Method for increasing content of beneficial glucosinolates in radishes based on gene editing technology
By using gene editing technology to increase the content of 4-methylsulfinylbutyl glucosinolate (Glucoraphanin, GRA) in radish, the problem of low genetic transformation efficiency of radish in existing technology was solved, the GRA content was significantly improved, and the quality improvement of radish and the development of functional foods were promoted.
Patent Information
- Application Number
- CN202510827363.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-19
- Publication Date
- 2025-09-09
AI Technical Summary
The existing technology has not been able to effectively increase the content of 4-methylsulfinylbutyl glucosinolate (Glucoraphanin, GRA) in radish through biotechnology. Radish is a recalcitrant crop with low genetic transformation efficiency.
Using gene editing technology, the target sequence of the RsGRS1 gene was designed and inserted into the Ubi-CRISPR/Cas9-WPR vector. Radish explants were transfected with Agrobacterium to obtain rsgrs1 mutant plants. DNA and RNA were extracted and PCR was performed. Finally, the GRA content was determined by ultra-performance liquid chromatography triple quadrupole tandem mass spectrometry.
The GRA content in radish leaves was significantly increased, with the mutant plants increasing by 39.66-46.38 times compared with the wild type, providing a new method for the creation and genetic improvement of radish germplasm with high beneficial glucosinolate GRA.
Smart Images

Figure CN120608094A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of radish genetic engineering technology, and in particular to the application of gene editing technology in increasing the content of beneficial radish glucosinolate 4-methylsulfinylbutyl glucosinolate (Glucoraphanin, GRA). Background Art
[0002] Glucosinolates (GSLs), also known as glucosinolates, are a class of plant secondary metabolites containing nitrogen and sulfur. They are widely found in cruciferous plants and have been shown to participate in plant defense responses, impart distinctive flavor to plants, and promote human health. Epidemiological studies have shown that consuming cruciferous vegetables can reduce the risk of disease. Currently, most research focuses on the health benefits of glucosinolates and their bioactive derivatives. Among them, sulforaphane (SF), the hydrolysis product of 4-methylsulfinylbutyl glucosinolate (Glucoraphanin, GRA), is one of the most powerful anti-cancer compounds found in plants. It has multiple effects: ① Detoxifying carcinogens and oxidants by inhibiting cell proliferation, showing significant therapeutic effects in the prevention and treatment of various cancers such as breast cancer, lung cancer, prostate cancer, colorectal cancer, and esophageal cancer; ② Protecting against chemotherapy-induced neuropathy and significantly alleviating neuropathic pain; ③ Inhibiting hepatic steatosis to alleviate non-alcoholic fatty liver disease; ④ Having a strong inhibitory effect on the viral replication of SARS-CoV-2, which causes pneumonia caused by the new coronavirus; ⑤ Demonstrating unique advantages in the prevention and treatment of diseases such as autism, osteoporosis, and diabetes.
[0003] radish( Raphanus sativus Raphanus sativus L. is an annual or biennial root vegetable of the genus Raphanus in the family Cruciferae. Its fleshy roots are edible and possess high nutritional and medicinal value. Glucosinolates, as important functional components and a source of flavor, are a key quality trait of radish. Current research reports that GRA levels are high in broccoli, while relatively low in other cruciferous vegetables, such as radish. Therefore, increasing GRA content in radish is crucial for improving radish quality and developing functional foods.
[0004] 2OGD superfamily members have been widely reported to participate in a variety of important secondary metabolic pathways in different developmental stages of plants. The family is mainly divided into three subclasses: DOXA, DOXB, and DOXC. Among them, DOXC subclass members have been widely reported to participate in regulating the biosynthesis of glucosinolates in cruciferous plants. RsGRS1 The expression level of the gene is closely related to the GRA content. The gene belongs to the DOXC subfamily of the 2OGD family, which indicates that RsGRS1The gene may be involved in the biosynthesis of GRA in radish.
