifth leaves by 4-12 times, reaching 24%, 40%, and 60% of the phosphorus content in leaves under normal phosphorus conditions, respectively. This significantly increases the inorganic phosphorus content in barley leaves. This invention provides a theoretical basis and candidate genes for efficient phosphorus breeding and production in barley. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 barley PHR Gene homology and expression analysis. A. Phylogenetic tree analysis of PHR homologous proteins in barley, rice, and Arabidopsis. Green, yellow, and red colors indicate PHR homologous proteins in barley, rice, and Arabidopsis, respectively. B. Barley HvPHR1 and HvPHR2 The expression in different tissues. The left and right Y axes represent HvPHR1 and HvPHR2 relative to barley housekeeping genes HvACTIN E, embryo of 4-day-old seed; I, inflorescence tissue; L, leaf tissue of 14-day-old barley; R, root tissue of 14-day-old barley; S, grain-filling seed.

[0012] Figure 2 Overexpression HvPHR1 The transgenic lines showed significantly increased leaf phosphorus content. A. Hydroponics of normal phosphorus concentration (200µm NH4H2PO4) and low phosphorus concentration (10µm NH4H2PO4) for three weeks HvPHR1 Phenotypes of overexpression lines and wild type (GP). B. Hydroponics at normal and low phosphorus concentrations for three weeks HvPHR1 Phenotypes of the third to fifth leaves of the overexpression lines and wild type under normal phosphorus concentration hydroponics HvPHR1Overexpression of C. senescent leaves showed obvious phosphorus toxicity phenotype. C. Hydroponics at normal and low phosphorus concentrations for three weeks HvPHR1 Inorganic phosphorus content in leaves and roots of the overexpression lines and wild type. HvPHR1 The inorganic phosphorus content of the leaves of the overexpression strain was significantly higher than that of the wild type under normal and low phosphorus concentrations. Under low phosphorus conditions, the inorganic phosphorus content of the third to fifth leaves increased by 4-12 times, reaching 24%, 40% and 60% of the phosphorus content of the leaves under normal phosphorus culture conditions, respectively. HvPHR1, HvIPS1 and HvPHO2 Gene in wild-type GP and HvPHR1 Expression levels in leaves of overexpressing lines.

[0013] Figure 3 Nuclear subcellular localization of HvPHR1. Agrobacterium AGL1 containing a GFP-fused HvPHR1 plasmid (HvPHR1-pH7WGF2) and a GFP-empty plasmid (pH7WGF2) were injected into tobacco leaves, and the subcellular localization of the protein was observed using a confocal microscope.

[0014] Figure 4 HvPHR1 has transcription factor activity assay. A. Luciferase reporter gene activation assay. B. Luciferase reporter gene activation quantitative assay (n=3). HvPHR1 Agrobacterium overexpressing the HvPHR1-pBract214 vector and Agrobacterium expressing the Luc luciferase reporter gene vector (POsIPS1-1300-Luc) were mixed at equal concentrations and volumes and injected into tobacco leaves (A upper left and A upper right). Agrobacterium alone containing POsIPS1-1300-Luc (A lower left) and Agrobacterium alone containing the 1300-Luc empty vector (A lower right) served as controls. DETAILED DESCRIPTION

[0015] The technical solution of the present invention is further described in detail below with reference to the accompanying drawings and specific embodiments: like Figures 1 - 4 As shown, Example 1: Identification and tissue expression analysis of barley PHR homologous proteins The present invention provides sequence information of Arabidopsis PHR1 and its homologous proteins PHL1, PHL2 and PHL3; protein sequences of rice PHR1, PHR2 (LOC_Os07g25710), PHR3 and PHR4; and barley transcript, CDS and protein sequence files. A BLAST comparison database was established for barley protein sequences. The rice PHR2 (LOC_Os07g25710) protein was used as a bait protein for comparison and search of barley PHR homologous proteins. In the comparison results, two barley PHR homologous proteins were screened based on the criteria of alignment length greater than 300 amino acids with the bait protein and evalue less than 1e-20. A phylogenetic tree was constructed for the PHR bait protein and the two barley homologous proteins using MEGA7 software ( Figure 1 A) HORVU4Hr1G051080 and HORVU3Hr1G019260 were named HvPHR1 and HvPHR2, respectively, based on their similarity to rice PHR proteins.

