Application of lactobacillus johnsonii in prevention and treatment of radiation-induced lung injury

Abstract

The invention provides application of lactobacillus johnsonii in prevention and treatment of radiation-induced lung injury, and belongs to the technical field of biological medicine. The invention provides an application of lactobacillus johnsonii in preparation of a medicine for preventing and / or treating radioactive injury, and discovers that the lactobacillus johnsonii can improve weight loss and lung coefficient increase of mice caused by ionizing radiation, and also can relieve physiological injury caused by ionizing radiation. After the mouse is treated by the about lactobacillus, the damage of irradiation to the lung coefficient and respiratory function of the mouse is improved. The invention proves that the radiation-induced lung injury of mice can be improved by administration of the lactobacillus.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and particularly relates to the application of Lactobacillus johnsonii in preventing and treating radiation-induced lung injury. Background Art

[0002] Radiation-induced lung injury (RILI) is a common complication of radiotherapy for thoracic tumors. Clinically, it is divided into early-stage radiation-induced pneumonia and late-stage radiation-induced pulmonary fibrosis (RIPF). Clinical symptoms include retching, shortness of breath, chest pain, fever, and can even lead to respiratory failure and death. Current treatment primarily consists of glucocorticoids, anti-infectives, and symptomatic supportive care, which only improve symptoms but do not provide effective treatment.

[0003] Amifostine is the first pan-cell protective agent approved by the US FDA. Continuous research by clinicians has revealed that amifostine can protect normal cells from damage caused by radiotherapy rays and chemotherapy drugs. However, amifostine has significant side effects, such as gastrointestinal dysfunction, hypotension, and hypocalcemic tetany. Therefore, identifying drug intervention targets with diagnostic potential is of great clinical value in the prevention and treatment of radiation-induced lung injury. Summary of the Invention

[0004] The present invention provides the use of Lactobacillus johnsonii in preventing and treating radiation-induced lung injury. The Lactobacillus johnsonii has a significant preventive and therapeutic effect on radiation-induced lung injury.

[0005] The present invention provides the use of Lactobacillus johnsonii in preparing a medicine for preventing and / or treating radiation damage.

[0006] In a preferred embodiment of the present invention, the dosage form of the drug includes an oral dosage form.

[0007] In a preferred embodiment of the present invention, the daily dosage of Lactobacillus johnsonii in the drug is not less than 10 8 CFU / d.

[0008] In a preferred embodiment of the present invention, the radiation damage includes radiation-induced weight loss and / or radiation-induced lung injury.

[0009] In a preferred embodiment of the present invention, the radiation-induced lung injury includes radiation-induced pulmonary fibrosis.

[0010] In a preferred embodiment of the present invention, the prevention and / or treatment includes at least one of the following: improving radiation-induced weight loss, improving radiation-induced respiratory dysfunction, reducing radiation-induced tissue inflammatory factor levels, and improving radiation-induced pulmonary fibrosis.

[0011] In a preferred embodiment of the present invention, the detection index of respiratory dysfunction includes at least one of the following: conductivity parameters such as maximum inspiratory flow, maximum expiratory flow, tidal volume, and airway obstruction parameter such as airway stenosis index.

[0012] The present invention also provides a medicine for preventing and / or treating radiation damage, which contains Lactobacillus johnsonii as an active ingredient and further comprises pharmaceutically acceptable excipients.

[0013] In a preferred embodiment of the present invention, when the drug is administered in the form of a solution, PBS is used as the solvent.

[0014] In a preferred embodiment of the present invention, the daily dosage of Lactobacillus johnsonii in the drug is not less than 10 8 CFU / d.

