Feature sequence, marker primer and identification method of fig variety Grass

Abstract

The invention relates to a characteristic sequence of a fig variety Grass, a molecular specific marker primer and a method capable of rapidly identifying the fig variety Grass. According to the present invention, the sequences of the molecular specific marker primers are as follows: 1) 825458 primer group: 825458 LF: GAGCAAGTATAAATCTGATGCCCCTTGAAACGATAGGTAAT2) 5728445 primer group: 5728445 LF:

Description

(1) Technical field

[0001] The invention relates to a characteristic sequence of a fig variety Grace, a molecular specific marker primer combination, and a method for specifically identifying the fig variety Grace by utilizing the molecular specific marker primer combination. (2) Background technology

[0002] The fig, Ficus carica, is a deciduous shrub or small tree of the genus Ficus in the Moraceae family. It is native to the Mediterranean coast and was first cultivated throughout Xinjiang, my country. It is now being introduced and cultivated in many locations across my country, boasting high yields and rapid returns. Currently, over 20 varieties, including 'Bojihong,' 'Glais,' and 'Masyitaofen,' have performed well in this field. The fig fruit contains a variety of active ingredients, including polysaccharides, flavonoids, and psoralens, which have been shown to treat sore throats, fight tumors, lower blood sugar and lipids, and enhance immunity, resulting in growing market demand. While fig cultivars vary significantly in shape, size, color, and flavor, individual plant differences are minimal. Furthermore, the naming of hybrids between some fig cultivars can be confusing. This situation hinders cultivar identification, promotion, communication, and the development of new varieties. Therefore, developing stable and specific DNA markers at the molecular level is a scientific approach to accurately and rapidly identifying fig varieties. (3) Summary of the invention

[0003] The purpose of the present invention is to provide a characteristic sequence of the fig variety Grace, a molecular specific marker primer combination, and a method for specifically identifying the fig variety Grace using the molecular specific marker primer combination;

[0004] The technical solution adopted in the present invention is:

[0005] The characteristic sequence group of fig variety Grice is as follows:

[0006] 1)8254_58: 5'-CCGAACACTCCTCAACATCATCAGCAAAACGCCATGCCTTGAAAACGTT GAAGGTAACCTGTTGGTCGTGAACTCTCATGGTCAATTCACCCTTCTGCACATCTATCAAGGTCCTGCCAGTAGCCANNNNNNNNACTTTGGAAGGGCA TTATGTGACCTAGGAGCAAGTATAAATCTGATGCCCATGTCTATCTTTAAAAAGCTGGGAATTAGGGAAGCAAGACCCACTACAGTCACTTTGCAATTAGCAGACAGGTCAT-3'

[0007] 2)57284_45: 5'-CCCTCCTTCTAGCGCCAAAATATTGATGCCGAAAACGCTTCCGGCAGCA ACACCCAATGTGGTCGGGTGGTCCGATCACGTCCGGCCAGTCGCTCCGCCGCAGTCACCTGCAAAACGAACGCACCTNNNNNNNNNCCCTATAAATAGGGGAAGAACCCACGAATCTAGGTAAGCTGACTTCTACCTTGCCAAAGCTCTGTCTCCTATCGCTCATCAGCTCTCGAACTGACTTAGGCATCGGAGTGCCCGCGACAGACA-3'

[0008] Where NNNNNNNNNN is an unknown sequence within 300bp.

[0009] The present invention also relates to a molecular specific marker primer set for the fig variety Grice, wherein the primer sequences are as follows: 1) 8254_58 primer set:

[0010] 8254_58LFGAGCAAGTATAAAATCTGATGCCC

[0011] 8254_58RRTAATTGCAAAGTGACTGTAGTGG

[0012] 8254_58SFAGCCTTGAAAACGTTGAAGGTAAT

[0013] 2) 57284_45 primer set:

[0014] 57284_45LFACGAATCTAGGTAAGCTGACTTC

[0015] 57284_45RRGATGCCTAAGTCAGTTCGAGAG

[0016] 57284_45SFGCCGAAAACGCTTCCGGT

[0017] The two primer sets described above were derived from molecular marker development using SLAF-seq (Specific-Locus Amplified Fragment Sequencing) technology on 23 samples, yielding genome-wide molecular markers. This project generated an average of 118,891 SLAF tags per sample, with an average sequencing depth of 10.12x. A total of 72.00 Mb reads were generated during the experiment. Bioinformatics analysis yielded 166,254 SLAF tags, including 6,575 polymorphic SLAF tags, yielding a total of 72,678 population SNPs. Based on these analysis results, over 1,000 primer pairs were designed and screened and validated in 23 samples, yielding DNA fragments specific to the fig variety Grace. Specific fragments for the selected primer combination could not be obtained for other fig varieties. It should be noted that the molecular-specific marker primer combination of the present invention is limited to fig variety identification, meaning that the samples tested are limited to figs.