[0005] However, since radish is a recalcitrant crop with extremely low genetic transformation efficiency, there are no reports in the existing technology on the creation of radish high in beneficial glucosinolates GRA through biotechnology. Summary of the Invention
[0006] The present invention provides a method for cultivating radish with high beneficial glucosinolate 4-methylsulfinylbutyl glucosinolate (Glucoraphanin, GRA), which provides an effective method for radish germplasm creation and genetic improvement.
[0007] A method for increasing the content of beneficial glucosinolates in radish based on gene editing technology comprises the following steps:
[0008] (1) Constructing a RsGRS1 Host cell engineering bacteria for gene editing vectors;
[0009] (2) transfecting radish explants with host cell engineering bacteria, wherein the radish variety is 'NAU-RG' and the explants are rootless seedlings;
[0010] (3) Obtaining transgenic radish plants: bud induction, rooting induction, and acclimatization and transplanting;
[0011] (4) Radish rsgrs1 Detection of mutant materials: DNA and RNA extraction and reverse transcription, PCR detection and qRT-PCR analysis;
[0012] (5) Determination and analysis based on ultra-high performance liquid chromatography triple quadrupole tandem mass spectrometry rsgrs1 GRA content of mutant materials.
[0013] In step (1), use CRISPR-P website design RsGRS1 The two target sequences of the gene were synthesized together with the promoter and sgRNA sequences containing the two targets, and then inserted into the Ubi-CRISPR / Cas9-WPR vector (https: / / www.molecularcloud.org / plasmid / WIP-RUBY-cas9 / MC-0101503.html) preserved in our laboratory. RsGRS1 The gene editing vector was constructed and the correctly sequenced plasmid was transformed into the host cell Agrobacterium rhizogenes MSU440.
[0014] In step (2), the culture medium for activating Agrobacterium is: 20 g / L LB + 15 g / L agar + 100 mg / L kanamycin (Kan) + 100 mg / L streptomycin (Str).
[0015] In step (2), the culture medium for shaking the bacteria was: 20 g / L LB + 100 mg / L Kan + 100 mg / L Str; 1 / 2MS liquid medium was used, the OD600 value of the bacterial solution was adjusted to 1.0, 300 μmol / L acetosyringone (AS) was added to the bacterial solution, and the infection process was carried out in a shaking incubator at 28°C and 220 rpm.
[0016] In step (2), 'NAU-RG' rootless seedlings with a hypocotyl of about 0.5 cm were used as explants, immediately immersed in the suspension for infection for 15 min, then washed 3-5 times with sterile water and dried on sterile filter paper.
[0017] In step (2), the inoculated explants were transferred to MS medium for co-cultivation. Two days later, the explants were transferred to sterilized medium. The sterilized medium formula was: 4.71 g / L MS + 30 g / L sucrose + 8 g / L agar + 300 mg / L cefotaxime (Cef) + 200 mg / L timentin (Tim).
[0018] In step (3), after 30 days of sterilization, adventitious buds began to grow at the bottom of the rootless 'NAU-RG' seedlings. The adventitious buds were cut and transferred to the rooting induction medium for rooting culture. After 60-90 days, the adventitious buds began to root. The rooting induction medium formula is: 2.47 g / L 1 / 2 MS + 20 g / L sucrose + 8 g / L agar + 0.5 mg / L IBA + 300 mg / L Cef + 200 mg / L Tim.
[0019] In step (3), the rooted regenerated plants were moved to the environment to be acclimated. After 1 day, the tissue culture bottle cap was opened and placed in the artificial climate chamber for 3 days. After the regenerated plants were fully adapted to the environment, they were transplanted into moist substrate and covered with a seedling cover to allow them to grow slowly. After 3 days, the seedling cover was opened and the regenerated plants could grow normally in an environment with a light intensity of 12000 lx and a light period of 12 hours and a dark period of 12 hours.
[0020] In step (4), the CTAB method was used to extract DNA from the transgenic plants, and the extracted DNA was subjected to PCR amplification and product purification. The PCR amplification reaction system was as follows: a total volume of 10 μL, including 5 μL of Taq enzyme mix, 0.5 μL each of primer F (10 μM) and primer R (10 μM), 1 μL of template DNA (20 ng / μL), and 3 μL of ddH2O.