[0016] Total RNA was extracted from germinating seeds, inflorescences, leaves, roots, and filling seeds of barley Golden Hope (GP) using a plant total RNA extraction kit (TIANGEN, China). The extraction steps were as described in the reference manual. The purity and concentration of the extracted RNA were determined using a NanoDrop 2000 (ThermoFisher Scientific Inc., USA). Reverse transcription was performed using a cDNA First Strand Synthesis Kit (TIANGEN, China) with total RNA as a template. HvPHR1 and HvPHR2 The real-time fluorescence quantitative PCR primers were designed based on the transcript reference sequence, and the quantitative results of different tissues showed HvPHR1 and HvPHR2 are constitutively expressed and HvPHR1 The expression level is the same tissue HvPHR2 100 times the expression level ( Figure 1 B), implies HvPHR1 The quantitative primers for HvPHR1 and HvPHR2 are: RT-HvPHR1-F: TCTAGACCTGAAATCGAGCA RT-HvPHR1-R: CTTGTTTCTTCAATTCGCAAC RT-HvPHR2-F: AACTCAACCACAGGCTGGAC RT-HvPHR2-R:CGTGTCTTCGAGGTGTTGGA Example 2: HvPHR1 Gene cloning Total RNA was extracted from leaves of two-week-old hydroponic barley Golden Hope (GP) seedlings using a plant total RNA extraction kit (TIANGEN, China). The extraction steps were as described in the reference manual. The purity and concentration of the extracted RNA were determined using a NanoDrop 2000 (Thermo Fisher Scientific Inc., USA). Reverse transcription was performed using a cDNA First Strand Synthesis Kit (TIANGEN, China) with total RNA as a template. HvPHR1 Primers were designed on the 5' and 3'UTRs of the transcript reference sequence. The PCR product was 1438 bp, containing the full-length coding frame CDS (1356 bp in length, encoding 451 amino acids). The target fragment was amplified using a high-fidelity DNA polymerase and ligated into the pGM-T vector. The ligation product was transformed into competent Escherichia coli DH5a and plated on LB solid medium containing ampicillin. The cells were cultured at 37 degrees for about 16 hours, and single clones were picked and shaken for PCR verification. Positive clones were sent to the company for sequencing. Single clones with correct sequencing were expanded, and the culture solution was stored in glycerol and plasmids were extracted. The plasmid was named HvPHR1-T and used for the construction of vectors such as HvPHR1 gene overexpression transgenes.

[0017] HvPHR1 The transcript amplification primers are: Transcript-HvPHR1-F: CTTGATGAGGAGGTGTGATCT Transcript-HvPHR1-R: AGCATCGACACGGAATGAAAC Example 3: HvPHR1 Construction of vectors for transgene overexpression, subcellular localization, and transcription factor activity detection Built using the Gateway method HvPHR1 Gene overexpression and subcellular localization vectors, namely HvPHR1-pBract214 and HvPHR1-pH7WGF2.

[0018] Using the stored HvPHR1-T plasmid as a template, primers for overexpression vectors with linkers (underlined) were designed for amplification. HvPHR1 The ORF fragment of the gene (with the stop codon TAA) and the primer sequence are: BP-HvPHR1-F: GGGGACAAGTTTGTACAAAAAAGCAGGCTTC ATGAGGAGGTGTGATCTGAGA BP-HvPHR1-R: GGGGACCACTTTGTACAAGAAAGCTGGGTC TTAACTATCATGCACCCTTCGG PCR amplification products were detected by 1% agarose gel electrophoresis, and the target product was recovered and its concentration determined. The recovered product was then subjected to a BP recombination reaction with the pDONR(Zeo) entry vector using Gateway BP Clonase II enzyme mix (Invitrogen, USA). The recombination reaction protocol was described in the reference manual. The recombinant product was transformed into competent Escherichia coli DH5a cells, plated with LB solid medium containing bleomycin, and cultured at 37°C for approximately 16 hours. Single colonies were picked and confirmed by PCR. Positive clones were sent to the company for sequencing. Correctly sequenced single colonies were expanded, stored in glycerol, and used for plasmid extraction. The plasmid was named HvPHR1-pDONR(Zeo).