[0018] The results of a random sampling of 5 plants of this variety showed that the characteristics of the Grace variety fig are shown in the table below:

[0019]

[0020] The present invention also relates to a method for rapidly identifying the fig variety Grace using the molecular specific marker primer combination, the method comprising: extracting genomic DNA from leaves of the fig variety to be tested as a template, using the molecular specific marker primer set as amplification primers, and performing PCR amplification, wherein the primers correspond to binding sites on characteristic sequences such as Figure 1 , Figure 2 shown.

[0021] The key to the method of the present invention lies in the selection of amplification primer combinations, while DNA extraction, PCR reaction system and reaction conditions, and electrophoresis detection can all be performed according to conventional methods in the art.

[0022] Compared with existing molecular marker methods for fig varieties, such as SSR markers, the method of the present invention has the following advantages:

[0023] (1) Because the primers used have been sequenced and repeatedly verified, their reliability is greatly improved;

[0024] (2) The detection is convenient and intuitive. The presence or absence of band combinations can be directly determined by ordinary electrophoresis. However, if the SSR marker method is used, further analysis or sequencing by high-resolution electrophoresis is required after amplification.

[0025] (3) The sample requirements are relatively low, and DNA samples from tissues such as leaves can meet the needs of variety identification;

[0026] Preferably, the PCR amplification system of the present invention is composed as follows:

[0027]

[0028] The balance is ddH2O;

[0029] The PCR amplification conditions were as follows: pre-denaturation at 94°C for 300 s, denaturation at 95°C for 10 s, annealing at 56°C for 50 s, extension at 72°C for 40 s, for a total of 30 cycles, and a final fill-in at 72°C for 300 s; the termination temperature was 4°C;

[0030] The final concentration of PCR Buffer is 1×, which means that the concentrations of the components in the reaction system are the same as those of 1× PCR Buffer. 10× PCR Buffer is usually used at a volume of 1 / 10 of the reaction system volume. 10× PCR Buffer consists of: 100mM Tris-HCl (pH 8.5), 500mM KCl, 25mM MgCl2, and 1.0% Triton-X-100, with ddH2O as the solvent.

[0031] Specifically, the method is as follows:

[0032] (1) Take the fig leaves to be tested, grind them with liquid nitrogen, and extract the genomic DNA of the fig leaves to be tested using the CTAB method;

[0033] (2) Using the genomic DNA extracted in step (1) as a template and the molecular specific marker primers as amplification primers, PCR amplification is performed:

[0034] The PCR reaction system per 15 μL is composed as follows:

[0035]

[0036] PCR reaction conditions are as follows:

[0037] After pre-denaturation at 94°C for 300 s, the reaction was cycled for 30 cycles: denaturation at 95°C for 10 s, annealing at 56°C for 50 s, and extension at 72°C for 40 s. The final cycle was completed at 72°C for 300 s. The termination temperature was 4°C.

[0038] (3) Take 3 μL of the amplified product from step (2), mix it with 1 μL of 0.25% bromophenol blue buffer, apply the sample to a 1.5% agarose gel, and electrophorese in 1×TAE buffer at 5 V / cm. After the electrophoresis, stain with EB and photograph it on an automatic gel image analyzer. If a specific DNA band appears in the electrophoresis result, the fig variety to be tested is Grice; otherwise, it is not. (IV) Description of the accompanying drawings

[0039] Figure 1 . Schematic diagram of the relative positions of the primers in the 8254_58 primer set within the fig DNA signature sequence fragment 8254_58;

[0040] Figure 2 .57284_45 primer set relative position diagram of each primer in the fig DNA characteristic sequence fragment 57284_45;

[0041] Figure 3 Electrophoretogram of PCR amplification results of 23 fig varieties using the 8254_58 primer set (numbers 1-23 represent fig varieties: 1, Brooke Red; 2, Grace; 3, Brunswick; 4, Early Yellow; 5, Mas-Yi-Taufin; 6, Strawberry; 7, B1011; 8, Huishankou; 9, Jinaofen; 10, Qinghua; 11, Hongyan; 12, Papa John's; 13, BNR; 14, Hardy; 15, BBR; 16, Baishan; 17, Sala; 18, Rockery; 19, Green Anti-1; 20, Dela; 21, Baiya; 22, California Black; 23, Baraunay); Takara DL2000 marker was used as the marker. Only one specific DNA band was amplified for the fig variety Grace, numbered 2, using the 8254_58 primer set.

