A combination and method of synthesizing cap2-structured 5'-capped rnas
By combining a tetranucleotide cap analog with the T7 RNA polymerase promoter sequence to initiate transcription, the problems of low Cap2 capping rate and high cost have been solved, achieving efficient and economical Cap2 mRNA synthesis and improving the safety and application potential of mRNA.
Patent Information
- Application Number
- CN202411750439.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-29
- Publication Date
- 2026-04-10
- Estimated Expiration
- 2044-11-29
AI Technical Summary
Existing technologies lack low-cost and efficient Cap2 capping methods. The low Cap2 capping rate, complex preparation, and high cost limit the advancement of Cap2 mRNA in basic research and application development.
By combining a tetranucleotide cap analog with the promoter sequence of T7 RNA polymerase, highly efficient Cap2 5'-capped RNA is generated through in vitro transcription, and RNA synthesis is carried out using a transcription initiation combination containing a tetranucleotide cap analog.
This method enables the efficient synthesis of Cap2-capped RNA, improving the capping rate, reducing production costs, and enhancing the safety and efficacy of mRNA.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biochemistry and genetic engineering, and relates to a tetranucleotide cap analog, a transcription initiation combination containing the same and application thereof, and relates to a method for preparing 5'-capped RNA by using a combination of a tetranucleotide cap analog and a transcription initiation sequence, in particular, in vitro transcription by using a combination of a specific tetranucleotide cap structure analog and a T7 promoter sequence. BACKGROUND
[0002] The cap structure is an important element at the 5' end of mRNA and is a decisive factor for RNA fate, and its function runs through the entire life cycle of the mRNA molecule, including mRNA molecule maturation, coding region translation regulation and resistance to host exonuclease degradation. According to the number of 2'-hydroxymethylation of the +1 / +2 nucleotides at the 5'-end of mRNA, the cap structure without 2'-hydroxymethyl is Cap0, and the cap structures with 1 or 2 hydroxymethyl are Cap1 and Cap2, respectively, which are also the common capping forms in living cells. The development and establishment of the capping method of Cap1 provide an important guarantee for mRNA basic research and application development, and the development of new crown mRNA vaccine also takes Cap1 as the capping endpoint. The latest literature reports that Cap2 mRNA also has high abundance and low immunogenicity in cells, indicating that Cap2 mRNA also has important biological significance. However, the existing capping strategy of Cap2 has the disadvantages of low capping rate, complex preparation and high cost, which seriously restricts the mRNA basic research and application development taking Cap2 as the core.
[0003] There are two ways of enzyme capping and co-transcription capping for in vitro preparation of mRNA. The enzyme capping adopts the capping system of the vaccinia virus vaccine, which needs two-step enzyme reaction, and the introduction of additional enzymes and SAM, making the production process cumbersome. The co-transcription capping method has high stability, low cost and is easy to mass-produce, and is the mainstream capping technology of mRNA therapy. The main raw materials of the co-transcription capping method include cap structure analogs, T7 RNA polymerase and DNA template containing T7 promoter sequence . T7 RNA polymerase is a key enzyme for synthesizing long-chain RNA and has high specificity for T7 promoter. The commonly used T7 promoter mainly includes two types of Φ6.5 (-1~+3 is AGGG) and Φ2.5 (-1~+3 is TAGG), and the Φ6.5 type promoter is more efficient and is more widely used, and the mRNA 5' end of the Φ2.5 type promoter has better uniformity . The initiation of T7 RNAP transcription depends on the sequence of the T7 promoter, and the -1, +1 and +2 sequences of the promoter play an important role.
[0004] The development of cap analogs in the co-transcriptional capping scheme has gone through three iterations of mCap, ARCA, and CleanCap, with increasing capping rates, but there is still competition between nucleotides and cap analogs during the initiation of T7 RNAP transcription. The uncapped 5' ppp-RNA by-product produced during in vitro transcription not only loses the ability to translate, but the triphosphate group at its 5' end is a key molecule that activates innate immune receptors such as RIG-I and MDA5, which can induce significant immune responses, reducing the safety and effectiveness of mRNA Therefore, the capping rate of mRNA is one of the key indicators of the quality of mRNA molecule production, and improving the capping rate of mRNA is particularly important for mRNA therapy.
