Application of Plasmodiophora brassicae Pb035 gene in prevention and control of clubroot disease in cruciferous crops

Abstract

The present application belongs to the field of agricultural plant pathology and plant protection technology, and relates to a Plasmodiophora brassicae Pb035 gene and application thereof in prevention and control of Plasmodiophora brassicae. The core of the present application is to use host-induced gene silencing (HIGS) technology or exogenous RNA interference fragment delivery technology to silence Plasmodiophora brassicae Pb035 gene expression, thereby enhancing the resistance of Brassicaceae crops to Plasmodiophora brassicae. The present application provides a key technology and method for prevention and control of Plasmodiophora brassicae, and has broad agricultural application prospect and market value.

Description

Technical Field

[0001] This invention relates to the field of clubroot disease control technology in cruciferous plants, and particularly to a clubroot fungus gene. Pb035 Application in the control of clubroot disease in cruciferous crops. Background Technology

[0002] Cruciferous crops play a vital role in global agriculture, including rapeseed, cabbage, kale, radish, and mustard greens, and are an important component of the human food supply chain and agricultural economy. However, these crops are often borne by obligate, live parasitic protozoa such as *Plasmodiophora* (…). Plasmodiophora brassicae Clubroot, caused by Woronin, can harm almost all cruciferous crops. Clubroot causes the plant roots to swell, become deformed, and rot, severely weakening the crop's ability to absorb water and nutrients, ultimately leading to premature aging, reduced yield, or even crop failure.

[0003] Existing control methods, such as chemical control, soil management, biological control, and the breeding of disease-resistant varieties, all have significant limitations: long-term use of chemical pesticides leads to pesticide resistance and pollutes the environment; soil improvement methods are costly and difficult to promote; biological control methods are limited by environmental conditions; and the effectiveness of disease-resistant varieties is limited due to the rapid evolution of pathogens. Therefore, the development of new clubroot disease control technologies is imperative.

[0004] RNA interference (RNAi) is an evolutionarily conserved gene silencing mechanism mediated by double-stranded RNA. It specifically degrades mRNA complementary to its sequence, thereby inhibiting the expression of target genes. In recent years, the application of RNAi technology in plant disease control has developed rapidly, especially strategies represented by host-induced gene silencing (HIGS) and spray-induced gene silencing (SIGS), which have become important directions for green pesticides and precision breeding. Summary of the Invention

[0005] The purpose of this invention is to provide key targets of clubroot bacteria for improving clubroot resistance in cruciferous crops. By targeting and inhibiting these targets, clubroot resistance in cruciferous crops can be improved, providing new key targets and technical means for improving clubroot resistance and achieving long-term and efficient control in cruciferous crops.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0007] In a first aspect, the present invention provides a root-bearing fungus. Pb035 Genes, the ones mentioned Pb035 The nucleotide sequence of the gene is shown in SEQ ID NO.1:

[0008]

[0009] Secondly, the present invention also provides a method for silencing. Pb035 base Because of the expressed biomaterial, the biomaterial contains a targeted Pb035 RNA interference fragments in genes;

[0010] Preferably, the RNA interference fragment includes a target gene fragment S1 and an inverse complementary fragment S2 of the target gene fragment, the nucleotide sequences of which are shown in SEQ ID NO.2-3, respectively:

[0011] S1:

[0012] (SEQ ID NO.2);

[0013] S2:

[0014] (SEQ ID NO.3).

[0015] Preferably, the biological material is at least one of a recombinant expression vector, a transgenic cell line, and a recombinant bacterium.

[0016] Thirdly, the present invention also provides a method for controlling clubroot disease in cruciferous crops, comprising the following steps: using the above-mentioned silencing agent... Pb035 Gene-expressing biomaterials were transferred into cruciferous crops to reduce... Pb035 Gene expression levels.