[0019] The HvPHR1-pDONR (Zeo) plasmid was recombined with the target vectors pBract214 and pH7WGF2 by LR recombination reaction using Gateway LR Clonase II enzyme mix (Invitrogen, USA) to construct HvPHR1 For overexpression and subcellular localization vectors, refer to the reference instructions for recombination reaction procedures. The recombinant product was transformed into competent Escherichia coli DH5a cells and plated with LB solid medium containing kanamycin and spectinomycin, respectively. Culture was performed at 37°C for approximately 16 hours. Single colonies were picked and shaken, and the culture suspension was verified by PCR. Positive clones were sent to the company for sequencing. Correctly sequenced single clones were expanded, stored in glycerol, and plasmids were extracted. The plasmids were named HvPHR1-pBract214 and HvPHR1-pH7WGF2, respectively. The HvPHR1-pBract214 plasmid and the pSoup plasmid were co-transformed into competent Agrobacterium tumefaciens AGL1 cells, plated with YEP solid medium containing kanamycin and rifampicin, and cultured at 28°C for approximately 48 hours. Positive clones were verified by PCR. 100 μl of positive clones were added to 10 mL of MG medium (containing 25 μg / mL rifampicin and 50 μg / mL kanamycin) and cultured at 28°C at 200 rpm / min. The culture was shaken to an OD600 of 0.6-0.7. An equal volume of 30% sterile glycerol was added, mixed, and snap-frozen in liquid nitrogen. The culture was then stored at -80°C until further use. Transform Agrobacterium tumefaciens AGL1 with the HvPHR1-pH7WGF2 plasmid and plated on YEP solid medium containing spectinomycin. The culture was cultured at 28°C for approximately 48 hours. Positive clones were verified by PCR. 100 μl of positive clones were added to 10 mL of YEP medium (containing 50 μg / mL spectinomycin) and cultured at 28°C at 200 rpm / min. The culture was shaken to an OD600 of 1.0. An equal volume of sterile glycerol was added, mixed, and snap-frozen in liquid nitrogen. The culture was then stored at -80°C until further use.