[0005] The efficient acquisition of Cap2-capped RNA is still a shortcoming that restricts its basic research and application development. TriLink uses oligonucleotide cap analogs to cap RNA (patent publication number: CN116751827B). The results of the cap analogs used for capping efficiency: A) m7G3' OmepppG = 79%; B) m7GpppG2' OmepG = 89%; C) m7G3' OmepppG2' OmepG = 87%; D) m7GpppA2' OmepG = 99%; E) m7G3' OmepppA2' OmepG = 99%; F) m7GpppC2' OmepG = 98%; G) m7G3' OmepppC2' OmepG = 97%; H) m7GpppA2' OmepG2' OmepG = 50%. A-G) are the Cap1 cap analogs tested by Trilink, and H) is the capping rate result of Cap2 cap analogs. The results show that combinations (D-G) obtain higher Cap1 capping rates, while the test combination (H) only obtains a Cap2 capping rate of 50%. SUMMARY
[0006] The technical problem to be solved by the present application is that the prior art lacks a low-cost and efficient Cap2 capping method, and a combination and method for synthesizing Cap2 structure 5'-capped RNA are provided. The combination uses a transcription initiation combination containing a tetranucleotide cap analog, which can be used for in vitro transcription of 5'-capped RNA.
[0007] The present application solves the above technical problems by the following technical solutions.
[0008] The tetranucleotide cap analog of the present application is as follows:
[0009] The first aspect of the present application provides a transcription initiation combination for synthesizing 5'-cap analog RNA, the transcription initiation combination comprising a tetranucleotide cap analog and a DNA template;
[0010] The tetranucleotide cap analog has a structure as shown in formula (I):
[0011]
[0012] Formula (I);
[0013] B1, B2 and B3 are independently natural, modified or unnatural nucleotide bases; R1, R2 are independently H, OH, CH3, O-CH3, O-CH2CH3, NH2, alkyne or azido group and derivatives thereof.
[0014] The DNA template comprises a promoter sequence of T7 RNA polymerase, and the promoter sequence-1, +1, +2 and +3 are natural or unnatural deoxynucleotides; one or more nucleotides in the tetranucleotide cap analog are complementary to the DNA template-1, +1, +2 and +3.
[0015] In some embodiments, B1, B2 and B3 are independently natural, modified or unnatural nucleotide bases; R1, R2 are independently OH or O-CH3.
[0016] In some embodiments, the DNA template comprises a promoter sequence of T7 RNA polymerase, as shown in formula (II); one or more nucleotides in the tetranucleotide cap analog are complementary to the DNA template-1, +1, +2 and +3.
[0017]
[0018] Formula (II);
[0019] Y is a natural deoxynucleotide, X is a natural deoxynucleotide, and X and Y are complementary.
[0020] In the present application, the sequence of the promoter upper strand is shown as SEQ ID NO: 9, and the sequence of the promoter lower strand is shown as SEQ ID NO: 10.
[0021] In some embodiments, B1, B2 and B3 in the tetranucleotide cap analog are respectively complementary to the nucleotide bases of +1, +2 and +3 of the promoter sequence in the DNA template; or, B2 and B3 in the tetranucleotide cap analog are respectively complementary to the nucleotide bases of +1 and +2 of the promoter sequence in the DNA template; or, B3 in the tetranucleotide cap analog is complementary to the nucleotide base of +1 of the promoter sequence in the DNA template.
[0022] In some embodiments, R1 is O-CH3 or OH, and R2 is O-CH3 or OH in the tetranucleotide cap analog.
[0023] In some embodiments, in the tetranucleotide cap analog, B1, B2 and B3 are natural nucleobases.
[0024] In some embodiments, in the tetranucleotide cap analog, B1, B2 and B3 are independently adenine, guanine, uracil or cytosine.
[0025] In some embodiments, in the tetranucleotide cap analog, B1, B2 and B3 are independently adenine or guanine.
[0026] In some embodiments, in the tetranucleotide cap analog, B1 is adenine, and B2 and B3 are guanine.
[0027] In some embodiments, in the tetranucleotide cap analog, B1 and B2 are adenine, and B3 is guanine.
[0028] In some embodiments, in the DNA template, the -1 position of the promoter sequence is adenine or thymine, and the +1, +2, +3 positions are natural bases.
