Application of dipsacus asper and radix cyathulae stem and leaf compound in feed additive

Abstract

The invention provides application of a dipsacus asper and radix cyathulae stem and leaf compound in a feed additive, and belongs to the technical field of feed. Dipsacus asper stem and leaf powder, radix cyathulae stem and leaf powder and corn flour are compounded, and the feed additive is prepared through double fermentation of bacillus subtilis and lactobacillus plantarum. The fatty acid synthase expression level of fattening pigs fed with the feed additive is remarkably reduced. The lean meat percentage of a control group is 62.75%, the lean meat percentage of a group fed with a conventional traditional Chinese medicine feed additive is 64.35%, the lean meat percentage of a group fed with a fermented traditional Chinese medicine feed additive is 67.87%, and the lean meat percentage is remarkably improved. The pig fattening period of the control group is 104 days, and the feed conversion ratio is 3.02: 1; the fattening period of the pigs fed with the conventional traditional Chinese medicine feed additive group is 101 days, and the feed conversion ratio is 2.94: 1; the fattening period of pigs fed with the fermented traditional Chinese medicine feed additive is shortened to 88 days, the feed conversion ratio is 2.57: 1, and the breeding efficiency is remarkably improved.

Description

Technical Field

[0001] The invention belongs to the technical field of feed, and in particular relates to application of a compound of dipsacus root and cyperus rotundus stems and leaves in feed additives. Background Art

[0002] With rising living standards, the concept of healthy eating is gaining popularity, and meat products high in protein, low in cholesterol, and low in calories are becoming increasingly popular. Meat with a high lean meat percentage, meaning it's low in fat, aligns with modern healthy eating trends. As my country's most consumed meat, high lean meat percentage has become a key characteristic sought by the pig farming industry. Pigs with high lean meat percentages have efficient muscle growth and generally improve feed conversion ratios (FCR), meaning they consume less feed to gain one kilogram of weight, reducing production costs. Pigs with low lean meat percentages require more energy to deposit fat, resulting in lower feed utilization. Pigs with high lean meat percentages (such as Duroc and Landrace) grow faster, shortening time to market and improving capital turnover. Carcasses with high lean meat percentages also have a high meat yield, which better meets the needs of processing companies (for example, lean meat is preferred for further processed products like ham and sausage). Pigs with excessive fat may require additional trimming during slaughter, increasing labor and costs. In most markets (such as China, Europe, and the United States), carcasses with high lean meat percentages are rated higher and command higher prices. For example, in the EU SEUROP classification system, "S" (the best) requires a lean meat percentage of 60% or higher. Slaughterhouses set prices based on lean meat percentage, with a 0.5% to 1% premium for every 1% increase. Processing companies (such as bacon and ham manufacturers) promote the production of high-lean pigs. The fast food industry also demands standardized lean meat ingredients (for example, McDonald's pork patties require a lean meat percentage of 65% or higher).

[0003] Driven by market demand for high-lean pork, clenbuterol (clenbuterol) was once a powerful tool for increasing lean meat percentage in pork. Clenbuterol is a class of substances that promote muscle growth and reduce fat deposition in animals. They are β-adrenergic receptor agonists. The most well-known of these are ractopamine and clenbuterol. They activate β-adrenergic receptors, accelerating lipolysis and inhibiting liposynthesis, allowing more nutrients to be used for muscle growth. However, consuming pork contaminated with clenbuterol can pose serious risks to humans. Serious adverse events involving clenbuterol poisoning have occurred in the past. China has completely banned the use of clenbuterol and implements strict inspections at the breeding and slaughtering stages. Excessive pursuit of lean meat percentage can also lead to stress sensitivity in pigs. For example, certain high-lean meat breeds are susceptible to stress syndrome. Rapid muscle growth can place strains on bones and joints, leading to leg problems. Traditional Chinese medicine has the potential to improve pig health, strengthen bones and muscles, and promote nutritional activity and lipid-protein conversion. Developing traditional Chinese medicine feed additives is a safe and effective way to increase lean meat percentage in pigs. Summary of the Invention

[0004] The invention aims to provide an application of a compound of Radix Dipsaci and Radix Cyathulae stems and leaves in feed additives, belonging to the technical field of feed.

[0005] To achieve the above object, the present invention provides the following technical solutions: First, the present invention provides an application of a compound of Radix Dipsaci and Radix Achyranthis Bidentatae stems and leaves in a feed additive, wherein the feed additive is a compound of Radix Dipsaci and Radix Achyranthis Bidentatae stem and leaf powder and corn flour, and is prepared by dual fermentation with Bacillus subtilis and Lactobacillus plantarum.

[0006] Furthermore, the mass ratio of the Dipsacus asper stem and leaf powder, the Cyathula officinalis stem and leaf powder and the corn flour in the feed additive is 1:1:1.