[0017] It should be noted that the control process of this invention includes both prevention and treatment; that is, it can be administered before clubroot infection by introducing a silencing agent. Pb035 Gene-expressing biomaterials that stably express targeted clubroot bacteria within plant cells. Pb035 RNA interference fragments in genes can prevent clubroot infection; they can also be used to silence bacteria after clubroot infection. Pb035Biological materials that express genes can promptly interfere with gene expression and block the infection process of *Plasmodiophora stylosa*.

[0018] Preferably, the biomaterial is transferred into cruciferous crops by constructing a silencing vector and using Agrobacterium-mediated transformation; or, the biomaterial is transferred into cruciferous crops by root irrigation.

[0019] More preferably, the biomaterial contains a target Pb035 The RNA interference fragment of the gene includes a target gene fragment S1 and a reverse complementary fragment S2 of the target gene fragment, the nucleotide sequences of which are shown in SEQ ID NO.2-3, respectively.

[0020] More preferably, the Agrobacterium is Agrobacterium tumefaciens.

[0021] More preferably, the method for constructing the silent carrier includes the following steps:

[0022] (1) with Plasmodium Pb035 Using the gene sequence (as shown in SEQ ID NO.1) as a template, the target gene fragment S1 (as shown in SEQ ID NO.2) was amplified using the primers shown in SEQ ID NO.4-5.

[0023] (2) Linearized vectors were obtained by digesting the PBI121Bar-RNAi vector with BamHI enzyme;

[0024] (3) Homologous recombination of the target fragment S1 (as shown in SEQ ID NO.2) and the linearized vector PBI121Bar-RNAi was performed to obtain the recombinant vector PBI121Bar-RNAi-S1;

[0025] (4) with Plasmodium Pb035 Using the gene sequence (as shown in SEQ ID NO.1) as a template, the reverse complementary fragment S2 of the target gene fragment (as shown in SEQ ID NO.3) is amplified using the primer pairs shown in SEQ ID NO.6-7.

[0026] (5) Linearized vector was obtained by digesting the recombinant vector PBI121Bar-RNAi-S1 with Sac I enzyme;

[0027] (6) Homologous recombination was performed between the target fragment S2 (as shown in SEQ ID NO.3) and the linearized vector PBI121Bar-RNAi-S1 to obtain Pb035 Gene silencing vector.

[0028] More preferably, the primers for amplifying the target gene fragment S1 and the reverse complementary fragment S2 of the target gene fragment are as shown in SEQ ID NO. 4-7, respectively:

[0029] S1-F: AACACGGGGGACTCTAGA GGATCC GATTGCACGGTCGAGAAGGA (SEQ ID NO.4);

[0030] S1-R: TTACCAAGCTGGGGTACC GGATCC CGAGAGCTGAACTGGGATCC (SEQ ID NO.5);

[0031] S2-F: GCTGGGTTCGAAGTCGAC GAGCTC CGAGAGCTGAACTGGGATCC (SEQ ID NO.6);

[0032] S2-R: GAACGATCGGGGAAATTC GAGCTC GATTGCACGGTCGAGAAGGA (SEQ ID NO.7);

[0033] In SEQ ID NO.4-7, the underlined parts are vector homologous arms, the bolded parts are restriction enzyme sites, and the italicized parts are specific amplifications. Pb035 Primers for genes.

[0034] More preferably, the transfer of the biomaterial into cruciferous crops by root irrigation includes the following steps: mixing the biomaterial, the nanomaterial delivery carrier and the RNase inhibitor, preparing a solution with RNase-free water, and then performing root irrigation on the plants.

[0035] More preferably, the synthesis of the RNA interference fragment contained in the biological material includes the following steps: using primer pairs as shown in SEQ ID NO. 8-9, the RNA interference fragment is synthesized using T7 RNA in vitro transcription technology.

[0036] Most preferably, the primers for synthesizing the RNA interference fragment are as shown in SEQ ID NO. 8-9:

[0037] F: TAATACGACTCACTATAGGGGATTGCACGGTCGAGAAGGA(SEQ ID NO.8);

[0038] R: CCCTATAGTGAGTCGTATTACGAGAGCTGAACTGGGATCC (SEQ ID NO. 9).