[0029] In some embodiments, in the DNA template, the -1 position of the promoter sequence is adenine, the +1 and +2 positions are adenine, and the +3 position is guanine.
[0030] In some embodiments, in the DNA template, the -1 position of the promoter sequence is thymine, the +1 and +2 positions are adenine, and the +3 position is guanine.
[0031] In some embodiments, in the DNA template, the -1 position of the promoter sequence is adenine, the +1 position is adenine, and the +2, +3 positions are guanine.
[0032] In some embodiments, in the DNA template, the -1 position of the promoter sequence is thymine, the +1 position is adenine, and the +2, +3 positions are guanine.
[0033] In some embodiments, in the DNA template, the promoter sequence is as set forth in any one of SEQ ID NOs: 1-4.
[0034] A second aspect of the present application provides a kit comprising: a tetranucleotide cap analog and a RNA polymerase; the tetranucleotide cap analog is capable of forming a transcription initiation complex as described in the first aspect with a DNA template.
[0035] In some embodiments, the kit further comprises: NTPs, a buffer, and optionally divalent metal ions.
[0036] In some preferred embodiments, the divalent metal ion is a magnesium ion.
[0037] In some preferred embodiments, the buffer is Tris-HCl buffer.
[0038] In some preferred embodiments, the NTPs comprise GTP, ATP, CTP and UTP.
[0039] A third aspect of the present application provides a method for improving the stability of RNA, the method comprising:
[0040] incorporating a tetranucleotide cap analog into an RNA synthesis system; the tetranucleotide cap analog is capable of forming a transcription initiation complex as described in the first aspect with a DNA template;
[0041] or, reacting the kit as described in the second aspect with a DNA template.
[0042] In some embodiments, the RNA synthesis system is an in vitro synthesis system.
[0043] A fourth aspect of the present application provides a method for mRNA capping, the method comprising a transcription reaction using the transcription initiation complex as described in the first aspect in the presence of T7 RNA polymerase.
[0044] A fifth aspect of the present application provides use of the transcription initiation complex as described in the first aspect, or the kit as described in the second aspect, in the in vitro synthesis of RNA.
[0045] The present application also provides combinations of tetranucleotides and their analogs and T7 RNA polymerase promoter signature sequences, the combinations being selected from any one of the following groups:
[0046] Combination 1
[0047] m7 Gppp( 2'OMe A)p( 2'OMe A)pG
[0048] 5'-TAATACGACTCACTATAAAG (SEQ ID NO: 1)
[0049] 3'-ATTATGCTGAGTGATATTTC (SEQ ID NO: 5)
[0050] Combination 2
[0051] m7 Gppp( 2'OMe A)p( 2'OMe A)pG
[0052] 5'-TAATACGACTCACTATAAGG (SEQ ID NO: 2)
[0053] 3'-ATTATGCTGAGTGATATTCC (SEQ ID NO: 6)
[0054] Combination 3
[0055] m7 Gppp ( 2'OMe A)p( 2'OMe A)pG
[0056] 5'-TAATACGACTCACTATTAAG (SEQ ID NO: 3)
[0057] 3'-ATTATGCTGAGTGATAATTC (SEQ ID NO: 7)
[0058] Combination 4
[0059] m7 Gppp ( 2'OMe A)p( 2'OMe A)pG
[0060] 5'-TAATACGACTCACTATTAGG (SEQ ID NO: 4)
[0061] 3'-ATTATGCTGAGTGATAATCC (SEQ ID NO: 8)
[0062] Based on common knowledge in the field, the above-mentioned preferred conditions can be combined arbitrarily to obtain various preferred embodiments of the present invention.
[0063] The reagents and raw materials used in this invention are all commercially available.
[0064] The positive and progressive effects of this invention are as follows:
[0065] The tetranucleotide cap analogue of the present invention can be used for Cap2 capping, and the transcription initiation combination formed with the T7 promoter in the DNA template can efficiently and economically cap RNA, such as RNA in an in vitro synthesis system. Attached Figure Description
[0066] Figure 1 This is a schematic diagram of the tetranucleotide cap structure and promoter combination of this application.