[0020] Homologous recombination technology was used to construct the HvPHR1 transcription factor activity detection vector and amplify the rice IPS1 The 1597-bp promoter region upstream of the gene (LOC_Os03g05334) (containing the P1BS cis-acting element) was ligated into the laboratory-maintained luciferase reporter 1300-Luc vector. One week after germination, approximately 1 cm of rice leaves were cut and the rice leaf genome was extracted using a high-efficiency plant genomic DNA extraction kit (TIANGEN, China). Primers were designed targeting the 1601-bp promoter region of the rice IPS1 gene. The target fragment was amplified using a high-fidelity DNA polymerase and ligated into the pGM-T vector. The ligation product was transformed into competent Escherichia coli DH5a and plated on LB solid medium containing ampicillin. The culture was incubated at 37°C for approximately 16 hours. Single colonies were selected and shaken for verification by PCR. Positive clones were sent to the company for sequencing. Correctly sequenced single colonies were propagated, stored in glycerol stock, and plasmids were extracted. The plasmid was named POsIPS1-T. The primers for amplifying the rice IPS1 promoter are: POsIPS1-F: TCAGCAGCATCGTTCATCAAT POsIPS1-R: ACATCCACCGAATAATTGCC Using the correctly sequenced POsIPS1-T as a template, primers were designed to amplify homologous recombination primers with vector information + BamHI restriction site (underlined) to amplify the 1597bp region of the IPS1 gene promoter. The primer information is as follows: re-POsIPS1-F: CTGCAGGTCGACTCTAGAGGATCC TCAGCAGCATCGTTCATCAAT re-POsIPS1-R: GTAAAAATAAAGCTTATCGATGGATCC CCACCGAATAATTGCCAAAGGA PCR amplification products were detected by 1% agarose gel electrophoresis, and the target product was recovered and its concentration determined. The recovered product was recombined with the BamHI-digested 1300-Luc vector using the In-Fusion HD Cloning Kit (Takara, Japan). Recombination procedures are described in the reference manual. The recombinant product was transformed into competent Escherichia coli DH5a cells, plated on LB solid medium containing kanamycin, and cultured at 37°C for approximately 16 hours. Single colonies were picked and verified by PCR. Positive clones were sent to the company for sequencing. Correctly sequenced single colonies were expanded, stored in glycerol stock, and plasmids were extracted. The plasmid was named POsIPS1-1300-Luc. The POsIPS1-1300-Luc plasmid was transformed into Agrobacterium tumefaciens AGL1, plated on YEP solid medium containing kanamycin, and cultured at 28°C for approximately 48 hours. Positive colonies were verified by PCR. Take 100 μl of positive clone culture liquid and add it to 10 mL of YEP culture medium (containing 50 μg / mL kanamycin). Cultivate at 28 degrees Celsius, 200 rpm / min, and shake until OD600 = 1.0. Add an equal volume of sterile glycerol, mix well, and quickly freeze in liquid nitrogen. Store at -80 degrees Celsius until use.

[0021] Example 4: HvPHR1 Gene overexpression genetic transformation and phenotypic identification HvPHR1Gene-overexpressing transgenic material was created based on a published genetic transformation system for immature barley embryos (Hinchliffe and Harwood 2019). The procedure was as follows: Immature embryos of Golden Hope (GP) barley cultivated 2-3 weeks after anthesis were selected for genetic transformation. Kernels meeting the criteria were stripped from the ear, and the awns removed. The seeds were surface-sterilized with 70% alcohol for 30 seconds, washed several times with sterile water, soaked in 10% sodium hypochlorite for 4 minutes, and washed several times with sterile water. Immature embryos were isolated on sterile filter paper, the embryonic axis removed, and placed on callus induction medium with the scutellum facing upward. Incubation was carried out in the dark at 23-24°C for 2-3 days. 400 μL of the stored HvPHR1 gene-overexpressing Agrobacterium culture was added to 10 mL of antibiotic-free MG liquid medium and shaken at 28°C at 180 rpm to an OD600 of 1.3-1.4 for embryo infection. The prepared Agrobacterium infection solution was dripped onto each immature embryo and allowed to dry. Seal the plates with parafilm and incubate in the dark at 23-24°C for 2 days. Transfer the immature embryos to fresh callus induction medium plates for selection (containing 50 mg / L hygromycin and 160 mg / L Trichoderma). After 56 days of incubation in the dark at 23-24°C (changing the medium plates every 14 days), calli isolated from the immature embryos are transferred to transfer medium and incubated at 24°C under low light for 21 days, at which point green spots will appear. Transfer the green spots to subculture medium and continue incubation. Roots begin to form when the upper leaves reach 2-3 cm. Transfer the seedlings to rooting medium without any growth regulators or antibiotics. After rooting, remove the established seedlings, wash off the medium, and transfer them to plastic pots containing vermiculite and nutrient medium. Cultivate in a 22°C / 18°C climate chamber (day / night) until T1 seed is harvested.