[0039] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0040] This invention provides a method for enhancing the resistance of cruciferous crops to clubroot disease by using host-induced gene silencing technology or exogenous double-stranded RNA delivery technology to silence key target genes of clubroot bacteria. Pb035Gene expression can enhance the resistance of cruciferous plants to clubroot disease; it provides a key technology for the prevention and control of clubroot disease in cruciferous crops and has broad prospects for agricultural application and market value. Attached Figure Description

[0041] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0042] Figure 1 When Arabidopsis thaliana at different growth stages is infected with Plasmodium falciparum Pb035 A schematic diagram of gene expression levels in root cells; where RS represents dormant spores, MP represents mid-primary infection, IS represents early secondary infection, MS represents mid-secondary infection, and LS represents late secondary infection; FPKM represents the fragment length read per million bases per kilobase of transcription.

[0043] Figure 2 for Pb035 Protein structure diagram.

[0044] Figure 3 Map of the pBI121Bar-RNAi vector.

[0045] Figure 4 for Pb035 A schematic diagram of the construction of a gene silencing vector.

[0046] Figure 5 To target *Plasmodiophora* using host-induced gene silencing technology Pb035 Disease survey of transgenic Arabidopsis thaliana after inoculation with different physiological races of Plasmodium falciparum; Figure A shows... Pb035 Figure A shows gene expression level analysis; Figure B shows a picture of swollen roots of Arabidopsis thaliana; Figure C shows a disease index survey.

[0047] Figure 6 To target clubroot bacteria through root irrigation Pb035 Double-stranded RNA technology for gene silencing Pb035 Figure A shows the disease survey of transgenic Arabidopsis thaliana plants; Figure A is... Pb035 Figure A shows the gene expression level analysis; Figure B shows the disease index survey; Figure C shows the root rot bacteria biomass survey. Detailed Implementation

[0048] The technical solutions of the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0049] It should be noted that the order of description of the following embodiments is not intended to limit the preferred order of embodiments. Furthermore, in the description of this application, the term "comprising" means "including but not limited to". Various embodiments of the present invention may exist in the form of a range; it should be understood that the description in the form of a range is merely for convenience and brevity and should not be construed as a rigid limitation on the scope of the invention; therefore, it should be considered that the range description has specifically disclosed all possible sub-ranges and single numerical values ​​within that range. For example, it should be considered that the range description from 1 to 6 has specifically disclosed sub-ranges, such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., and single digits within the range, such as 1, 2, 3, 4, 5, and 6, regardless of the range. Additionally, whenever a numerical range is indicated herein, it means including any referenced number (fraction or integer) within the indicated range.

[0050] This invention provides root-emergent fungi. Pb035 The gene, with its nucleotide sequence as shown in SEQ ID NO.1.

[0051] Embodiments of the present invention also provide for silencing Pb035 Gene expression biomaterials, including targeted Pb035 RNA interference fragments in genes.

[0052] Specifically, the RNA interference fragment includes the target gene fragment S1 and the reverse complementary fragment S2 of the target gene fragment, with nucleotide sequences as shown in SEQ ID NO.2-3, respectively.

[0053] Specifically, the biological material is at least one of recombinant expression vector, transgenic cell line, and recombinant bacteria.

[0054] This invention also provides a method for controlling clubroot disease in cruciferous crops, comprising the following steps: using a silencing agent... Pb035 Gene-expressing biomaterials were transferred into cruciferous crops to reduce... Pb035 Gene expression levels. Specifically, biological materials are transferred into cruciferous crops by constructing silencing vectors and using Agrobacterium-mediated transformation; or, biological materials are transferred into cruciferous crops through root irrigation.

[0055] More specifically, biomaterials include targeted... Pb035The RNA interference fragment of the gene includes a target gene fragment S1 and a reverse complementary fragment S2 of the target gene fragment, the nucleotide sequences of which are shown in SEQ ID NO.2-3, respectively.

[0056] More specifically, Agrobacterium is Agrobacterium tumefaciens.