[0067] Figure 2 for m7 Gppp ( 2'OMe A)p( 2'OMe A) pG and m7 Gppp (2'OMe A)pG 2'OMe G)pG and different T7 promoter combinations for in vitro transcription of capped mRNA.
[0068] Figure 3 To m7 Gppp(A)pG and 2'OMe A)pG and m7 Gppp(A)pG and 2'OMe A)pG and 2'OMe A)pG and DETAILED DESCRIPTION
[0069] DEFINITIONS
[0070] As used herein, the terms "nucleic acid," "nucleotide sequence," or "nucleic acid sequence" refer to an oligonucleotide, polynucleotide, or any fragment thereof, any ribose or deoxyribose derivative, and to naturally occurring or synthetic molecules containing natural and / or modified nucleotide residues and internucleotide linkages. These phrases also refer to DNA or RNA of either natural (e.g., genomic) or synthetic origin which can be single-stranded, double-stranded, triple-stranded, or four-stranded and which can represent the sense or anti-sense strand, or to any DNA-like or RNA-like material. With reference to a DNA sequence, an "RNA equivalent" consists of the same linear sequence of nucleotides as the reference DNA sequence except that all or almost all of the thymine bases are replaced with uracil and the sugar backbone consists of ribose instead of 2'-deoxyribose. Additional alternative nucleic acid backbones suitable for the methods and compositions provided herein include, but are not limited to, phosphorothioate, phosphoroselenoate, alkylphosphotriester, arylphosphotriester, alkylphosphonate, aryphosphonate, phosphoboronate, morpholino nucleic acid (MNA), locked nucleic acid (LNA), peptide nucleic acid (PNA).
[0071] As used herein, the term "primer" or "oligonucleotide primer" refers to a ribo- or deoxyribo- or chimeric ribo / deoxyribo-oligonucleotide, single-stranded, which can be naturally occurring or synthetic, and often includes a sequence of between about 2 and about 10 nucleotides, about 3 to about 8 nucleotides, or about 3 to about 5 nucleotides. The oligonucleotide primer can contain one or more modifying groups. The oligonucleotide primer can include RNA, DNA, and / or other modified nucleosides. The skilled artisan is capable of designing and preparing oligonucleotide primers suitable for transcribing a DNA template sequence.
[0072] As used herein, the term "tetranucleotide cap analog" is used interchangeably with "initiating capping oligonucleotide tetramer primer" to refer to a tetranucleotide capping primer composed of natural or non-natural nucleotides containing a N7 position methylation modification of guanosine or any nucleoside analog on the 5'-end. The tetranucleotide cap analog is a substrate for RNA polymerase, has an unmodified or open 3'-OH group, and it can be extended by RNA polymerase by incorporating NTPs onto the 3' end of the primer. It is capable of initiating in vitro transcription under the control of a promoter in a transcription system containing the necessary components (DNA template (e.g., DNA plasmid), RNA polymerase, nucleoside 5'-triphosphates, and appropriate buffers).
[0073] As used herein, the term "unsubstituted" or "unmodified" in the context of initiating capping oligonucleotide primers and NTPs refers to initiating capping oligonucleotide primers and NTPs that have not been modified.
[0074] As used herein, the term "modified initiating capping oligonucleotide primer" refers to an initiating capping oligonucleotide primer containing one or more additional modifying groups.
[0075] As used herein, the term "modifying group" refers to any chemical moiety that can be attached to an initiating primer at some position including, but not limited to, sugar, nucleobase, triphosphate bridge, and / or internucleotide phosphate. The modifying group of an initiating capping oligonucleotide primer can be any nature of group that is compatible with the process of transcription.
[0076] As used herein, the term "internucleotide linker" refers to one or more bonds that link two nucleosides of an oligonucleotide primer or nucleic acid and can be a natural phosphodiester linker or a modified linker.
[0077] As used herein, the term "label" or "detectable label" refers to any compound or combination of compounds that can be attached or otherwise associated with a molecule so that the molecule can be detected, either directly or indirectly, by detecting the label. A detectable label can be a radioisotope (e.g., carbon, phosphorus, iodine, indium, sulfur, tritium, etc.), a mass isotope (e.g., H2, C13, or N15), a dye or fluorophore (e.g., a cyanine, a fluorescein, or a coumarin), a hapten (e.g., biotin), or any other agent that can be detected, either directly or indirectly.
