RAA specific primer, crRNA thereof and kit for detecting vibrio parahaemolyticus

By designing RAA-specific primers and crRNA and combining them with the CRISPR/Cas13a system, a rapid, sensitive, and specific Vibrio parahaemolyticus detection method was established, which solved the problems of complex operation and false positives in existing detection methods and achieved a simple and efficient detection effect.

CN120608164APending Publication Date: 2025-09-09YANGZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510768544.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-10
Publication Date
2025-09-09

AI Technical Summary

Technical Problem

Existing Vibrio parahaemolyticus detection methods have problems such as cumbersome operation, time-consuming and labor-intensive, high sensitivity to false-positive results, and long reaction time, which limit their application in resource-limited or field environments.

Method used

A RAA-specific primer and its crRNA were designed. Combined with the CRISPR/Cas13a system, a rapid, sensitive, and specific detection method was established. Through RAA isothermal amplification and CRISPR/Cas13a trans-cleavage fluorescent probe reaction, a single-tube system was constructed for the detection of Vibrio parahaemolyticus.

Benefits of technology

It realizes the detection of Vibrio parahaemolyticus quickly, simply and without the need for sophisticated instruments. It has wide applicability, improves detection efficiency and is suitable for places such as seafood markets, aquaculture farms and food processing facilities.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120608164A_ABST
    Figure CN120608164A_ABST
Patent Text Reader

Abstract

The invention discloses an RAA specific primer, crRNA thereof and a kit for detecting vibrio parahaemolyticus. A plurality of primer pairs are designed by adopting an RAA isothermal amplification technology, the primer with the optimal amplification efficiency is screened, the reaction time and temperature conditions are optimized, and a sensitive and rapid isothermal amplification platform is established. On the basis, a CRISPR / Cas13a detection system is further developed, specific crRNA is designed and screened, and an ssRNA fluorescence report probe is combined, so that high-specificity recognition and cutting of targeted RNA are realized, and a visual detection kit is established. According to the invention, RAA isothermal amplification and a CRISPR / Cas13a cutting system are integrated, the vibrio parahaemolyticus rapid detection kit with high sensitivity and short reaction time (the detection limit is 3 copies / [mu] L, and the detection time is less than or equal to 5 min) is established, and the vibrio parahaemolyticus rapid detection kit is suitable for multiple fields of aquaculture pathogen detection, food safety monitoring and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of pathogenic microorganism detection and relates to a RAA-specific primer and crRNA thereof and a kit for detecting Vibrio parahaemolyticus. Background Art

[0002] Vibrio parahaemolyticus (V. parahaemolyticus) is a Gram-negative, halophilic bacterium widely distributed in estuaries and oceans, and inhabits the surfaces of fish, shrimp, crabs, and mollusks. It is a major pathogen in aquaculture. Consuming raw or undercooked seafood, particularly shellfish such as shrimp and oysters, is a major route of infection for humans. It can cause acute gastroenteritis, accompanied by symptoms such as vomiting, nausea, diarrhea, and fever. In severe cases, it can also cause sepsis through exposed wounds, seriously endangering life and health. In recent years, the increasing detection of V. parahaemolyticus in aquaculture products has raised serious concerns about food safety and consumer protection, particularly in areas with intensive seafood consumption and farming. Therefore, there is a strong push to develop rapid and accurate detection tools that can be implemented at all stages of the food production and supply chain.

[0003] At present, the detection methods of Vibrio parahaemolyticus are mainly divided into three types: traditional culture, immunological detection and molecular biology detection. Although the traditional culture detection method is mature, its operation is cumbersome, time-consuming and labor-intensive. Although the immunological detection method has strong specificity and high sensitivity, it still has shortcomings compared to the molecular biology detection method. Molecular biology detection methods can accurately identify Vibrio parahaemolyticus from water samples, food, etc. due to their high efficiency, high sensitivity and strong specificity. Among them, nucleic acid diagnosis is widely regarded as the gold standard for detecting a variety of pathogens. For example, real-time fluorescence quantitative PCR (qPCR) is still the gold standard method for detecting Vibrio parahaemolyticus. However, this variable temperature nucleic acid amplification has strict requirements on instruments, operator quality and time, which limits its application in resource-limited or field environments, such as seafood markets, aquaculture farms and food processing facilities. To address these limitations, isothermal amplification technologies, primarily loop-mediated isothermal amplification (LAMP) and recombinase-assisted amplification (RAA), have been widely used in real-time nucleic acid testing. Although these methods offer certain advantages over qPCR, such as lower temperature requirements, they are more susceptible to false positives and have relatively long reaction times, factors that limit their widespread adoption in practical applications.