[0007] Furthermore, the feed additive can be used to increase the lean meat rate of fattening pigs.

[0008] Furthermore, the preparation method of the feed additive is as follows: (1) Authentic Dipsacus root is harvested on the same day as the Dipsacus root, and the stems and leaves of Dipsacus are dried and crushed; (2) Authentic Achyranthes bidentata: harvest the roots of Achyranthes bidentata on the same day, and then harvest the stems and leaves of Achyranthes bidentata, dry them, and crush them; (3) Mix the stem and leaf powder of Radix Dipsaci, the stem and leaf powder of Radix Cyathulae and corn flour in a mass ratio of 1:1:1, add 55% water by weight of the dry powder and stir evenly; (4) According to 1×10 9 CFU / kg was added with Bacillus subtilis, mixed and fermented for 24 hours; (5) According to 1×10 9 Lactobacillus plantarum was added at a concentration of 100 CFU / kg, mixed and fermented for 48 hours; (6) Dry with hot air at 60-80°C until the moisture content is ≤10%, crush with a crusher, and seal in plastic bags for storage.

[0009] Furthermore, the feed additive is mixed into the basic feed at a mass ratio of 1%.

[0010] Beneficial effects: The present invention compounds stem and leaf powder of Dipsacus asper and stem and leaf powder of Cyathula obtusifolia with corn flour, and prepares a feed additive through dual fermentation with Bacillus subtilis and Lactobacillus plantarum. The expression level of fatty acid synthase in fattening pigs fed with the feed additive is significantly lower than that in the control group and the group fed with conventional Chinese medicine feed additives. The lean meat rate of pigs in the control group is 62.75%, the lean meat rate of pigs in the group fed with conventional Chinese medicine feed additives is 64.35%, and the lean meat rate of pigs in the group fed with fermented Chinese medicine feed additives is 67.87%, and the lean meat rate is significantly improved. The fattening period of pigs in the control group is 104 days, and the feed-meat ratio is 3.02:1; the fattening period of pigs in the group fed with conventional Chinese medicine feed additives is 101 days, and the feed-meat ratio is 2.94:1; the fattening period of pigs in the group fed with fermented Chinese medicine feed additives is shortened to 88 days, and the feed-meat ratio is 2.57:1, and the breeding efficiency is significantly improved. The fermented Chinese medicinal feed additive of the present invention is prepared from the non-medicinal parts of pure natural Chinese medicinal plants, has low cost and high safety, and can improve the lean meat rate of pigs while improving breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 Effects of additives on the expression level of fatty acid synthase in pigs; Figure 2 The effect of additives on the pig fattening cycle; Figure 3 The effect of additives on the feed-to-meat ratio of pigs; Figure 4 Effect of additives on lean meat rate of pigs. DETAILED DESCRIPTION

[0012] Example 1: Preparation of conventional Chinese medicinal feed additives (1) Authentic Dipsacus root is harvested on the same day as the Dipsacus root, and the stems and leaves of Dipsacus are dried and crushed; (2) Authentic Achyranthes bidentata: harvest the roots of Achyranthes bidentata on the same day, and then harvest the stems and leaves of Achyranthes bidentata, dry them, and crush them; (3) Mix the stem and leaf powder of Dipsacus asper, the stem and leaf powder of Achyranthes bidentata and corn flour in a mass ratio of 1:1:1 to prepare a feed additive.

[0013] Example 2: Preparation of fermented Chinese medicinal feed additive (1) Authentic Dipsacus root is harvested on the same day as the Dipsacus root, and the stems and leaves of Dipsacus are dried and crushed; (2) Authentic Achyranthes bidentata: harvest the roots of Achyranthes bidentata on the same day, and then harvest the stems and leaves of Achyranthes bidentata, dry them, and crush them; (3) Mix the stem and leaf powder of Radix Dipsaci, the stem and leaf powder of Radix Cyathulae and corn flour in a mass ratio of 1:1:1, add 55% water by weight of the dry powder and stir evenly; (4) According to 1×10 9 CFU / kg was added with Bacillus subtilis, mixed and fermented for 24 hours; (5) According to 1×10 9 Lactobacillus plantarum was added at a concentration of 100 CFU / kg, mixed and fermented for 48 hours; (6) Dry with hot air at 60-80°C until the moisture content is ≤10%, crush with a crusher, and seal in plastic bags for storage.

[0014] Example 3: Effects of Chinese herbal feed additives on fattening pigs (1) 300 healthy Landrace piglets weighing 30±1.5 kg were selected and randomly divided into 3 groups, 100 pigs in each group, and raised in isolation. The pigs in each group were immunized and raised according to the routine immunization program.