[0057] More specifically, the method for constructing a silent carrier includes the following steps:

[0058] (1) with Plasmodium Pb035 Using the gene sequence (as shown in SEQ ID NO.1) as a template, the target gene fragment S1 (as shown in SEQ ID NO.2) was amplified using the primers shown in SEQ ID NO.4-5.

[0059] (2) Linearized vectors were obtained by digesting the PBI121Bar-RNAi vector with BamHI enzyme;

[0060] (3) Homologous recombination of the target fragment S1 (as shown in SEQ ID NO.2) and the linearized vector PBI121Bar-RNAi was performed to obtain the recombinant vector PBI121Bar-RNAi-S1;

[0061] (4) with Plasmodium Pb035 Using the gene sequence (as shown in SEQ ID NO.1) as a template, the reverse complementary fragment S2 of the target gene fragment (as shown in SEQ ID NO.3) is amplified using the primer pairs shown in SEQ ID NO.6-7.

[0062] (5) Linearized vector was obtained by digesting the recombinant vector PBI121Bar-RNAi-S1 with Sac I enzyme;

[0063] (6) Homologous recombination was performed between the target fragment S2 (as shown in SEQ ID NO.3) and the linearized vector PBI121Bar-RNAi-S1 to obtain Pb035 Gene silencing vector.

[0064] More specifically, the transfer of biomaterials into cruciferous crops via root irrigation includes the following steps: mixing biomaterials, nanomaterial delivery carriers, and RNase inhibitors, preparing a solution with RNase-free water, and then applying the solution to the plants via root irrigation.

[0065] More specifically, the synthesis of the RNA interference fragment includes the following steps: using primer pairs as shown in SEQ ID NO. 8-9, the RNA interference fragment is synthesized using T7 RNA in vitro transcription technology.

[0066] More specifically, the RNA interference fragment contained in the synthetic biological material includes the following steps: using primer pairs as shown in SEQ ID NO. 8-9, the RNA interference fragment is synthesized using T7 RNA in vitro transcription technology.

[0067] The following specific embodiments further illustrate the root-emergent fungus of the present invention. Pb035 Methods for the application of genes in the control of clubroot disease in cruciferous crops. This section further illustrates the invention with specific embodiments, but should not be construed as limiting the invention. Unless otherwise specified, the techniques used in the embodiments are conventional methods well known to those skilled in the art. Unless otherwise specified, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in the art.

[0068] In the following embodiments, cruciferous crops include one or more of the following: rapeseed, Chinese cabbage, kale, mustard, or radish.

[0069] In the following embodiments, the specific methods for investigating the incidence rate and disease index are as follows: Thirty days after Arabidopsis thaliana inoculation with *Plasmodiophora*, the plants were uprooted, the roots were washed clean with running water, and a disease survey was conducted. The number of infected plants and the disease severity were counted, and the incidence rate and disease index were calculated. The formula for calculating the disease index is:

[0070]

[0071] Clubroot disease is graded from 0 to 3: Grade 0: Normal root system, no disease symptoms; Grade 1: No clubroot on the main root; a few small tumors on the lower 1 / 3 of the lateral roots; Grade 2: Clubroot on the main root or tumors on the lower 1 / 3 to 2 / 3 of the lateral roots; Grade 3: Larger tumors on the main root and the upper 2 / 3 of the lateral roots. The following examples demonstrate the detection and verification. Pb035 Primers for gene expression, such as SEQ ID NO.10-11:

[0072] Pb035 -F: GATTGCACGGTCGAGAAGGA (SEQ ID NO.10);

[0073] Pb035 -R: TGCATGAGAGCTTGACAGGG (SEQ ID NO. 11).

[0074] Example 1: Plasmodium falciparum Pb035 Genes are highly expressed at all stages of infection.