[0004] The CRISPR (Critically Interspaced Short Palindromic Repeats) system was originally discovered as an adaptive immune mechanism in bacteria and has been successfully applied in various fields such as gene editing and molecular diagnostics. In the context of nucleic acid detection, the CRISPR / Cas13a system is widely used for its high specificity in targeting RNA sequences and its ability to exhibit flanking activity upon target recognition. The system consists of a crRNA and a Cas13a protein. Once bound to the target RNA, it indiscriminately cleaves surrounding single-stranded RNA, including synthetic fluorophore-quenched reporter proteins, thereby enabling real-time signal readout. Importantly, the LwaCas13a variant does not require a protospacer adjacent motif (PAM), making it particularly suitable for targeting different microbial targets. The SHERLOCK (Specific High-sensitivity Enzymatic Reporter lock) platform combines isothermal amplification with Cas13-based detection, showing excellent sensitivity and specificity in pathogen diagnosis, and offers great promise for the development of portable, low-cost foodborne pathogen detection systems. Summary of the Invention

[0005] Purpose of the invention: The technical problem to be solved by the present invention is to provide a RAA-specific primer for rapid detection of Vibrio parahaemolyticus.

[0006] The technical problem that the present invention also solves is to provide a crRNA designed based on the RAA-specific primers.

[0007] The technical problem that the present invention also aims to solve is to provide the use of the RAA-specific primer or the crRNA in preparing a kit for detecting Vibrio parahaemolyticus.

[0008] The technical problem that the present invention also aims to solve is to provide a kit for detecting Vibrio parahaemolyticus.

[0009] The final technical problem to be solved by the present invention is to provide a rapid detection method for Vibrio parahaemolyticus based on the RAA-CRISPR / Cas13a system.

[0010] Technical solution: In order to solve the above technical problems, the present invention provides a RAA-specific primer, the nucleotide sequence of the RAA-specific primer is shown in SEQ ID NO.5-24.

[0011] The present invention also includes a crRNA designed based on the RAA-specific primers, the nucleotide sequence of the crRNA is shown in SEQ ID NO.26-29.

[0012] The present invention also includes the use of the RAA-specific primer or the crRNA in preparing a kit for detecting Vibrio parahaemolyticus.

[0013] The present invention also includes a kit for detecting Vibrio parahaemolyticus, which includes the RAA-specific primer and the crRNA.

[0014] The kit further comprises an ssRNA reporter probe, the nucleotide sequence of which is shown in SEQ ID NO. 30. The specific nucleotide sequence is as follows:

[0015] 5'-6FAM- 2'-O-M AATGGC 2'-O-M A 2'-O-M AATGGC 2'-O-M A-BHQ1-3'; among them, 2'- O-M Modify base A separately.

[0016] The kit further comprises a plasmid standard, the nucleotide sequence of which is shown in SEQ ID NO.25.

[0017] The kit further comprises an ssRNA standard, the nucleotide sequence of which is shown in SEQ ID NO. 31. The specific sequence is as follows:

[0018] 5'-GCAATCTTTGGGACTTAAGGGGAATAATGCAGGGGATTTGGTTTATTCTGCTAGA CAACTGACGGACCTTATTACTGTACCAGAATATGGAAACAATCGCGATCTTACCA AGCGTCAAGCTATCCTTAAAATGCTCATT-3'

[0019] The kit further comprises other reagents in the CRISPR / Cas13a cleavage system and / or in vitro transcription system.

[0020] The CRISPR / Cas13a cleavage system further comprises HOLMES Bffer for Cas13, Cas13a protein and DEPC water.

[0021] Wherein, the in vitro transcription system includes Transcription Bffer, T7 RNA Polymerase Mix and rNTP.

[0022] Among them, the primer of the kit is RAA-1-F / R primer, the sequence of the RAA-1-F / R primer is shown in SEQ ID NO.5~6, and the crRNA sequence is shown in SEQ ID NO.26.

[0023] The plasmid standard of the present invention is a template standard prepared by targeting the virulence gene VPA1585 of Vibrio parahaemolyticus. A qPCR standard curve is also established based on the template standard.