[0021] In step (4), the PCR amplification product was purified and sent to Nanjing Sipujin Biotechnology Co., Ltd. for sequencing. If overlapping peaks appeared at the target site, the recovered product was TA cloned using the pMD™19-T Vector Cloning Kit (Takara, Dalian). The reaction system was as follows: a total volume of 10 μL, including 0.4 μL of PMD19-T, 1.6 μL of ligase, and 2 μL of recovered product. The ligation was carried out at 16°C for 3 h. The ligation product was transformed into Escherichia coli competent DH5α. The positive clone solution was picked and sent to Nanjing Sipujin Biotechnology Co., Ltd. for sequencing.
[0022] In step (4), for 'NAU-RG' rsgrs1 RNA was extracted and reverse transcribed from leaves of the mutant material using the RNAsimple Total RNA Kit and Reverse Transcription Kit. The qRT-PCR reaction system was as follows: 15 μL of the system contained 7 μL of 2×SYBR Green reaction mix, 0.56 μL each of primers F (10 μM) and R (10 μM), cDNA (20 ng / μL), and 3 μL of ddH2O.
[0023] In step (5), 0.2 g of freeze-dried sample powder was weighed and transferred into a 10 mL centrifuge tube. After incubating at 75°C for 1 min, 5 mL of 80% methanol solution and 100 μL of 5 mM internal standard were added in sequence. The mixture was thoroughly vortexed and then incubated at 75°C for 10 min. The sample was taken out and cooled to room temperature. 1 mL of 0.4 M barium acetate was added and centrifuged at 4500 rpm for 10 min. The supernatant was transferred to a new centrifuge tube. 3 mL of 80% methanol solution was added to the remaining precipitate and the extraction was repeated twice. The supernatants were combined and the volume was adjusted to 10 mL with 80% methanol solution. Before injection, the extracted stock solution was diluted 10 times with ultrapure water, filtered through a 0.22 μM water filter membrane, and transferred to an injection bottle. It was stored at -20°C for later use.
[0024] In step (5), ultra-high performance liquid chromatography triple quadrupole tandem mass spectrometry is used to analyze the glucosinolate components and their contents. 2-propenyl glucosinolate (SIN) is used as the internal standard, and the contents of the glucosinolate components are calculated based on their retention time and peak area. [target GSLs] (μmol / g DW) = (Area [target GSLs] / Area [SIN] ) × Amount [SIN] (μmol) / m [sample quality] (g). Amount [target GSLs] is the target glucosinolate content (μmol / g DW); Area [target GSLs] is the target glucosinolate peak area; Area [SIN] is the internal standard peak area; Amount [SIN] is the internal standard content (μmol); m is the sample mass (g).
[0025] Beneficial results of the present invention
[0026] The present invention is first designed RsGRS1 The two target sequences of the gene were synthesized together with the promoter and sgRNA sequence containing the two targets, and then inserted into the Ubi-CRISPR / Cas9-WPR vector preserved in our laboratory to obtain RsGRS1 The gene editing vector was transferred into the host cell engineering bacteria and then transfected into the radish 'NAU-RG' rootless seedling explants, and finally the 'NAU-RG' was obtained. rsgrs1 Mutant plants. Through the determination and analysis of glucosinolate content, it was found that rsgrs1 The content of beneficial glucosinolate GRA in the leaves of the mutant plants was 39.66-46.38 times higher than that of the wild type, providing a new method for the creation and genetic improvement of radish germplasm with high beneficial glucosinolate GRA. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] Attachment Figure 1 The radish in Experimental Example 1 RsGRS1 Gene editing vector structure.
[0028] Attachment Figure 2 The sgRNA synthesized in Experimental Example 1 includes two 20 bp oligonucleotide target sites (yellow fill) and a conserved structural sequence (underlined), as well as the corresponding promoter sequence, AtU6-26 before the first target site and AtU6-29 before the second target site (green fill).