[0075] To investigate plasmin Pb035This study, based on transcriptome data, systematically analyzed the expression pattern of a *Plasmodiophora* gene at different infection stages to investigate its biological function and potential application value in disease control. The *Plasmodiophora* strain used was race 4, collected from Jishou City, Hunan Province. Two-week-old *Arabidopsis thaliana* seedlings were used as experimental material, and a concentration of 10... 6 To ensure the consistency and reproducibility of infection, root inoculation was performed using a suspension of resting spores / strain of *Plasmodiophora stearothermiae*. Sample collection covered all key stages of *Plasmodiophora stearothermiae* infection, including resting spores (RS), mid-primary infection (MP), early-secondary infection (IS), mid-secondary infection (MS), and late-secondary infection (LS). Results showed that *Plasmodiophora stearothermiae*... Pb035 The gene is expressed at relatively high levels at all stages of infection, especially at the end of the secondary infection stage. Figure 1 This suggests that the gene may play a crucial role in the establishment of plasmodium infection and disease progression. This finding provides a basis for further analysis. Pb035 This laid the foundation for its functional mechanism and its potential use as a target for disease control.

[0076] Further based on protein sequence and structure ( Figure 2 Annotation revealed that this protein possesses typical signal peptide and protein disulfide isomerase functional domains, capable of catalyzing the formation and reconstruction of disulfide bonds. This suggests that it enhances the adaptability and pathogenicity of *Plasmodiophora stearothermiae* to the host environment by regulating the proper folding of the protein, providing a basis for the development of targeted therapies. Pb035 Gene-based disease control technologies provide a theoretical basis and molecular targets. For example... Figure 2 As shown, the pLDDT (predicted Local Distance Difference Test) score represents the confidence level of each amino acid residue in the predicted protein structure, ranging from 0 to 100. A higher score indicates a more reliable structure. The 82.48 shown in the figure is the average confidence score for all residues.

[0077] Example 2: Targeted silencing based on host-induced gene silencing (HIGS) technology Pb035 Transgenic plants with significantly enhanced resistance to clubroot disease

[0078] To verify Pb035 This embodiment constructs a targeted silencing mechanism to explore the disease control potential of genes. Pb035 The host-induced gene silencing vector. The original vector for the silencing expression vector was the pBI121Bar-RNAi vector preserved in our laboratory, with *E. coli* as the host bacterium. The vector map is shown below. Figure 3 As shown. See also Figure 4, Pb035 The process of constructing gene silencing vectors specifically includes: using *Plasmodium* Pb035 Using the gene sequence (as shown in SEQ ID NO.1) as a template, the target gene fragment S1 (as shown in SEQ ID NO.2) was amplified using primers shown in SEQ ID NO.4-5; the PBI121Bar-RNAi vector was linearized by digesting it with BamHI; the target fragment S1 (as shown in SEQ ID NO.2) and the linearized vector PBI121Bar-RNAi were homologously recombinated to obtain the recombinant vector PBI121Bar-RNAi-S1; *Plasmodiophora stearothermiae* was used as a template. Pb035 Using the gene sequence (as shown in SEQ ID NO.1) as a template, the inverse complementary fragment S2 of the target gene fragment (as shown in SEQ ID NO.3) was amplified using primer pairs shown in SEQ ID NO.6-7; the recombinant vector PBI121Bar-RNAi-S1 was digested with Sac I to obtain a linearized vector; homologous recombination of the target fragment S2 (as shown in SEQ ID NO.3) and the linearized vector PBI121Bar-RNAi-S1 was performed to obtain... Pb035 Gene silencing vector. Restriction endonuclease digestion confirmed correct vector construction. The expression of the RNA interference fragment was driven using the 35S promoter and NOS terminator carried on the vector.

[0079] Will Pb035 The gene silencing vector was transformed into Agrobacterium GV3101 (Shanghai Weidi Biotechnology Co., Ltd.), and then transformed into Columbia-0 Arabidopsis thaliana using the inflorescence immersion method. Arabidopsis thaliana Transgenic plants were screened using the herbicide resistance gene (bar) carried in the vector. Harvested Arabidopsis seeds were evenly sown in 10 cm × 20 cm bread boxes and grown under artificial light for one week before the first herbicide screening. 80 µL of 10% glufosinate was dissolved in 500 mL of deionized water, shaken well, and sprayed evenly onto the plant leaves, ensuring complete wetting. The spraying was repeated one week later; surviving plants were designated as T1 generation transgenic plants. The T2 generation screening method was basically the same, except that seeds were sown in small pots for cultivation. For the T3 generation screening, to more accurately observe the homozygosity of the progeny, nine seeds were evenly sown in each small pot, and the spraying and screening were performed using the same method. Plants from which all progeny survived were considered homozygous. Ultimately, two homozygous transgenic lines (L1 and L2) were successfully obtained.