[0015] Beneficial effects: The present invention provides the use of Lactobacillus johnsonii in the preparation of drugs for preventing and / or treating radiation damage. The examples of the present invention confirm that the content of Lactobacillus johnsonii in mouse feces decreases after four months of ionizing radiation. At the same time, experiments on mice exposed to ionizing radiation show that Lactobacillus johnsonii can improve the weight loss of mice caused by ionizing radiation, increase the lung coefficient, and alleviate the physiological damage caused by ionizing radiation. After treatment with Lactobacillus johnsonii, the damage to the lung coefficient and respiratory function of mice caused by radiation was improved. In order to further clarify the therapeutic effect of Lactobacillus johnsonii on the early inflammatory stage of radiation-induced pulmonary fibrosis, the inflammatory infiltration of mouse lung tissue and the degree of alveolar structural damage were analyzed by staining the results of mouse lung tissue pathological sections. It was found that the inflammatory cell infiltration was improved after one month of treatment with Lactobacillus johnsonii, and the alveolar septa gradually returned to normal. Subsequently, the mouse lung tissue pathological sections were Masson stained and semi-quantitatively scored, and it was found that collagen deposition was improved after administration of Lactobacillus johnsonii. The present invention confirms that administration of Lactobacillus johnsonii can improve radiation-induced lung damage in mice. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The results of the effects of irradiation on the intestinal flora of mice are shown in Figure A: Alpha analysis, B: Observed_species index, C: Shannon index, and D: Lactobacillus yolkiolyticus content; Figure 2 This is the experimental flow chart and results of Lactobacillus yolkiolyticus improving radiation-induced pulmonary fibrosis. In the figure, A: experimental flow chart, B: body weight, C: lung coefficient; Figure 3 The results of the improvement of physiological indicators of mice induced by irradiation by Lactobacillus yolkii are shown in Figure A: PIF, B: Penh, C: PEF; Figure 4 This figure shows the improvement of the damage to the respiratory function of the lung coefficient of mice after irradiation after treatment with Lactobacillus yoelii. In the figure, A: the expression level of the inflammatory factor IL-1β in serum, B: the expression level of the inflammatory factor IL-6 in serum, C: the expression level of the inflammatory factor IL-1β in lung tissue, and D: the expression level of the inflammatory factor IL-6 in lung tissue. Figure 5 Figure 2 is the pathological staining result of lung tissue sections, A: HE staining result, B: semi-quantitative scoring result; Figure 6 These are the results of pathological staining of lung tissue sections, A: MASSON staining results, B: collagen quantification results. DETAILED DESCRIPTION

[0017] The present invention provides the use of Lactobacillus johnsonii in preparing a medicine for preventing and / or treating radiation damage.

[0018] The Lactobacillus johnsonii of the present invention ( Lactobacillus johnsonii ) was purchased from BNCC Beina Biotechnology with the product number 186384, and the product form was 200 μL lyophilized powder.

[0019] In a preferred embodiment of the present invention, the dosage form of the drug includes an oral dosage. In a preferred embodiment of the present invention, the daily dosage of Lactobacillus johnsonii in the drug is not less than 10 8 CFU / d.

[0020] In a preferred embodiment of the present invention, the radiation damage includes radiation-induced weight loss and / or radiation-induced lung injury, and specifically the radiation-induced lung injury includes radiation-induced pulmonary fibrosis.

[0021] In a preferred embodiment of the present invention, the prevention and / or treatment includes at least one of the following: improving radiation-induced weight loss, improving radiation-induced respiratory dysfunction, reducing radiation-induced tissue inflammatory cytokine levels, and improving radiation-induced pulmonary fibrosis. The respiratory dysfunction detection indicators of the present invention include at least one of the following: conductivity parameters such as maximum inspiratory flow, maximum expiratory flow, tidal volume, and airway obstruction parameter such as airway stenosis index.

[0022] The present invention also provides a medicine for preventing and / or treating radiation damage, which contains Lactobacillus johnsonii as an active ingredient and further comprises pharmaceutically acceptable excipients.

[0023] In a preferred embodiment of the present invention, when the drug is administered in the form of a solution, PBS is used as the solvent. During preparation, the bacterial solution can be centrifuged at 3000 rpm for 5 minutes and then resuspended in PBS.