[0022] The T1 generation HvPHR1 Gene overexpression lines (HvPHR1-OE1 and HvPHR1-OE2) and control (GP) were cultured in normal phosphorus concentration (200µm NH4H2PO4) and low phosphorus stress (10µm NH4H2PO4) hydroponic culture, and the inorganic phosphorus content in leaves and roots was measured. The results showed that after 3 weeks of hydroculture at normal phosphorus concentration, the inorganic phosphorus content in leaves and roots was significantly decreased. HvPHR1 The old leaves of the gene overexpression strain showed obvious phosphorus poisoning phenotype, and the inorganic phosphorus in the third to fifth leaves was significantly higher than that in the control ( Figure 2 ); Under low phosphorus stress hydroponic conditions, HvPHR1 The old leaves of the gene overexpression strain did not show obvious phosphorus poisoning phenotypes. Under low phosphorus conditions, the inorganic phosphorus content of the third to fifth leaves increased by 4-12 times, reaching 24%, 40% and 60% of the phosphorus content of the leaves under normal phosphorus culture conditions, respectively. Figure 2 ). Overexpression HvPHR1At the transcriptional level, it significantly increased the expression of HvIPS1 and significantly inhibited the expression of HvPHO2.

[0023] Example 5: Detection of HvPHR1 subcellular localization and transcription factor activity Agrobacterium strains HvPHR1-pH7WGF2, POsIPS1-1300-Luc, and HvPHR1-pBract214 stored at -80°C were streaked onto YEP solid medium supplemented with the corresponding antibiotics and cultured at 28°C for approximately 48 hours. Several single colonies were then inoculated into 10 mL of YEP liquid medium supplemented with the corresponding antibiotics and shaken at 28°C to an OD600 of approximately 1.0. The cells were harvested by centrifugation at 3000g for 10 minutes, washed twice with injection buffer (0.2 mM AS, 10 mM MES, and 1 / 2 MS, pH 5.7), and resuspended in the same buffer to an OD600 of approximately 1.0. The resuspended bacterial solution was aspirated with a 1 mL syringe and injected into tobacco leaves at the 5-6 leaf stage from the back of the leaf (HvPHR1-pH7WGF2 was injected alone for HvPHR1 subcellular localization identification, and an equal amount of POsIPS1-1300-Luc and HvPHR1-pBract214 resuspended bacterial solution was used for HvPHR1 transcription factor activity detection). The injected tobacco was continued to be cultured in an incubator (26 degrees / 24 degrees, 16 hours / 8 hours, day / night) for 3 days, and then the subcellular localization of HvPHR1 was observed using a laser confocal microscope (LSM710, Carl Zeiss, Germany), and the expression of the luciferase reporter gene was observed using the NightSHADE in vivo Plant Imaging System (LB985, Germany). The results showed that HvPHR1 was subcellularly localized in the cell nucleus and could bind to rice. IPS1 The promoter activates luciferase gene expression.

[0024] Among them: Figure 1 Barley PHR Gene homology and expression analysis. A. Phylogenetic tree analysis of PHR homologous proteins in barley, rice, and Arabidopsis. Green, yellow, and red colors indicate PHR homologous proteins in barley, rice, and Arabidopsis, respectively. B. Barley HvPHR1 and HvPHR2 The expression in different tissues. The left and right Y axes represent HvPHR1 and HvPHR2 relative to barley housekeeping genes HvACTIN E, embryo of 4-day-old seed; I, inflorescence tissue; L, leaf tissue of 14-day-old barley; R, root tissue of 14-day-old barley; S, grain-filling seed.