[0029] Attachment Figure 3 The wild type radish and rsgrs1 Sequencing results of target site 1 in mutants (A: in wild-type radish) RsGRS1Target site 1 sequencing peak diagram; B: 3 mutant radish lines RsGRS1 Target site 1 sequencing peak diagram).
[0030] Attachment Figure 4 For the radish in Experimental Example 4 rsgrs1 Mutation analysis of mutant lines.
[0031] Attachment Figure 5 The wild type and Phenotypes of mutant lines (A: front view; B: top view).
[0032] Attachment The wild type and In mutants Gene expression analysis.
[0033] Attachment The wild type and GRA chromatograms in mutants.
[0034] Attachment The wild type and GRA content in mutants. DETAILED DESCRIPTION
[0035] The technical solutions of the present invention will be clearly and completely described below in conjunction with specific embodiments. The described embodiments are only used to explain the present invention but not to limit the present invention.
[0036] Experimental Example 1 Construction of a radish-containing Host cell engineering bacteria for gene editing vectors
[0037] The nucleotide sequence of the gene is shown in SEQ ID NO. 1. Using the CRISPR-P website, according to The nucleotide sequence of the gene was designed with two target sequences on its first exon. The nucleotide sequences of the target sequences are shown in SEQ ID NO.2 (AATGGGCGTAAAAGCCCTGG) and SEQ ID NO.3 (AGGAGTGAGCCTGCACTACA). Then, the AtU6-26 promoter and the AtU6-29 promoter were synthesized together with the sgRNA sequence AtU6-26-sgRNA1-AtU6-29-sgRNA2 containing the two target sequences (as shown in SEQ ID NO.4). The specific operation of the above method is that Nanjing GenScript Company synthesizes the sgRNA and its corresponding promoter fragment, and inserts them into the Ubi-CRISPR / Cas9-WPR vector stored in this laboratory, and finally obtains The gene editing vector was sent to Qingke Company for sequencing confirmation. The gene editing vector was transfected into the host cell Agrobacterium rhizogenes MSU440 to obtain the host cell engineered bacteria.
[0038] Experimental Example 2: Transfection of radish 'NAU-RG' rootless seedling explants with the host engineered bacteria.
[0039] 1. Obtaining sterile radish seedlings
[0040] (1) Select 'NAU-RG' radish seeds of uniform size and sterilize them in a clean bench.
[0041] (2) Disinfect with 75% alcohol for 1.5 minutes, 8% sodium hypochlorite for 10 minutes, and rinse with sterile water three times.
[0042] (3) Place the sterilized seeds on sterile filter paper to dry, and use sterilized tweezers to inoculate the seeds onto MS solid culture medium. Culture at 25°C and a light intensity of 16 h / d for 6-7 days to obtain sterile seedlings.
[0043] 2. Preparation of Agrobacterium tumefaciens
[0044] (1) Take the product stored in -80℃ refrigerator In a clean bench, pipette 20 μL of Agrobacterium rhizogenes culture containing the gene editing vector and streak it onto a solid medium containing LB + 100 mg / L Kan (kanamycin) + 100 mg / L Str (streptomycin). After the culture solution is air-dried, seal the plate and invert it in a 28°C incubator for 2 days.
[0045] (2) Scrape the activated bacterial mass and transfer it into liquid culture medium containing LB + 100 mg / L Kan (kanamycin) + 100 mg / L Str (streptomycin) and culture in a shaking incubator at 28°C and 220 rpm for 8-12 h.
[0046] (3) Centrifuge the bacterial solution at 11200 rpm for 5 min, remove the supernatant, and resuspend the Agrobacterium in 1 / 2 MS to adjust the OD 600 The value is 1.0. Add 300 μmol / L AS and mix well to obtain the infection solution.
[0047] 3. Explant Preparation
[0048] Select the sterile seedlings of 'NAU-RG' with good growth, cut the roots of the sterile seedlings in the clean bench, and obtain the rootless seedling explants.