[0024] The present invention also provides a rapid detection method for Vibrio parahaemolyticus based on the RAA-CRISPR / Cas13a system, which is characterized by comprising the following steps:

[0025] (1) Preparing a template standard and establishing a qPCR standard curve using the virulence gene VPA1585 of Vibrio parahaemolyticus as a target; the nucleotide sequence of the virulence gene VPA1585 of Vibrio parahaemolyticus is shown in SEQ ID NO. 25;

[0026] (2) Using the template standard as a template, design specific primers and perform recombinase-assisted amplification (RAA) reaction;

[0027] (3) Designing a crRNA sequence targeting the Cas13a protein and preparing ssRNA standards based on the specific sequence optimized for the RAA reaction; the nucleotide sequence of the crRNA is shown in SEQ ID NO. 26-29;

[0028] (4) Designing an ssRNA reporter probe; utilizing the trans-cleavage activity of CRISPR / Cas13a on the ssRNA reporter probe to screen the components in the reaction system and optimize the dosage of each component in the reaction system; the nucleic acid sequence of the fluorescent probe is shown in SEQ ID NO.30;

[0029] (5) The optimized system was combined with the RAA reaction system to prepare a two-step detection system, and a visualization detection system of the Vibrio parahaemolyticus RAA-CRISPR / Cas13a system combined with a fluorescent reporter probe was established.

[0030] Furthermore, the preparation and establishment process of step (1) is as follows:

[0031] 1) Amplifying the virulence gene VPA1585 of Vibrio parahaemolyticus and inserting it into the pMD18-T plasmid to produce a pMD18-T-VPA1585 plasmid standard; transforming pMD18-T-VPA1585 into competent Escherichia coli cells, and extracting the plasmid standard; the nucleotide sequences of the primers used to amplify the VPA1585 gene are shown in SEQ ID NO. 25;

[0032] 2) Based on the concentration of the extracted plasmid standard and the number of plasmid bases, the nucleic acid copy number per microliter of solution was converted. The plasmid standard was diluted 10-fold for qPCR and a standard curve was established;

[0033] Furthermore, the specific process of step (2) is:

[0034] 1) Using the constructed plasmid standard as a template, design different RAA primers and screen for the best specific primer pair;

[0035] 2) Optimize the temperature and reaction time of the RAA reaction and select the best conditions for subsequent reactions;

[0036] Furthermore, the nucleotide sequence of the RAA primer used for screening is shown in SEQ ID NO. 5-24; a T7 promoter sequence is additionally added to the 5' end of the RAA upstream primer for subsequent in vitro transcription reaction;

[0037] Furthermore, the specific process of step (3) is:

[0038] 1) Based on the specific target sequence optimized by the RAA reaction, different crRNA sequences were designed and the constructed crRNA sequences were inserted into the pMD18-T vector to obtain the pMD18-T-crRNA plasmid; the pMD18-T-crRNA plasmid was transformed into Escherichia coli competent cells, the plasmid was extracted, and the crRNA was synthesized in vitro as a template after linearization with the Xba1 restriction endonuclease;

[0039] 2) The linearized pMD18-T-crRNA double-stranded DNA was transcribed into RNA in vitro using T7 RNA Polymerase Mix. Similarly, the ssRNA standard was obtained by in vitro transcription using the purified RAA product as a template.

[0040] Furthermore, a T7 promoter sequence was additionally added to the 5′ end of the crRNA for in vitro transcription reaction;

[0041] Furthermore, the specific process of step (4) is:

[0042] 1) Design ssRNA reporter probes; utilize the trans-cleavage activity of CRISPR / Cas13a to screen for crRNA sequences with optimal cleavage activity for subsequent experiments;

[0043] 2) Using the optimal crRNA sequence screened, the dosage of Cas13a protein, crRNA, and ssRNA reporter probe in the CRISPR / Cas13a cleavage system was optimized;

[0044] 3) Optimize the amount of T7 RNA Polymerase Mix and rNTPs used in the in vitro transcription system;

[0045] Furthermore, the optimized system was combined with RAA isothermal amplification to construct a two-step reaction method, and the reaction was carried out with the help of an isothermal nucleic acid fluorescence detector to establish a visual detection system for the Vibrio parahaemolyticus RAA-CRISPR / Cas13a system combined with a fluorescent probe.