[0080] After inoculation with a suspension of *Plasmodiophora* spores from six different physiological races, root samples were collected on day 8 for qPCR testing. Pb035The specific experimental procedure for gene expression levels is as follows: Total RNA was extracted using TriQuick Reagent (Beijing Solarbio Technology Co., Ltd., catalog number: R1100), and genomic DNA contamination was removed using DNase I (Beyotime Biotech Inc., catalog number: D7076). After RNA precipitation, it was dissolved in RNase-free water (Beyotime Biotech Inc., catalog number: R0022). cDNA synthesis was performed using 5×TS RT-Mix (ShaanxiProyanti Biotechnology Development Co., Ltd., catalog number: RT-010-100), reacted at 50℃ for 15 minutes, and then inactivated at 85℃ for 5 seconds. qPCR was performed using 2×Universal SYBR qPCR Master Mix (Beijing noble Ryder Technology Co., Ltd., catalog number: FQ-PCR05-1) premix, with 10 μL of premix and 0.4 μL of 10 μM forward / reverse primers (primer sequences as shown in SEQ ID) in a 20 μL reaction system. As shown in NO.10-11, primers (final concentration 0.2 μM) and 1-2 μL cDNA template were used. The program was run on an ABI 7500 Fast fluorescence PCR instrument (Thermo Fisher Scientific Inc.): 95℃ pre-denaturation for 30 seconds, followed by 40 cycles of 95℃ denaturation for 10 seconds / 60℃ annealing extension for 30 seconds, and finally, melting curves were collected. The *Plasmodiophora* actin gene was used as an internal control gene. The results were obtained through 2... -ΔΔCt Method calculation Pb035 The relative expression level of the gene is used to ensure that the melting curve has a single peak and the amplification efficiency is between 90% and 110%.

[0081] like Figure 5 As shown, qPCR analysis results confirmed that transgenic plants... Pb035 Gene expression levels were significantly downregulated ( Figure 5 Figure A shows the root swelling of the transgenic line. Figure 5 (Figure B in the chart) and the disease index (after t-test, Figure 5 The C-value in the target group (Figure C) was significantly lower than that in the control group, indicating that the target... Pb035 The HIGS gene technology can confer broad-spectrum resistance to clubroot disease in plants. This result validates the efficacy of this technology at the functional level. Pb035 The feasibility of using genes as key targets for disease control.

[0082] Example 3: External Silence Pb035 RNA interference fragments in the gene significantly enhance plant resistance to clubroot.

[0083] To verify the target Pb035 Whether the RNA interference fragment of the gene has the effect of controlling clubroot disease was investigated using the TR102-T7RNAi Transcription Kit (Nanjing Novizan Biotechnology Co., Ltd.) to synthesize a targeted RNA interference fragment. Pb035 The primer sequences for synthesizing the RNA interference fragment of the gene via in vitro transcription are shown in SEQ ID NO. 8-9.

[0084] Under artificial light cultivation conditions, each wild-type Arabidopsis thaliana ( Arabidopsis thaliana ) Root inoculation at a concentration of 1×10⁻¹ mL 6 A suspension of *Plasmodiophora spores* (racemetrorrhizae 4, Jishou, Hunan) was prepared at 40 nmol / L using RNase-free water (Beyotime Biotech Inc., catalog number: R0022). An amino-modified dendritic macroporous silica nanomaterial delivery carrier (Jiangsu Xianfeng Nanomaterials Technology Co., Ltd., catalog number: 778949) was added to a final concentration of 0.5 mg / mL, and an RNase inhibitor (RNaseOUT™, Thermo Fisher Scientific Inc., catalog number: 10777019) was added to a final concentration of 1 U / μL. The solution was incubated on ice for 30 minutes before use. Before application, the solution was thoroughly mixed, and 1 mL was slowly added dropwise to the root of each *Arabidopsis thaliana* plant using a pipette. An RNA interference fragment solution was applied three times after inoculation with *Plasmodiophora spores* on days 2, 4, and 6. A blank control group was included. Pb035 The method for detecting gene expression levels is the same as in Example 2.