[0049] 4. Agrobacterium infection
[0050] Immerse the explants in the bacterial solution and infect them for 10 minutes in a shaker at 220 rpm at 28°C. After infection, rinse the explants 3-4 times with sterile water in a clean bench and place them on sterile filter paper to dry.
[0051] 5. Co-culture and degerming
[0052] The dried explants were inoculated on MS medium and co-cultured in the dark for 2 days. After co-culture, the explants were transferred to MS medium supplemented with 300 mg / L Cef and 200 mg / L Tim for sterilization.
[0053] Experimental Example 3 Obtaining transgenic radish plants
[0054] After 30 days of sterilization, adventitious buds began to grow at the bottom of the rootless radish 'NAU-RG' seedlings. The adventitious buds were cut off and transferred to rooting induction medium (1 / 2 MS + 20 g / L sucrose + 8 g / L agar + 0.5 mg / L IBA + 300 mg / L Cef + 200 mg / L Tim). After 60-90 days, the bottom of the adventitious buds began to take root.
[0055] Move the rooted regenerated plants to the environment they will be acclimated to. After 1 day, open the tissue culture bottle cap and place them in the artificial climate chamber for 3 days. Once the regenerated plants have fully adapted to the environment, move them to moist substrate and cover them with a seedling cover to allow them to grow. After 3 days, open the seedling cover and the regenerated plants will grow normally in an environment with a light intensity of 12,000 lx and a 12-hour light / 12-hour dark cycle.
[0056] Experimental Example 4: Radish Detection of mutant materials
[0057] DNA was extracted from the transgenic radish plants obtained in Experimental Example 3 using the CTAB method, and the extracted DNA was further amplified by PCR and the product was purified. The PCR reaction system for DNA detection was as follows: a total volume of 10 μL, including 5 μL of Taq enzyme mix, 0.5 μL each of primer F (10 μM) and primer R (10 μM), 1 μL of template DNA (20 ng / μL), and 3 μL of ddH2O; the Cas9 primer was used to detect whether the exogenous Cas9 gene was successfully integrated into the radish genome, and the Cas9 primer was used to detect whether the exogenous Cas9 gene was successfully integrated into the radish genome. -Cas9 primers were used to amplify the Cas9 gene in radish positive plants. Fragment. The primers are:
[0058] Cas9-F (primer F): GACAAGAAGTACTCCATCGG
[0059] Cas9-R (primer R): CTCGATCTTCTTGAAGTAGT
[0060] -Cas9-F (primer F): ATAGGAAGTAAGACAAGTAT
[0061] -Cas9-R (primer R): CGAAGCCTTCAAGCATCCT
[0062] The purified product was sent to Nanjing Sipujin Biotechnology Co., Ltd. for sequencing. SnapGene and DNAMAN software were used to analyze the sequencing results and target sites. If overlapping peaks occurred at the target site, the recovered product was TA-cloned using the pMD™19-T Vector Cloning Kit (Takara, Dalian). The reaction system was as follows: a total volume of 10 μL, including 0.4 μL of pMD19-T, 1.6 μL of ligase, and 2 μL of recovered product. Ligation was performed at 16°C for 3 h. The ligation product was then transformed into competent Escherichia coli DH5α. Positive clones were selected and sent to Nanjing Sipujin Biotechnology Co., Ltd. for sequencing.
[0063] The wild type and RNA was extracted and reverse transcribed from leaves of the mutant material using the RNAsimple Total RNA Kit and Reverse Transcription Kit. The qRT-PCR reaction system was as follows: 15 μL of the system contained 7 μL of 2×SYBR green reaction mix, 0.56 μL each of primers F (10 μM) and R (10 μM), cDNA (20 ng / μL), and 3 μL of ddH2O. The primers were:
[0064] -qPCR-F (primer F): ATTTGATGACGCGGCGGA
[0065] -qPCR-R (primer R): TCTTGCGCGTGAAACCGA
[0066] The sequencing results showed that the radish In the mutant plants, 59# deleted 7 and 8 bases at target site 1 (protein translation terminated prematurely), 64# deleted 5 and 8 bases at target site 1 (protein translation terminated prematurely), and 79# deleted 1 and 5 bases at target site 1 (protein translation terminated prematurely). RT-qPCR results showed that in the mutant plants The expression level was significantly downregulated compared with the wild type.