[0046] Beneficial effects: Compared with the prior art, the present invention has the following outstanding significant advantages: the detection kit disclosed in the present invention is based on the VPA1585 gene, a virulence factor of Vibrio parahaemolyticus, and is designed with VPA1585-specific crRNA. At the same time, it is combined with the CRISPR / Cas13a fluorescence detection system, which can quickly, sensitively and specifically detect Vibrio parahaemolyticus. It is easy to operate, does not require sophisticated instruments, and has a wide applicability. The CRISPR / Cas13a detection system for Vibrio parahaemolyticus detection of the present invention is a kit for detecting Vibrio parahaemolyticus based on CRISPR / Cas13a detection combined with RAA isothermal amplification technology. It can detect the presence of Vibrio parahaemolyticus in a short time and has a wide detection range. The single-tube RAA-CRISPR / Cas13a detection method established in the present invention combines RAA isothermal amplification, in vitro transcription, and CRISPR / Cas13a trans-cleavage fluorescent probe reaction into a single-tube system for RAA-CRISPR / Cas13a detection of Vibrio parahaemolyticus. This provides a solution for the detection and prevention of Vibrio parahaemolyticus and other pathogenic microorganisms, and can improve the detection efficiency of Vibrio parahaemolyticus. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 This is a diagram showing the PCR amplification results of the Vibrio parahaemolyticus VPA1585 gene described in an embodiment of the present invention; M: 500 bp molecular weight marker; 1-4: VPA1585;

[0048] Figure 2 This is the qPCR standard curve of the pMD18-T-VPA1585 plasmid standard successfully constructed in the embodiment of the present invention; y = -3.531x + 39.942; R2 =0.9978;

[0049] Figure 3 This is a diagram showing the screening results of the optimal primer pair for RAA isothermal amplification according to an embodiment of the present invention; M: 500 bp molecular weight marker MARKER; 1-10: RAA1-10;

[0050] Figure 4 This is a grayscale value analysis diagram of the amplification results of the optimal primer pair for isothermal amplification according to an embodiment of the present invention;

[0051] Figure 5 This is a graph showing the optimization results of the optimal reaction temperature for RAA isothermal amplification described in an embodiment of the present invention; M: 500 bp molecular weight marker; 1: 33°C; 2: 35°C; 3: 37°C; 4: 39°C; 5: 41°C; 6: 43°C;

[0052] Figure 6 This is a graph showing the optimization results of the optimal reaction time for RAA isothermal amplification according to an embodiment of the present invention; M: 500 bp molecular weight marker; 1: 5 min; 2: 10 min; 3: 15 min; 4: 20 min; 5: 25 min; 6: 30 min;

[0053] Figure 7 This is a graph showing the PCR verification results after crRNA annealing and self-assembly according to an embodiment of the present invention; M: 500 bp molecular weight marker MARKER; 1-4: crRNA1-4;

[0054] Figure 8 Figure 1 is a graph showing the optimal crRNA screening results in the CRISPR / Cas13a cleavage system described in an embodiment of the present invention; NC is a blank control group; crRNA1-4 are four crRNA sequences to be screened;

[0055] Figure 9 Graph showing the optimization results of the optimal crRNA concentration in the CRISPR / Cas13a cleavage system described in the examples of the present invention; NC represents the blank control group;

[0056] Figure 10 Result diagram of optimization of Cas13a protein concentration in the CRISPR / Cas13a cleavage system described in the embodiment of the present invention; NC is the blank control group;

[0057] Figure 11 This is a graph showing the optimization results of the optimal concentration of ssRNA fluorescent reporter probes in the CRISPR / Cas13a cleavage system described in the examples of the present invention; NC is a blank control group;

[0058] Figure 12This is a diagram showing the optimization results of the optimal dosage of T7 RNA Polymerase Mix in the in vitro transcription system described in the examples of the present invention; NC is a blank control group;

[0059] Figure 13 Graph showing the results of rNTP concentration optimization in the in vitro transcription system described in the examples of the present invention; NC is a blank control group;

[0060] Figure 14 This is a graph showing the sensitivity of the RAA-CRISPR / Cas13a two-step method for detecting Vibrio parahaemolyticus described in this example; NC is a blank control group;

[0061] Figure 15 This is a graph showing the specific results of the RAA-CRISPR / Cas13a two-step method for detecting Vibrio parahaemolyticus described in this example; NC is a blank control group. DETAILED DESCRIPTION

[0062] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0063] In order to make the purpose of the invention, technical solutions and beneficial technical effects of the present invention more clear, the present invention is further described in detail below with reference to the embodiments. Those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. Modifications or substitutions made to the methods, steps or conditions of the present invention without departing from the spirit and essence of the present invention are within the scope of the present invention.