[0085] The results showed that 8 days after inoculation with *Plasmodiophora stylosa*, the treatment group... Pb035 The gene expression level decreased by 52.8% compared to the control group. Figure 6 Figure A in the diagram); 25 days after inoculation, the disease index of Arabidopsis roots in the treatment group ( Figure 6 Figure B in the diagram) and the biomass of clubroot bacteria ( Figure 6 The C-figures in the figure decreased by 60.3% and 42.6%, respectively. These results indicate that exogenous silencing... Pb035 RNA interference fragments of genes can effectively silence key genes in pathogens, significantly inhibit the infection process of *Plasmodiophora stearothermiae*, and have good control potential.

[0086] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for controlling clubroot disease in Arabidopsis thaliana, characterized in that, The procedure includes the following steps: transforming biological material used to silence Pb035 gene expression into Arabidopsis thaliana to reduce the expression level of the Pb035 gene; The Pb035 The nucleotide sequence of the gene is shown in SEQ ID NO.1; The use of silence Pb035 Gene expression biomaterials for targeted therapy Pb035 RNA interference fragments in genes; The RNA interference fragment includes a target gene fragment S1 and an inverse complementary fragment S2 of the target gene fragment, the nucleotide sequences of which are shown in SEQ ID NO.2-3, respectively.

2. The method for controlling clubroot disease in Arabidopsis thaliana as described in claim 1, characterized in that, The biomaterial was transferred into Arabidopsis thaliana by constructing a silencing vector and using Agrobacterium-mediated transformation. The Agrobacterium is Agrobacterium tumefaciens.

3. The method for controlling clubroot disease in Arabidopsis thaliana as described in claim 2, characterized in that, The method for constructing the silent carrier includes the following steps: (1) with Pb035 Using the nucleotide sequence of the gene as a template, the target gene fragment S1 was amplified using the primers shown in SEQ ID NO.4-5; (2) Linearized vectors were obtained by digesting the PBI121Bar-RNAi vector with BamHI enzyme; (3) Homologous recombination of the target fragment S1 and the linearized vector PBI121Bar-RNAi was performed to obtain the recombinant vector PBI121Bar-RNAi-S1; (4) with Pb035 Using the nucleotide sequence of the gene as a template, the reverse complementary fragment S2 of the target gene fragment was amplified using the primer pairs shown in SEQ ID NO.6-7; (5) Linearized vector was obtained by digesting the recombinant vector PBI121Bar-RNAi-S1 with Sac I enzyme; (6) Homologous recombination of the target fragment S2 and the linearized vector PBI121Bar-RNAi-S1 was performed to obtain the silencing vector.

4. A method for controlling clubroot disease in Arabidopsis thaliana, characterized in that, The procedure includes the following steps: transforming biological material used to silence Pb035 gene expression into Arabidopsis thaliana to reduce the expression level of the Pb035 gene; The nucleotide sequence of the Pb035 gene is shown in SEQ ID NO.1; The biological material used to silence Pb035 gene expression is an RNA interference fragment targeting the Pb035 gene. The RNA interference fragment is a double-stranded RNA synthesized using the primer pairs shown in SEQ ID NO. 8-9 and the T7 RNA in vitro transcription technique.

5. The method for controlling clubroot disease in Arabidopsis thaliana as described in claim 4, characterized in that, The biomaterial is transferred into Arabidopsis thaliana through root irrigation, including the following steps: mixing the biomaterial, nanomaterial delivery carrier and RNase inhibitor, preparing a solution with RNase-free water, and then performing root irrigation on the plant.

Images