[0067] Experimental Example 5: Radish Determination of glucosinolate content in mutant materials
[0068] right Leaves from mutant plants were freeze-dried in a freeze dryer. After drying, 0.2 g of freeze-dried sample powder was accurately weighed and transferred to a 10 mL centrifuge tube. After incubation at 75°C for 1 min, 5 mL of 80% methanol and 100 μL of 5 mM internal standard were added, followed by thorough vortex mixing and then incubation at 75°C for 10 min. The tube was removed and cooled to room temperature, and 1 mL of 0.4 M barium acetate was added. The tube was centrifuged at 4500 rpm for 10 min. The supernatant was transferred to a new centrifuge tube. The remaining pellet was extracted twice with 3 mL of 80% methanol. The supernatants were combined and the volume was adjusted to 10 mL with 80% methanol. Prior to injection, the extract was diluted 10-fold with ultrapure water, filtered through a 0.22 μM water filter, transferred to a sample vial, and stored at -20°C until use.
[0069] Ultra-performance liquid chromatography triple quadrupole tandem mass spectrometry (UPLC-QqQ-MS / MS) was used to analyze the glucosinolate components and their contents. 2-Propylene glucosinolate (SIN) was used as the internal standard, and the contents of the glucosinolate components were calculated based on their retention times and peak areas. [target GSLs] (μmol / g DW) = (Area [target GSLs] / Area [SIN] ) × Amount [SIN] (μmol) / m [sample quality] (g). Amount [target GSLs] is the target glucosinolate content (μmol / g DW); Area [target GSLs] is the target glucosinolate peak area; Area [SIN] is the internal standard peak area; Amount [SIN] is the internal standard content (μmol); m is the sample mass (g).
[0070] According to the results of glucosinolate content determination, the GRA content in wild-type radish leaves was 0.058 μmol / g DW, while The GRA content in the leaves of the mutant material was 2.27~2.65 μmol / g DW, which was 39.66-46.38 times that of the wild-type plant. Gene mutation can promote the biosynthesis of beneficial glucosinolate GRA in radish.
[0071] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention are intended to be within the scope of protection of the present invention.
Claims
1. A method for increasing the content of beneficial glucosinolates in radish based on gene editing technology, characterized in that: The following steps are involved: (1) Constructing a RsGRS1 Host cell engineering bacteria for gene editing vectors; (2) transfecting radish explants with host cell engineering bacteria, wherein the radish variety is 'NAU-RG' and the explants are rootless seedlings; (3) Obtaining transgenic radish plants: bud induction, rooting induction, and acclimatization and transplanting; (4) Radish rsgrs1 Detection of mutant materials: DNA and RNA extraction and reverse transcription, PCR detection and qRT-PCR analysis; (5) Determination and analysis based on ultra-high performance liquid chromatography triple quadrupole tandem mass spectrometry rsgrs1 GRA content of mutant materials.
2. The method for increasing the content of beneficial glucosinolates in radish based on gene editing technology according to claim 1, characterized in that: In step (1), RsGRS1 The nucleotide sequence of the gene is shown in SEQ ID NO. 1 and was designed using the CRISPR-P website. RsGRS1 The two target sequences of the gene, the nucleotide sequences are shown in SEQ ID NO. 2 (AATGGGCGTAAAAGCCCTGG) and SEQ ID NO. 3 (AGGAGTGAGCCTGCACTACA), and then the promoter together with the sgRNA sequence containing the two target sites were synthesized (as shown in SEQ ID NO. 4) and inserted into the Ubi-CRISPR / Cas9-WPR vector preserved in our laboratory (https: / / www.molecularcloud.org / plasmid / WIP-RUBY-cas9 / MC-0101503.html), to obtain RsGRS1 Gene editing vector; The specific operation of the above method is to synthesize sgRNA and its corresponding promoter fragment at Nanjing GenScript Company, and insert it into the Ubi-CRISPR / Cas9-WPR vector, and finally obtain RsGRS1 The gene editing vector is sent to Qingke Company for sequencing confirmation; the constructed sequencing-correct plasmid is transferred into the host cell engineering bacteria.