[0064] Example 1 Successfully prepared template standards and established qPCR standard curves using the virulence gene VPA1585 of Vibrio parahaemolyticus as the target

[0065] 1. The genome of Vibrio parahaemolyticus was extracted and used as a template to construct a pMD18-T-VPA1585 plasmid standard. The nucleotide sequences of the primers used are shown in SEQ ID NOs. 1-2; VPA1585-F: 5'-ATGTACTCTTCAATTGCGAG-3', VPA1585-R: 5'-TCAATGTGGCTTTTTTTGAT-3' to synthesize and amplify the DNA sequence of VPA1585 (SEQ ID NO. 25). The PCR system consisted of 25 μL Taq Master Mix, 15 μL DEPC water, 2 μL each of VPA1585-F / R (shown in SEQ ID NOs. 1-2), and 6 μL of Vibrio parahaemolyticus genomic DNA. The amplification procedure for the sample used was: pre-denaturation at 95°C for 5 min, followed by 35 cycles (95°C for 30 s, 55°C for 30 s, 72°C for 1 min), and a final extension at 72°C for 10 min. The amplified VPA1585 fragment was ligated into the pMD18-T vector via TA cloning. The reaction mixture consisted of 1 μL of pMD18-T vector, 1 μL of the amplified VPA1585 fragment, 3 μL of DEPC water, and 5 μL of Solttion I. The ligation reaction conditions were 16°C for 30 min. The resulting recombinant plasmid was transformed into Escherichia coli DH5α competent cells and cultured overnight at 37°C on ampicillin (Amp)-resistant plates. Single colonies were picked and identified by sequencing to identify the positive clone, pMD18-T-VPA1585. The clone was further expanded in 5 mL of LB medium supplemented with 100 μg / mL Amp and cultured overnight at 37°C in an incubator at 220 rpm.

[0066] 2. Extract plasmid standard DNA and quantify its concentration and quality using Nanodrop. For the establishment of the qPCR standard curve for Vibrio parahaemolyticus: the number of nucleic acid copies per microliter of solution was converted based on the concentration of the extracted plasmid standard and the number of plasmid bases. The plasmid standard was diluted 10-fold and used as a template for establishing the qPCR standard curve; the qPCR primers used were qVPA1585-F: 5'-ATGAAAAATGGTCGTGCCGC-3' (SEQ ID NO.3) qVPA1585-R: '-TGCACGACTTTGGTCTTGGT-3' (SEQ ID NO.4); the reaction system was as follows: 10 μL of 2× Taq Pro Universal SYBR qPCR Master Mix (Novozymes, China), 0.4 μL each of qVPA1585-F / R (10 μM), 1 μL of plasmid standard DNA, and 8.2 μL of DEPC water; the qPCR reaction procedure was as follows: pre-denaturation at 95°C for 30 s, followed by 40 cycles (denaturation at 95°C for 10 s, annealing / extension at 60°C for 30 s); a standard curve was prepared based on the linear relationship between the Ct value and the logarithmic value of the plasmid standard copy number (e.g. Figure 2 shown).

[0067] Example 2: Design specific primers based on RAA isothermal amplification technology, screen the primer pairs with the best amplification efficiency, and optimize the reaction time and reaction temperature

[0068] Based on the VPA1585 gene (SEQ ID NO.25), RAA amplification primers were designed using Oligo7 software and NCBI Prime Blast online website. A T7 promoter sequence was additionally added to the 5' end of the RAA upstream primer for subsequent in vitro transcription reaction; the primer nucleotide sequences used are shown in SEQ ID NO.5-24; the RAA reaction system (basic nucleic acid isothermal amplification reagent (RAA type), Hangzhou Zhongce Biotechnology Co., Ltd., product number: S001ZC) is: 13.5 μL of DEPC water, 25 μL of Btffer A, 1 tube of freeze-dried reaction powder, 2.5 μL of Btffer B, 5 μL of the standard DNA prepared in Example 1, 2 μL of each RAA1~10-F / R primer (10 μM), the reaction procedure is: 37°C reaction for 30 minutes to obtain the amplified product. The amplified product was identified by agarose gel electrophoresis ( Figure 3 ), by analyzing the gray value of the target band ( Figure 4 ), and the optimal primer was determined to be RAA-1-F / R.