[0015] (2) The control group was fed with basal feed; the conventional Chinese medicine feed additive group was fed with 1% by weight of conventional Chinese medicine feed additive mixed into the basal feed; the fermented Chinese medicine feed additive group was fed with 1% by weight of fermented Chinese medicine feed additive mixed into the basal feed. The pigs were fed once at 8:00 and 16:00 each day, with free access to food and water. The health status and activity of the pigs were observed during the period.

[0016] (3) Effects of Chinese herbal feed additives on the expression level of pig fatty acid synthase After one month of feeding with the Chinese herbal feed additive, 10 pigs were randomly selected from each group. 2 mL of anticoagulated peripheral blood was collected, and total RNA was extracted using the Trizol method and reverse transcribed into cDNA. Real-time fluorescence quantitative PCR was used to measure the levels of fatty acid synthase (FASN) mRNA in the peripheral blood of each group using cDNA as a template and GAPDH as a calibrant.

[0017] The primers for fluorescent quantitative PCR are as follows: GAPDH-F:tggacattgtcgccatcaat GAPDH-R: gactgtgccgtggaacttgc FASN-F: ggtctggttcatctgctcag FASN-R:gtccgagcgcaggatggagt Real-time fluorescence quantitative PCR detection reaction system (20 μL): 2×SYBR Green supermix 10 μL F / R (upstream / downstream primer) 0.4 μL / 0.4 μL Template cDNA 0.8 μL ddH2O 8.4μL from Figure 1It can be seen that the expression level of fatty acid synthase in pigs fed with conventional Chinese medicine feed additives was slightly lower than that in the control group fed with only basic feed, and the expression level of fatty acid synthase in pigs fed with fermented Chinese medicine feed additives was significantly lower than that in the conventional Chinese medicine feed additives group and the control group.

[0018] (4) Each group of pigs was raised to an average weight of approximately 110 kg before being marketed. The feeding cycle and feed-to-meat ratio of each group of pigs were calculated. The lean meat percentage of the pigs was determined by carcass segmentation after slaughter. After slaughter, the head, hooves, and internal organs were removed to obtain the carcass. The carcass was segmented into lean meat, fat, bone, and skin according to commercial standards. The lean meat percentage was calculated after weighing: lean meat percentage = lean meat weight / carcass weight × 100%.

[0019] Depend on Figure 2 、 Figure 3 It can be seen that the fattening period of pigs in the control group fed only with basic feed was 104 days, with a feed-to-meat ratio of 3.02:1; the fattening period of pigs in the group fed with conventional Chinese herbal feed additives was 101 days, with a feed-to-meat ratio of 2.94:1; the fattening period of pigs in the group fed with fermented Chinese herbal feed additives was shortened to 88 days, with a feed-to-meat ratio of 2.57:1, and the breeding efficiency was significantly improved.

[0020] Depend on Figure 4 It can be seen that the lean meat rate of pigs in the control group fed only with basic feed was 62.75%; the lean meat rate of pigs in the group fed with conventional Chinese medicine feed additives was 64.35%; and the lean meat rate of pigs in the group fed with fermented Chinese medicine feed additives was 67.87%, and the lean meat rate was significantly improved.

Claims

1. An application of a compound of Radix Dipsaci and Radix Cyathulae stems and leaves in feed additives, characterized in that: The feed additive is prepared by compounding powder of stems and leaves of Radix Dipsaci and Radix Cyathulae with corn flour and undergoing double fermentation with Bacillus subtilis and Lactobacillus plantarum.

2. The use according to claim 1, characterized in that The mass ratio of the Dipsacus asper stem and leaf powder, the Cyathula officinalis stem and leaf powder and the corn flour in the feed additive is 1:1:

1.

3. The use according to claim 1, characterized in that The feed additive can be used to increase the lean meat rate of fattening pigs.

4. The use according to claim 1, characterized in that The preparation method of the feed additive is as follows: (1) Authentic Dipsacus root is harvested on the same day as the Dipsacus root, and the stems and leaves of Dipsacus are dried and crushed; (2) Authentic Achyranthes bidentata: harvest the roots of Achyranthes bidentata on the same day, and then harvest the stems and leaves of Achyranthes bidentata, dry them, and crush them; (3) Mix the stem and leaf powder of Radix Dipsaci, the stem and leaf powder of Radix Cyathulae and corn flour in a mass ratio of 1:1:1, add 55% water by weight of the dry powder and stir evenly; (4) According to 1×10 9 CFU / kg was added with Bacillus subtilis, mixed and fermented for 24 hours; (5) According to 1×10 9 Lactobacillus plantarum was added at a concentration of 100 CFU / kg, mixed and fermented for 48 hours; (6) Dry with hot air at 60-80°C until the moisture content is ≤10%, crush with a crusher, and seal in plastic bags for storage.

5. The use according to claim 1, characterized in that The feed additive is mixed into the basic feed at a mass ratio of 1%.

Images