[0078] As used herein, the term "hybridization" or "specific hybridization" refers to the process of annealing a priming capped oligonucleotide primer to a DNA template under conditions of appropriate stringency during a transcription reaction. Hybridization to DNA is by the priming capped oligonucleotide primer, which in certain embodiments is 3-10 nucleotides in length, including a 5'-5' inverted cap structure. Nucleic acid hybridization techniques are well known in the art.
[0079] As used herein, in the context of a complex of a priming capped oligonucleotide primer and a DNA template, the term "complementary," "complement," or "complementarity" refers to the standard Watson / Crick base pairing rules. For example, the sequence "5'-G-A-C-T-3'" is complementary to the sequence "3'-C-T-G-A-5'." Certain non-natural or synthetic nucleotides can be included in the nucleic acids described herein; these include, but are not limited to, base and sugar modified nucleosides, nucleotides, and nucleic acids such as inosine, 7-deazaguanosine, 2'-O-methyl guanosine, 2'-fluoro-2'-deoxycytidine, pseudouridine, locked nucleic acids (LNAs), and peptide nucleic acids (PNAs). Complementarity need not be perfect; a duplex can contain mismatched base pairs, degenerate or non-matching nucleotides. One of skill in the art can empirically consider a variety of variables to determine duplex stability, including, for example, the length of the oligonucleotide, the base composition and sequence of the oligonucleotide, the incidence of mismatched base pairs, ionic strength, the components of the hybridization buffer, and reaction conditions.
[0080] Complementarity can be "complete" or "total," where all of the nucleotide bases of two nucleic acid strands match according to the accepted base pairing rules, it can be "partial," where only some of the nucleotide bases of the priming capped oligonucleotide primer match the DNA target according to the accepted base pairing rules, or it can be "none," where no nucleotide bases of the two nucleic acid strands match according to the accepted base pairing rules. The degree of complementarity between a priming capped oligonucleotide primer and a DNA template can have a significant effect on the strength and corresponding efficiency of hybridization between the priming capped oligonucleotide and the DNA template. The term complementarity can also refer to individual nucleotide usage. For example, one can refer to the complementarity or lack thereof of one particular nucleotide within an oligonucleotide to a nucleotide within another strand (relative or as compared to the complementarity between the rest of the priming capped oligonucleotide primer and the DNA strand).
[0081] The term "complete," "total," or "perfect" complement, as used herein, means that every nucleotide base of the priming capped oligonucleotide primer exactly matches the DNA target according to the accepted base pairing rules.
[0082] As used herein, the term "substantially complementary" refers to two sequences that hybridize under stringent hybridization conditions. Those skilled in the art will appreciate that substantially complementary sequences need not hybridize along their entire length. Specifically, a substantially complementary sequence can contain contiguous base sequences that do not hybridize to the target sequence and can be positioned 3' or 5' to contiguous base sequences that do hybridize to the target sequence under stringent hybridization conditions.
[0083] As used herein, the term "specific" when used in reference to the starting capping oligonucleotide primer sequence and its ability to hybridize to a DNA template is a sequence that has at least 50% sequence identity to a portion of the DNA template when the starting capping oligonucleotide primer is aligned to the DNA strand. Higher levels of sequence identity that can be preferred include at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, and most preferably 100% sequence identity.
[0084] As used herein, the term "nucleoside" includes all naturally occurring nucleosides, including all forms of nucleobase and furanoside found in nature. The most commonly found base rings in naturally occurring nucleosides are purine rings and pyrimidine rings. Naturally occurring purine rings include, for example, adenine, guanine, and N6-methyladenine. Naturally occurring pyrimidine rings include, for example, cytosine, thymine, 5-methylcytosine, pseudouracyl. Naturally occurring nucleosides include, for example, but are not limited to, ribose, 2'-O-methyl, or 2'-deoxyribose derivatives of adenosine, guanosine, cytidine, thymidine, uridine, inosine, 7-methylguanosine, or pseudouridine.