[0069] After screening the best primers, the reaction was carried out at 33°C, 35°C, 37°C, 39°C, 41°C, and 43°C respectively to screen out the best reaction time, such as Figure 5 The optimal reaction temperature is 43°C; the reaction time is set to 5min, 10min, 15min, 20min, 25min, and 30min respectively. The results show that the optimal reaction time is 25min ( Figure 6 ).

[0070] Example 3 Design and screening of crRNA for the detection method of Vibrio parahaemolyticus based on CRISPR / Cas13a, and successful preparation of ssRNA standards

[0071] The crRNA sequence and primers were designed using SnapGene software and the NCBI BLAST online website. The 5' end of the crRNA contained a T7 promoter sequence. The nucleotide sequences of the crRNA used are shown in SEQ ID NOs. 26-29. The crRNA sequence was synthesized as a single-stranded oligonucleotide, gradient annealed to a double-stranded DNA, and cloned into the pMD18-T vector. The reaction system, reaction conditions, and subsequent positive clone plasmid screening process were as described in Example 1. The gradient annealing program was: 90°C for 4 minutes, 70°C for 10 minutes, 55°C for 10 minutes, 40°C for 10 minutes, and 25°C for 10 minutes. The pMD18-T-crRNA plasmid was extracted, linearized with the Xba1 restriction endonuclease, and used as a template for in vitro crRNA synthesis. The linearized pMD18-T-crRNA plasmid was transcribed in vitro using the T7 High Yield RNA Synthesis Kit (Yisheng Biotechnology (Shanghai) Co., Ltd., Catalog No. 10623ES10). The in vitro transcription system consisted of 5 μL of 10× Transcription Buff, 2 μL of T7 RNA Polymerase Mix, 8 μL of 100 mM rNTPs, and 1 μg of the linearized pMD18-T-crRNA plasmid. The reaction was incubated at 37°C for 4 hours. The crRNA standard was obtained by in vitro transcription. The ssRNA standard was obtained by in vitro transcription using the purified isothermal amplification product from Example 2 as a template. The reaction system and conditions were as described above: 5 μL of 10× Transcription Buff, 2 μL of T7 RNA Polymerase Mix, 8 μL of 100 mM rNTPs, and 1 μg of the RAA amplification product described in Example 2. The reaction was incubated at 37°C for 4 hours. The crRNA and ssRNA standards were purified using an RNA rapid concentration and purification kit (Sangon Biotech, Inc.), wherein the nucleotide sequence of the ssRNA standard is shown in SEQ ID NO. 31.

[0072] Example 4 Use ssRNA fluorescent reporter probe to verify the trans-cleavage activity of Cas13a protein, screen and obtain the best crRNA sequence, and determine the optimal reaction system

[0073] The ssRNA fluorescent reporter probe was designed, and its nucleotide sequence is shown in SEQ ID NO.30; the 5' end of the fluorescent ssRNA reporter probe was modified with a FAM fluorescent group, and the 3' end was modified with a BHQ1 quencher group. The optimal crRNA sequence was screened using the CRISPR / Cas13a cleavage system as crRNA1( Figure 8 ), CRISPR / Cas13a (GenCRISPR TM The cleavage system of Cas13a (C2c2) Ntclease, Nanjing GenScript Biotechnology Co., Ltd., catalog number: Z03486, was as follows: 5 μL of 10× HOLMES buffer for Cas13, 1 μL of Cas13a protein (100 ng / μL), 37 μL of DEPC water, 1 μL of crRNA (50 nmol), 1 μL of ssRNA reporter probe (20 μM), and 5 μL of ssRNA standard. The reaction procedure was as follows: 60 cycles of 30 s at 37°C in an isothermal fluorescence nucleic acid detector, and the fluorescence signal was collected. The concentration of crRNA in the system (24nmol, 12nmol, 6nmol, 3nmol, 1.5nmol, 0.75nmol, 0.375nmol, NC (DEPC water filling)), the amount of Cas13a protein (100ng, 50ng, 25ng, 12.5ng, 6.25ng, 3.125ng, 1.5625ng, NC (DEPC water filling)) and the concentration of ssRNA reporter probe (80μM, 40μM, 20μM, 10μM, 5μM, 2.5μM, 1.25μM, 0.625μM, NC (DEPC water filling)) were optimized, as shown in Figure 5. Figure 9-11 As shown in the figure, the optimal addition amount of Cas13a protein is 25 ng, the optimal addition amount of crRNA is 12.5 ng, and the ssRNA fluorescent probe is 20 μM; therefore, the CRISPR / Cas13a cleavage reaction system was finally determined to be: 5 μL of 10×HOLMES Bffer for Cas13, Cas13a protein (25 ng), 1 μL of crRNA (12.5 nmol), 1 μL of ssRNA fluorescent reporter probe (20 μM), 5 μL of ssRNA standard, and 37 μL of DEPC water.