3. The method for increasing the content of beneficial glucosinolates in radish based on gene editing technology according to claim 1, characterized in that: In step (2), the Agrobacterium rhizogenes containing the target gene was stored in a -80℃ refrigerator. The culture medium for activating Agrobacterium was: 20 g / L LB+15 g / L agar+100 mg / L kanamycin (Kan)+100 mg / L streptomycin sulfate (Str); the culture medium for shaking the bacteria was: 20 g / L LB+100 mg / L Kan+100 mg / L Str; when preparing the infection solution, 1 / 2MS liquid medium was used, and the OD value of the culture solution was 0. 600 The value was adjusted to 1.0, 300 μmol / L acetosyringone (AS) was added to the bacterial liquid, and the infection process was carried out in a shaking incubator at 28°C and 220 rpm; the composition of the 1 / 2MS liquid culture medium was 4.74 g / L 1 / 2MS + 30 g / L sucrose.
4. The method for increasing the content of beneficial glucosinolates in radish based on gene editing technology according to claim 1, characterized in that: In step (2), 'NAU-RG' radish seeds of uniform size were selected and sterilized in a clean bench using 75% alcohol for 1.5 min and 8% sodium hypochlorite for 10 min, followed by rinsing with sterile water three times; the MS culture medium formula was 4.74 g / L MS + 8 g / L agar + 30 g / L sucrose; the sterile seedlings were cultured at 25°C with a light duration of 16 h / d.
5. The method for increasing the content of beneficial glucosinolates in radish based on gene editing technology according to claim 1, characterized in that: In step (2), 'NAU-RG' sterile seedlings with an age of 6-7 days and good growth were selected, and the roots of the sterile seedlings were cut off in a clean bench to obtain rootless seedling explants containing a hypocotyl of about 0.5 cm. The explants were immediately immersed in the infection solution for 15 minutes, then washed with sterile water 3-5 times and dried on sterile filter paper; the inoculated explants were transferred to MS medium for co-cultivation, and after 2 days, the explants were transferred to sterile medium for bud induction. The sterile medium formula was 4.71g / L MS + 30g / L sucrose + 8g / L agar + 300mg / L cefotaxime (Cef) + 200mg / L timentin (Tim) 6. The method for increasing the content of beneficial glucosinolates in radish based on gene editing technology according to claim 1, characterized in that: In step (3), after 30 days of sterilization culture, adventitious buds began to grow at the bottom of the rootless seedlings of 'NAU-RG'. The adventitious buds were cut off and transferred to root induction medium (2.47 g / L 1 / 2 MS + 20 g / L sucrose + 8 g / L agar + 0.5 mg / L IBA + 300 mg / L Cef + 200 mg / L Tim) for rooting culture. After 60-90 days, the bottom of the adventitious buds began to take root. The rooted regenerated plants were moved to the environment to be acclimated. After 1 day, the tissue culture bottle cap was opened and placed in an artificial climate chamber for 3 days. After the regenerated plants were fully adapted to the environment, they were moved to a moist substrate and covered with a seedling cover for acclimatization. After 3 days, the seedling cover was opened and the regenerated plants could grow normally in an environment with a light intensity of 12000 lx and 12 h light / 12 h dark.