[0085] As used herein, the terms "nucleoside analog," "modified nucleoside," or "nucleoside derivative" include synthetic nucleosides as described herein. Nucleoside derivatives also include nucleosides with modified base or / and sugar moieties with or without protecting groups, and include, for example, 2'-deoxy-2'-fluorouridine, 5-fluorouridine, and analogs. The compounds and methods provided herein include such base rings and synthetic analogs thereof, as well as non-natural heterocyclic substituted base sugars and acyclic substituted base sugars. Other nucleoside derivatives that can be used in the present application include, for example, LNA nucleosides, halogen substituted purines (e.g., 6-fluoropurine), halogen substituted pyrimidines, N6-ethyladenine, N4-(alkyl)-cytosine, 5-ethylcytosine, and analogs.
[0086] As used herein, the terms "universal base," "degenerate base," "universal base analog," and "degenerate base analog" include, for example, nucleoside analogs with artificial bases that can be recognized by RNA polymerase as a substitute for one of the natural NTPs (e.g., ATP, UTP, CTP, and GTP) or other specific NTPs in certain embodiments.
[0087] As used herein, the term "modified NTP" refers to a nucleoside 5'-triphosphate with a chemical moiety bound at any position, including the sugar, base, triphosphate chain, or any combination of the three positions.
[0088] As used herein, the term "modified oligonucleotide" includes, for example, oligonucleotides containing modified nucleosides, modified internucleotide linkages, or any combination of modified nucleosides and internucleotide linkages. Examples of internucleotide linkage modifications of oligonucleotides include phosphorothioate, phosphotriester, and methylphosphonate derivatives.
[0089] As used herein, the term "promoter" refers to a region of a dsDNA template that directs and controls the initiation of transcription of a particular DNA sequence (e.g., a gene). The promoter is located on the same strand of DNA and upstream (close to the 5' region of the sense strand) of the DNA sequence to be transcribed. The promoter is generally immediately adjacent to (or partially overlapping with) the DNA sequence to be transcribed. Nucleotide positions in the promoter are designated relative to the transcription start site at which transcription of the DNA begins (position +1). The initiating oligonucleotide primer is complementary to the start site of the promoter sequence (which is at position +1 and +2 in certain embodiments, and at positions +1, +2, and +3 in the case of a start tetraloop).
[0090] As used herein, the term "transcription" or "transcription reaction" refers to a method known in the art for enzymatically making RNA complementary to a DNA template to produce multiple RNA copies of the DNA sequence. The RNA molecules synthesized in the transcription reaction are referred to as "RNA transcripts," "primary transcripts," or "transcripts." The transcription reaction involving the compositions and methods provided herein employs a "starting capping oligonucleotide primer." Transcription of the DNA template can be exponential, non-linear, or linear. The DNA template can be double-stranded linear DNA, partially double-stranded linear DNA, circular double-stranded DNA, a DNA plasmid, a PCR amplicon, a modified nucleic acid template compatible with the RNA polymerase.
[0091] The application is further illustrated by the following examples, which are not intended to limit the application in any way. The experimental methods in the following examples, for which specific conditions are not noted, were selected according to conventional methods and conditions, or according to the instructions of the commercial suppliers.
[0092] Information on the instruments and reagents used in the examples is shown in Table 1.
[0093] Table 1. Instrument and Reagent Information
[0094]
[0095] Example 1
[0096] like Figure 1 The molecular formula of a tetranucleotide is shown below: m7 Gppp ( 2'OMe A)p( 2'OMe A)pG
[0097] The sequence of bits -17 to +3 of the T7 starter encoder chain:
[0098] 5'-TAATACGACTCACTATAAAG (SEQ ID NO: 1)
[0099] 3'-ATTATGCTGAGTGATATTTC (SEQ ID NO: 5)
[0100] A double-stranded DNA transcription template containing the Twister ribozyme sequence was obtained by PCR. The sequence at positions -17 to +3 of the template strand is 3'-ATTATGCTGAGTGATATTTC (SEQ ID NO: 5).
[0101] mRNA was prepared by in vitro transcription, and the reaction system is shown in Table 2.
[0102] Table 2 In vitro transcription reaction system
[0103]
[0104] After mixing, react at 37°C for 2 hours, then digest with DNase I for 30 minutes.
[0105] Analysis was performed by 18 (w / v)% polyacrylamide gel electrophoresis containing 8M urea and 1×TBE. The gel was stained with SybrGOLD and the capped and uncapped bands were analyzed by Image Lab.