[0074] Example 5: Using the optimized RAA-CRISPR / Cas13a two-step detection system, a visualization detection system for Vibrio parahaemolyticus RAA-CRISPR / Cas13a cleavage reaction combined with fluorescent probes was successfully established

[0075] On the basis of Example 4, an in vitro transcription system was added: 5 μL of 10 × HOLMES Btffer for Cas13, 1 μL of Cas13a protein (25 ng / μL), 1 μL of crRNA (12.5 ng / μL), 1 μL of ssRNA reporter probe (20 μM), 5 μL of 10 × Transcription Btffer, 2 μL of T7 RNA Polymerase Mix, 8 μL of rNTP (100 mM), 5 μL of the isothermal amplification product purified in Example 2, and 21 μL of DEPC water; T7 RNA Polymerase Mix (2 μL, 1 μL, 0.5 μL, 0.25 μL, 0.125 μL, 0.0625 μL, 0.03 μL and without T7 RNA Polymerase) in the reaction system were added. Mix was made up with DEPC water as NC) and the amount of rNTP (100mM, 75mM, 50mM, 25mM, 12.5mM, 6.25mM, 3.125mM, without rNTP and made up with DEPC water as NC) were optimized. Figure 12-13 The results showed that the optimal dosage of T7 RNA Polymerase Mix was 0.5 μL, and the optimal dosage of rNTP was 75 mM; RAA-CRISPR / Cas13a detection was able to detect the presence of Vibrio parahaemolyticus within 5 minutes; the minimum detection line was: 3 copies / μL ( Figure 14 ); It has good specificity for Vibrio parahaemolyticus and has no cross-reaction to other common Vibrio (such as Vibrio alginolyticus, Vibrio vulnificus) and Escherichia coli ( Figure 15 The RAA-CRISPR / Cas13a fluorescence detection system can rapidly, sensitively, and specifically detect Vibrio parahaemolyticus.

Claims

1. A RAA-specific primer, characterized in that: The nucleotide sequences of the RAA-specific primers are shown in SEQ ID NOs. 5-24.

2. A crRNA designed based on the RAA-specific primer according to claim 1, characterized in that The nucleotide sequence of the crRNA is shown in SEQ ID NO.26-29.

3. Use of the RAA-specific primer according to claim 1 or the crRNA according to claim 2 in the preparation of a kit for detecting Vibrio parahaemolyticus.

4. A kit for detecting Vibrio parahaemolyticus, characterized in that: The kit comprises the RAA-specific primer according to claim 1 and the crRNA according to claim 2.

5. The kit for detecting Vibrio parahaemolyticus according to claim 4, characterized in that The kit further comprises an ssRNA reporter molecule probe, the nucleotide sequence of which is shown in SEQ ID NO.

30.

6. The kit for detecting Vibrio parahaemolyticus according to claim 4, characterized in that The kit further comprises a plasmid standard, the nucleotide sequence of which is shown in SEQ ID NO.

25.

7. The kit for detecting Vibrio parahaemolyticus according to claim 4, characterized in that The kit further comprises an ssRNA standard, the nucleotide sequence of which is shown in SEQ ID NO.

31.

8. The kit for detecting Vibrio parahaemolyticus according to claim 4, characterized in that The kit also includes other reagents in the CRISPR / Cas13a cleavage system and / or in vitro transcription system.

9. The kit for detecting Vibrio parahaemolyticus according to claim 8, characterized in that The in vitro transcription system includes T7 RNA Polymerase Mix and rNTP.

10. The kit for detecting Vibrio parahaemolyticus according to claim 4, characterized in that: The primers of the kit are RAA-1-F / R primers, the sequences of the RAA-1-F / R primers are shown in SEQ ID NOs. 5 to 6, and the crRNA sequence is shown in SEQ ID NO. 26.