7. The method for increasing the content of beneficial glucosinolates in radish based on gene editing technology according to claim 1, characterized in that: In step (4), the CTAB method was used to extract DNA from the transgenic radish plants, and the extracted DNA was further subjected to PCR amplification and product purification. The PCR reaction system for DNA detection was as follows: the total volume was 10 μL, including 5 μL of Taq enzyme Mix, 0.5 μL each of primer F (10 μM) and primer R (10 μM), 1 μL of template DNA (20 ng / μL), and 3 μL of ddH2O. The Cas9 primer was used to detect whether the exogenous Cas9 gene had been successfully integrated into the radish genome, and RsGRS1 -Cas9 primers were used to amplify the Cas9 gene in radish positive plants. RsGRS1 Fragment, primers are: Cas9-F:GACAAGAAGTACTCCATCGG; Cas9-R: CTCGATCTTCTTGAAGTAGT; RsGRS1 -Cas9-F:ATAGGAAGTAAGACAAGTAT; RsGRS1 -Cas9-R:CGAAGCCCTTCAAGCATCCT。 8. The method for increasing the content of beneficial glucosinolates in radish based on gene editing technology according to claim 1, characterized in that: In step (4), the PCR amplification product was purified and sent to Nanjing Sipujin Biotechnology Co., Ltd. for sequencing; if overlapping peaks appeared at the target site, the recovered product was TA cloned using the pMD™19-T Vector Cloning Kit (Takara, Dalian). The reaction system was as follows: the total volume was 10 μL, including 0.4 μL of PMD19-T, 1.6 μL of ligase, and 2 μL of recovered product. The ligation was carried out at 16°C for 3 h, and the ligation product was transformed into Escherichia coli competent DH5α. The positive clone solution was picked and sent to Nanjing Sipujin Biotechnology Co., Ltd. for sequencing; the obtained radish rsgrs1 RNA was extracted and reverse transcribed from leaves of mutant plants using the RNAsimple Total RNA Kit and Reverse Transcription Kit. The qRT-PCR reaction system was as follows: 15 μL of the system contained 7 μL of 2×SYBR green reaction mix, 0.56 μL each of primer F (10 μM) and primer R (10 μM), cDNA (20 ng / μL), and 3 μL of ddH2O. The primers were: RsGRS1 -qPCR-F (primer F): ATTTGATGACGCGGCGGA; RsGRS1 -qPCR-R (primer R): TCTTGCGCGTGAAACCGA.
9. The method for increasing the content of beneficial glucosinolates in radish based on gene editing technology according to claim 1, characterized in that: In step (5), the wild type radish 'NAU-RG' and rsgrs1 Leaves of the mutant plants were sampled and quickly placed in liquid nitrogen. They were then freeze-dried in a low-temperature freeze dryer (Shanghai Yetuo Technology Co., Ltd.) for 48 h. 0.2 g of freeze-dried sample powder was accurately weighed and transferred to a 10 mL centrifuge tube. After incubation at 75°C for 1 min, 5 mL of 80% methanol solution and 100 μL of 5 mM internal standard were added in sequence. The mixture was thoroughly vortexed and mixed again in a 75°C water bath for 10 min. The tube was taken out and cooled to room temperature. 1 mL of 0.4 M barium acetate was added and centrifuged at 4500 rpm for 10 min. The supernatant was transferred to a new centrifuge tube. 3 mL of 80% methanol solution was added to the remaining precipitate and the extraction was repeated twice. The supernatants were combined and the volume was adjusted to 10 mL with 80% methanol solution. Before injection, the extract was diluted 10 times with ultrapure water, filtered through a 0.22 μM water filter membrane, and transferred to an injection bottle.
10. The method for increasing the content of beneficial glucosinolates in radish based on gene editing technology according to claim 1, characterized in that: Step (5) Analyze the glucosinolate components and contents using ultra-performance liquid chromatography triple quadrupole tandem mass spectrometry (UPLC-QqQ-MS / MS) technology; use 2-propenyl glucosinolate (SIN) as the internal standard and calculate the content of the glucosinolate components based on their retention time and peak area: Amount [target GSLs] (μmol / g DW) = (Area [target GSLs] / Area [SIN] ) × Amount [SIN] (μmol) / m [sample quality] (g), where Amount [target GSLs] is the target glucosinolate content (μmol / g DW); Area [target GSLs] is the target glucosinolate peak area; Area [SIN] is the internal standard peak area; Amount [SIN] is the internal standard content (μmol); m is the sample mass (g); DW is the dry weight of the sample.