[0106] Formula 1 for determining the capping rate: (Gray value of the capped RNA band) / [(Gray value of the capped RNA band) + (Gray value of the uncapped RNA band)]
[0107] The obtained mRNA was extracted with RNA extraction reagent and precipitated with isopropanol, and its concentration was determined.
[0108] Further capping rate analysis of the 5′ end short fragments released by Twister self-cleavage was performed using LC-MS.
[0109] Calculation formula 2 for determining the capping rate: (peak intensity of capped RNA) / [(peak intensity of capped RNA) + (peak intensity of uncapped RNA)]
[0110] The capping rate of mRNA prepared by in vitro transcription using the combination of the promoter sequence of -17 to +3 positions of TAATACGACTCACTATAAAG (SEQ ID NO: 1) and AAG Cap2 was about 99%.
[0111] Example 2
[0112] Molecular formula of tetranucleotide: m7 Gppp( 2'OMe A)p( 2'OMe A)pG
[0113] Sequence of -17 to +3 positions of the coding strand of the T7 promoter:
[0114] 5'-TAATACGACTCACTATTAAG (SEQ ID NO: 3)
[0115] 3'-ATTATGCTGAGTGATAATTC (SEQ ID NO: 7)
[0116] A double-stranded DNA transcription template containing the Twister ribozyme sequence was obtained by PCR. The sequence of -17 to +3 positions of the template strand was 3'-ATTATGCTGAGTGATAATTC (SEQ ID NO: 7).
[0117] Referring to the method of Example 1, the capping rate of mRNA prepared by in vitro transcription using the combination of the promoter sequence of -17 to +3 positions of TAATACGACTCACTATTAAG (SEQ ID NO: 3) and AAG Cap2 was 98%.
[0118] Example 3
[0119] Molecular formula of tetranucleotide: m7 Gppp( 2'OMe A)p( 2'OMe A)pG
[0120] Sequence of -17 to +3 positions of the coding strand of the T7 promoter:
[0121] 5'-TAATACGACTCACTATTAAG (SEQ ID NO: 3)
[0122] 3'-ATTATGCTGAGTGATAATTC (SEQ ID NO: 7)
[0123] A double-stranded DNA transcription template containing the Twister ribozyme sequence was obtained by PCR. The sequence of the template strand at positions -17~+3 is 3’-ATTATGCTGAGTGATAATTC (SEQ ID NO: 7).
[0124] The mRNA was prepared by in vitro transcription, and the capping rate of the mRNA prepared by in vitro transcription using the combination of the promoter sequence of TAATACGACTCACTATTAAG (SEQ ID NO: 3) at positions -17~+3 and AAG Cap2 was 92% according to the method of Example 1.
[0125] Example 4
[0126] Molecular formula of tetranucleotide: m7 Gppp( 2'OMe A)p( 2'OMe A)pG
[0127] The sequence of the coding strand of the T7 promoter at positions -17~+3 is:
[0128] 5’-TAATACGACTCACTATTAGG (SEQ ID NO: 4)
[0129] 3’-ATTATGCTGAGTGATAATCC (SEQ ID NO: 8)
[0130] A double-stranded DNA transcription template containing the Twister ribozyme sequence was obtained by PCR. The sequence of the template strand at positions -17~+3 is 3’-ATTATGCTGAGTGATAATCC (SEQ ID NO: 8).
[0131] The mRNA was prepared by in vitro transcription, and the capping rate of the mRNA prepared by in vitro transcription using the combination of the promoter sequence of TAATACGACTCACTATTAGG (SEQ ID NO: 4) at positions -17~+3 and AAG Cap2 was 68% according to the method of Example 1.
[0132] The results of the above examples are shown in Figure 2 and Figure 3 .
[0133] References:
[0134] 1. Despic, V. & Jaffrey, S. R. mRNA ageing shapes the Cap2 methylome in mammalian mRNA. Nature 614, 358–366 (2023).
[0135] 2. Drazkowska, K. et al. 2’-O-Methylation of the second transcribed nucleotide within the mRNA 5’ cap impacts the protein production level in a cell-specific manner and contributes to RNA immune evasion. Nucleic Acids Res. 50, 9051-9071 (2022).