[0042] Figure 4 Electrophoresis diagram of PCR amplification results of 23 fig varieties using primer set 57284_45 (Fig varieties numbered 1-23 are: 1, Brooke Red; 2, Grace; 3, Brunswick; 4, Early Yellow; 5, Marseille Taupin; 6, Strawberry; 7, B1011; 8, Huishankou; 9, Jinaofen; 10, Qinghua; 11, Hongyan; 12, Papa John's; 13, BNR; 14, Hardy; 15, BBR; 16, Baishan; 17, Sala; 18, Rockery; 19, Green Anti-1; 20, Dela; 21, Baiya; 22, California Black; 23, Baraunay); Takara DL2000 marker was used as the marker; only one specific DNA band was amplified for Fig variety 2, Grace, using primer set 57284_45. (V) Specific implementation methods

[0043] The present invention is further described below with reference to specific embodiments, but the protection scope of the present invention is not limited thereto:

[0044] Example 1:

[0045] (1) Extraction of genomic DNA from fig varieties:

[0046] 0.05 g of young leaves of the test fig variety were taken and thoroughly ground with liquid nitrogen. Genomic DNA from the test fig leaves was extracted using the CTAB method. After multiple extractions, a genomic DNA extract of the fig variety was obtained. The DNA extract was then subjected to 1.5% agarose gel electrophoresis to test integrity, purity, and concentration. Band brightness was determined for subsequent PCR amplification. The DNA extract was stored at -20°C until use.

[0047] (2) Design specific PCR amplification primers. The sequences of the primer pairs are:

[0048] 1) 8254_58 primer set:

[0049] 8254_58LF GAGCAAGTATAAAATCTGATGCCC

[0050] 8254_58RR TAATTGCAAAGTGACTGTAGTGG

[0051] 8254_58SF AGCCTTGAAAACGTTGAAGGTAAT

[0052] 2) 57284_45 primer set:

[0053] 57284_45LF ACGAATCTAGGTAAGCTGACTTC

[0054] 57284_45RRGATGCCTAAGTCAGTTCGAGAG

[0055] 57284_45SF GCCGAAAACGCTTCCGGT

[0056] Synthesized by Shanghai Bioengineering Technology Co., Ltd.;

[0057] (3) PCR amplification:

[0058] PCR reaction solution composition (15 μL):

[0059] 2×TsingKE master mix (Qingke Biotechnology, Beijing) 7.5μL

[0060] 0.2 μL each of 10 μM upstream and downstream primers

[0061] 2 μL 20 ng / μl template DNA

[0062] ddH2O 5.1 μL;

[0063] The amplification reaction was performed on a TC-XP thermal amplification instrument. The amplification conditions were as follows: 94°C pre-denaturation for 300 s, 95°C denaturation for 10 s, 56°C annealing for 50 s, and 72°C extension for 40 s, for a total of 30 cycles, followed by a final fill-in at 72°C for 300 s. The termination temperature was 4°C.

[0064] (4) Electrophoresis: 3 μL of the PCR amplification product from step (3) was mixed with 1 μL of 0.25% bromophenol blue buffer, spotted on a 1.5% agarose gel, and electrophoresed in 1× TAE buffer at 5 V / cm. After electrophoresis, the gel was stained in an aqueous solution containing 0.5 μg / ml EB for 30 minutes and then photographed on a Bio-rad gel imaging system Gel Doc.

[0065] According to the above method, 23 fig varieties (numbered 1-23, representing fig varieties, are as follows: 1, Brooke Red; 2, Grace; 3, Brunswick; 4, Early Yellow; 5, Masyi Dauphin; 6, Strawberry; 7, B1011; 8, Huishankou; 9, Jinaofen; 10, Qinghua; 11, Hongyan; 12, Papa John's; 13, BNR; 14, Hardy; 15, BBR; 16, Baishan; 17, Sala; 18, Rockery; 19, Green Anti-1; 20, Dela; 21, Baiya; 22, California Black; 23, Balaonai) were detected by electrophoresis. The marker used was Takara DL2000. The results of electrophoresis are shown in the table. Figure 3 , Figure 4 ;

[0066] The electrophoresis results showed that only one specific DNA band was amplified from the 8254_58 primer set for the fig variety numbered 2, Grace, and only one specific DNA band was amplified from the 57284_45 primer set. This demonstrates that the molecular-specific marker primer pair developed by the present invention is highly stable and specific for early identification of the fig variety Grace.