[0025] Figure 2 Overexpression HvPHR1The transgenic lines showed significantly increased leaf phosphorus content. A. Hydroponics of normal phosphorus concentration (200µm NH4H2PO4) and low phosphorus concentration (10µm NH4H2PO4) for three weeks HvPHR1 Phenotypes of overexpression lines and wild type (GP). B. Hydroponics at normal and low phosphorus concentrations for three weeks HvPHR1 Phenotypes of the third to fifth leaves of the overexpression lines and wild type under normal phosphorus concentration hydroponics HvPHR1 Overexpression of C. senescent leaves showed obvious phosphorus toxicity phenotype. C. Hydroponics at normal and low phosphorus concentrations for three weeks HvPHR1 Inorganic phosphorus content in leaves and roots of the overexpression lines and wild type. HvPHR1 The inorganic phosphorus content of the leaves of the overexpression strain was significantly higher than that of the wild type under normal and low phosphorus concentrations. Under low phosphorus conditions, the inorganic phosphorus content of the third to fifth leaves increased by 4-12 times, reaching 24%, 40% and 60% of the phosphorus content of the leaves under normal phosphorus culture conditions, respectively. HvPHR1, HvIPS1 and HvPHO2 Gene in wild-type GP and HvPHR1 Expression levels in leaves of overexpressing lines.

[0026] Figure 3. Nuclear subcellular localization of HvPHR1. Agrobacterium AGL1 containing a GFP-fused HvPHR1 plasmid (HvPHR1-pH7WGF2) and an empty GFP vector plasmid (pH7WGF2) were injected into tobacco leaves, and protein subcellular localization was observed using confocal microscopy.

[0027] Figure 4. Detection of HvPHR1 transcription factor activity. A. Luciferase reporter gene activation assay. B. Luciferase reporter gene activation quantitative assay (n=3). HvPHR1 Agrobacterium overexpressing the HvPHR1-pBract214 vector and Agrobacterium expressing the Luc luciferase reporter gene vector (POsIPS1-1300-Luc) were mixed at equal concentrations and volumes and injected into tobacco leaves (A upper left and A upper right). Agrobacterium alone containing POsIPS1-1300-Luc (A lower left) and Agrobacterium alone containing the 1300-Luc empty vector (A lower right) served as controls.

[0028] In summary, the present invention is to HvPHR1 Gene cloning, expression analysis, subcellular localization, transcription factor activity detection, and transgenic function verification were carried out, proving that HvPHR1 is a transcription factor that regulates the ubiquitin E2 conjugating enzyme in the phosphorus signaling pathway at the transcriptional level. HvPHO2 and long noncoding LncRNA HvIPS1 Overexpression of HvPHR1Under low-phosphorus stress conditions (phosphorus content is 5% of normal conditions), the gene can increase the inorganic phosphorus content of the third to fifth leaves by 4-12 times, reaching 24%, 40%, and 60% of the phosphorus content in leaves under normal phosphorus conditions, respectively. This significantly increases the inorganic phosphorus content in barley leaves. This invention provides a theoretical basis and candidate genes for efficient phosphorus breeding and production in barley.

[0029] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any changes or substitutions that are not conceived through creative work should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be based on the scope of protection defined in the claims.

Claims

1. A barley HvPHR1 gene, characterized in that: The barley HvPHR1 gene sequence is shown in SEQ ID NO.

1.

2. The barley HvPHR1 gene according to claim 1, characterized in that: HvPHR1 gene overexpression transgenic intermediate vector HvPHR1-T, The primer sequences for HvPHR1 transcript amplification are: Transcript-HvPHR1-F: SEQ ID NO.2; Transcript-HvPHR1-R: SEQ ID NO.

3.

3. The barley HvPHR1 gene according to claim 2, characterized in that: Using the preserved HvPHR1-T plasmid as a template, primers for the overexpression vector with a linker were designed to amplify the ORF fragment of the HvPHR1 gene for BP reaction to obtain HvPHR1-pDONR (Zeo). The primer sequences are: BP-HvPHR1-F: SEQ ID NO.4 BP-HvPHR1-R:SEQ ID NO.5 The Gateway method was used to construct the HvPHR1 gene overexpression vector HvPHR1-pBract214 and the subcellular localization vector HvPHR1-pH7WGF2.

4. Use of the barley HvPHR1 gene according to any one of claims 1 to 3 in increasing the phosphorus content of barley.

5. The application according to claim 4, characterized in that: HvPHR1 regulates phosphorus homeostasis in barley and can increase the inorganic phosphorus content in barley leaves under low-phosphorus stress conditions.

Images