[0136] 3. Rosa, S. S., Prazeres, D. M. F., Azevedo, A. M. & Marques, M. P. C. mRNA vaccines manufacturing: Challenges and bottlenecks. Vaccine 39, 2190-2200 (2021).
[0137] 4. Henderson, J. M. et al. Cap 1 Messenger RNA Synthesis with Co-transcriptional CleanCap® Analog by In Vitro Transcription. Curr. Protoc. 1, e39 (2021).
[0138] 5. Inagaki, M. Cap analogs with a hydrophobic photocleavable tag enable facile purification of fully capped mRNA with various cap structures. Nat. Commun. (2023).
[0139] 6. Linares-Fernandez, S. et al. Combining an optimized mRNA template with a double purification process allows strong expression of in vitro transcribed mRNA. Mol. Ther. - Nucleic Acids 26, 945-956 (2021).
[0140] 7. Li, S. et al. The mitochondrial protein ERAL1 suppresses RNA virus infection by facilitating RIG-I-like receptor signaling. Cell Rep. 34, (2021).
[0141] 8. Rehwinkel, J. & Gack, M. U. RIG-I-like receptors: their regulation and roles in RNA sensing. Nat. Rev. Immunol. 20, 537-551 (2020).
[0142] 9. Moradian, H., Roch, T., Anthofer, L., Lendlein, A. & Gossen, M. Chemical modification of uridine modulates mRNA-mediated proinflammatory and antiviral response in primary human macrophages. Mol. Ther. - Nucleic Acids 27, 854-869 (2022).
[0143]
Claims
1. A transcription initiation combination for synthesizing 5'-cap RNA, characterized in that, The transcription initiation combination comprises a tetranucleotide cap analog and a DNA template; The tetranucleotide cap analog has the structure shown in formula (I): , Formula (I); Among them, B1, B2 and B3 are independently natural, modified or non-natural nucleoside bases; R1 and R2 are independently OH or O-CH3; The DNA template contains the promoter sequence of T7 RNA polymerase, as shown in Formula (II); one or more nucleotides in the tetranucleotide cap analog are complementary to the DNA template at positions -1, +1, +2 and +3. , Formula (II); Where Y is a natural deoxynucleoside, X is a natural deoxynucleoside, and X and Y are complementary pairs; B1 and B2 are adenine, and B3 is guanine; The promoter sequence in the DNA template has the following bases: -1 is adenine, +1 and +2 are adenine, and +3 is guanine; or, -1 is thymine, +1 and +2 are adenine, and +3 is guanine; or, -1 is adenine, +1 is adenine, and +2 and +3 are guanine; or, -1 is thymine, +1 is adenine, and +2 and +3 are guanine.
2. The transcription initiation combination as described in claim 1, characterized in that, In the tetranucleotide cap analogue, R1 is O-CH3 or OH, and R2 is O-CH3 or OH.
3. A reagent kit, characterized in that, The kit comprises a tetranucleotide cap analog and an RNA polymerase; the tetranucleotide cap analog is capable of forming a transcription initiation combination with a DNA template as described in claim 1 or 2.
4. The kit according to claim 3, characterized in that, The kit also includes NTP, buffer solution, and optionally divalent metal ions.
5. The kit according to claim 4, characterized in that, The divalent metal ion is a magnesium ion; and / or the buffer solution is a Tris-HCl buffer solution; and / or the NTP contains GTP, ATP, CTP and UTP.
6. A method for improving RNA stability, characterized in that, The method includes: A tetranucleotide cap analogue is incorporated into an RNA synthesis system; the tetranucleotide cap analogue is capable of forming a transcription initiation combination with a DNA template as described in claim 1 or 2. Alternatively, the kit as described in any one of claims 3-5 may be reacted with a DNA template.
7. The method as described in claim 6, characterized in that, The RNA synthesis system is an in vitro synthesis system.
8. A method for capping mRNA, the method comprising performing a transcriptional reaction using the transcription initiation combination as described in claim 1 or 2 in the presence of T7 RNA polymerase.
9. The use of a transcription initiation combination as described in claim 1 or 2, or a kit as described in any one of claims 3-5, in the in vitro synthesis of RNA.
Citation Information
Patent Citations
Compositions and methods for synthesizing 5'-capped RNA
CN116751827B
Compositions and methods for synthesizing 5'-capped rnas
CN108366604A