[0024] In a preferred embodiment of the present invention, the daily dosage of Lactobacillus johnsonii in the drug is not less than 10 8 CFU / d.

[0025] To further illustrate the present invention, the application of Lactobacillus johnsonii provided by the present invention in preventing and treating radiation-induced lung injury is described in detail below with reference to the following examples, but these examples should not be construed as limiting the scope of protection of the present invention.

[0026] Example 1 High-throughput 16S rRNA gene sequencing was performed on feces of C57BL / 6J mice irradiated (20 Gy γ-ray single whole-chest partial irradiation) for one month. Alpha analysis of generalized linear models revealed 277 OTUs (Operational Taxonomic Units) shared by the non-irradiated NC group and the irradiated IR group, 243 OTUs unique to the NC group, and 95 OTUs unique to the IR group ( Figure 1 (A). This suggests that radiation-induced lung injury leads to a decrease in OTUs compared to normal mice. Alpha Diversity analysis was used to analyze microbial community diversity. Compared with the NC group, the IR group showed a statistically significant decrease in observed species and Shannon index ( Figure 1 Figures B and C indicate that the number of intestinal flora species in mice with radiation-induced lung injury is reduced. RT-qPCR analysis of the whole genome of feces from mice with radiation-induced lung fibrosis revealed a decrease in the number of Lactobacillus johnsonii in feces four months after ionizing radiation ( Figure 1 Middle D).

[0027] The primers used for RT-qPCR detection are as follows: MLF (SEQ ID No. 1): TCGAGCGAGCTTGCCTAGATGA; MLR (SEQ ID No. 2): TCCGGACAACGCTTGCCACC.

[0028] Example 2 1. Animal experiment: Each mouse was gavage-fed with 5×10 8 CFU / mL of bacterial solution was gavaged daily at 200 μL. One week after gavage, the whole chest was irradiated with a single dose of 20 Gy γ-rays.

[0029] The experimental animals were divided into three groups: NC+Vehicle: simple oral gavage with PBS group; IR+Vehicle: simple oral gavage with PBS+irradiation group; IR+LJ: oral administration of Lactobacillus johnsonii + irradiation group; For gavage, Lactobacillus johnsonii was used: the bacterial solution was cultured statically and quantified to 5×10 8 After quantification, the bacterial solution was centrifuged at 3000 rpm for 5 min, the culture medium was discarded, and 2 mL of PBS was added for resuspending.

[0030] 2. Experimental process: NC+Vehicle group: Adaptive feeding for one week followed by oral gavage with PBS for one week; IR+Vehicle group: After one week of adaptive feeding, rats were gavaged with PBS for one week and then received a single 20 Gy γ-ray whole-chest irradiation. IR+LJ group: After one week of adaptive feeding, rats were gavaged with Lactobacillus johnsonii for one week and then received a single 20 Gy γ-ray whole-chest local irradiation. After irradiation, the mice were fed for 30 days and samples were collected to observe the weight, lung coefficient, and HE and Masson staining results of the lung tissue.

[0031] 4. Experimental results 4.1 Lactobacillus johnsonii improves radiation-induced pulmonary fibrosis The present invention uses 8-week-old male C57BL / 6J mice to establish a radiation-induced pulmonary fibrosis mouse model. First, C57BL / 6J mice were gavaged with Lactobacillus yoelii for one week, and then received 20 Gy 60 The mice were irradiated with Co γ-rays in a single shot. The body weight was monitored dynamically at different times after irradiation. The body weight and respiratory function of the mice were tested 1 month after irradiation. The results were as follows: Figure 2 As shown in the figure, the weight of mice decreased significantly one month after irradiation, but recovered after administration of Lactobacillus johnsonii. The lung coefficient of mice increased significantly one month after irradiation, but decreased after administration of Lactobacillus johnsonii, indicating that Lactobacillus johnsonii can improve the weight loss of mice caused by IR ( Figure 2 Middle B), lung coefficient increased ( Figure 2 Middle C).