Claims

1. The characteristic sequence of the fig variety Grice, which is composed of two coexisting specific DNA fragments, has the following sequence: 1)8254_58： 5'-CCGAACACTCCTCAACATCATCAGCAAAACGCATAGCCTTGAAAACGTTGAA GGTAACCTGTTGGTCGTGAACTCTCATGGTCAATTCACCCTTCTGCACATCTATCAAGGTCCTGCCAGTAGCCANNNNNNNNNNACTTTGGAAGGGCATTATGTGACCTAGGAGCAAGTATAAATCTGATGCCCATGTCTATCTTTAAAAAGCTGGGAATTAGGGAAGCAAGACCCACTACAGTCACTTTGCAATTAGCAGACAGGTCAT-3' 2)57284_45： 5'-CCCTCCTTCTAGCGCCAAAATATTGATGCCGAAAACGCTTCCGGCAGCAACAC CCAATGTGGTCGGGTGGTCCGATCACGTCCGGCCAGTCGCTCCGCCGCAGTCACCTGCAAAACGAACGCACCTNNNNNNNNNNNCCCTATAAATAGGGGAAGAACCCACGAATCTAGGTAAGCTGACTTCTACCTTGCCAAAGCTCTGTCTCCTATCGCTCATCAGCTCTCGAACTGACTTAGGCATCGGAGTGCCCGCGACAGACA-3' Where NNNNNNNNNN is an unknown sequence within 300bp.

2. A primer set for detecting the characteristic sequence of the fig variety Grice according to claim 1, wherein the primer set is composed of the following primer sequences: 1) 8254_58 primer set: 8254_58LF:GAGCAAGTATAAAATCTGATGCCC 8254_58RR:TAATTGCAAAGTGACTGTAGTGG 8254_58SF:AGCCTTGAAAACGTTGAAGGTAAT 2) 57284_45 primer set: 57284_45LF:ACGAATCTAGGTAAGCTGACTTC 5728445RR:GATGCCTAAGTCAGTTCGAGAG 57284_45SF:GCCGAAACGCTTCCGGT.

3. A method for rapidly identifying the fig variety Grace using the molecular specific marker primer set of claim 2, the method comprising: extracting genomic DNA from leaves of the fig variety Grace to be tested as a template, performing PCR amplification using the characteristic sequence primers in groups, and performing electrophoresis detection on the amplified products. If the electrophoresis results show that the 8254_58 primer set only amplifies one specific DNA band, and the 57284_45 primer set also amplifies only one specific DNA band, then the fig variety to be tested is the fig variety Grace; otherwise, it is not. The sequence of the molecular specific marker primer set is: 1) 8254_58 primer set: 8254_58LF:GAGCAAGTATAAAATCTGATGCCC 8254_58RR:TAATTGCAAAGTGACTGTAGTGG 8254_58SF:AGCCTTGAAAACGTTGAAGGTAAT 2) 57284_45 primer set: 57284_45LF:ACGAATCTAGGTAAGCTGACTTC 57284_45RR:GATGCCTAAGTCAGTTCGAGAG 57284_45SF:GCCGAAACGCTTCCGGT.

4. The method according to claim 3, wherein The PCR amplification conditions are as follows: pre-denaturation at 94°C for 300s; Denaturation at 95°C for 30 s, annealing at 56°C for 60 s, and extension at 72°C for 50 s were performed for a total of 30 to 40 cycles; finally, a fill-in at 72°C for 300 s was performed, and the termination temperature was 4°C.

5. The method according to claim 3, wherein The method is as follows: 1) Take the fig leaves to be tested, grind them in liquid nitrogen, and extract the genomic DNA of the fig leaves to be tested using the CTAB method; 2) performing PCR amplification using the genomic DNA extracted in step 1) as a template and the primers in the molecular-specific marker primer set as amplification primers; 3) 3 μL of the amplified product from step 2) was mixed with 1 μL of 0.25% bromophenol blue buffer and spotted on a 1.5% agarose gel. The gel was electrophoresed in 1×TAE buffer at 5 V / cm. After electrophoresis, the gel was stained with EB and photographed on an automated gel image analyzer. If the electrophoresis results showed the characteristic band described in claim 3, the fig variety being tested was Grice; if the characteristic band was not present, the fig variety was not.

Images