[0032] 4.2 Improvement of physiological indicators of mice induced by irradiation by Lactobacillus yolk The present invention dynamically monitors the changes in respiratory function indicators of mice at different time points within five minutes after irradiation. Figure 3As shown in the figure, one month after irradiation, the conductive parameters of mice, maximum inspiratory flow (PIF) and maximum expiratory flow (PEF), decreased. After intraperitoneal administration of Lactobacillus yoelii, the maximum inspiratory flow and tidal volume recovered ( Figure 3 A and C in the middle); the airway obstruction parameter airway stenosis index (Penh) increased after irradiation and decreased after administration of Lactobacillus yolkiolyticus ( Figure 3 (B) This indicates that Lactobacillus johnsonii can alleviate the physiological damage caused by ionizing radiation.

[0033] 4.3 After treatment with Lactobacillus yoelii, the damage to the lung coefficient and respiratory function of mice caused by irradiation was improved.

[0034] Collect 20 Gy 60 One month after a single whole-thorax irradiation with Co γ-rays, the expression levels of inflammatory factors IL-1β and IL-6 were detected in the serum and lung tissues of mice by ELISA and RT-qPCR.

[0035] Primer information is as follows: Internal control-F (SEQ ID No. 3): TGCTGTCCCTGTATGCCTCT; Internal control-R (SEQ ID No. 4): TTTGATGTCACGCACGATTT; IL-1β-F (SEQ ID No. 5): GAAATGCCACCTTTTGACAGTG; IL-1β-R (SEQ ID No. 6): TGGATGCTCTCATCAGGACAG; IL-6-F (SEQ ID No. 7): CTGCAAGAGACTTCCATCCAG; IL-6-R (SEQ ID No. 8): AGTGGTATAGACAGGTCTGTTGG.

[0036] The results are as follows Figure 4 As shown, Lactobacillus yoelii can improve the increase of serum inflammatory factors in mice caused by irradiation ( Figure 4 A and B in the middle), and can also alleviate the increase of inflammatory factors in the lung tissue of mice caused by irradiation ( Figure 4 (C, D) indicate that Lactobacillus johnsonii can alleviate lung damage caused by ionizing radiation.

[0037] 4.4 Therapeutic effect of Lactobacillus yoskylosis on the pre-inflammatory stage of radiation-induced pulmonary fibrosis The present invention analyzes the inflammatory infiltration of mouse lung tissue and the degree of alveolar structure damage through the staining results of mouse lung tissue pathology. Figure 5As shown in the figure, H&E staining of lung tissue showed that the alveolar septa in the lung tissue of mice became wider and the degree of inflammatory cell infiltration increased significantly after irradiation. After one month of treatment with Lactobacillus yolkii, the inflammatory cell infiltration was improved and the alveolar septa gradually returned to normal.

[0038] The pathological sections of mouse lung tissue were stained with Masson staining and semi-quantitatively scored. Figure 6 As shown, collagen deposition was improved after Lactobacillus yolkiolyticus administration.

[0039] In conclusion, administration of Lactobacillus yolkiolyticus can improve radiation-induced lung injury in mice.

[0040] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. Use of Lactobacillus johnsonii in the preparation of a medicament for preventing and / or treating radiation damage.

2. The application according to claim 1, characterized in that The dosage form of the drug includes oral dosage form.

3. The use according to claim 1 or 2, characterized in that: The daily dosage of Lactobacillus johnsonii in the drug is not less than 10 8 CFU / d.

4. The application according to claim 1, characterized in that The radiation damage includes radiation-induced weight loss and / or radiation-induced lung injury.

5. The application according to claim 4, characterized in that: The radiation-induced lung injury includes radiation-induced pulmonary fibrosis.

6. The application according to claim 1, characterized in that: The prevention and / or treatment includes at least one of the following: improving radiation-induced weight loss, improving radiation-induced respiratory dysfunction, reducing radiation-induced tissue inflammatory factor content, and improving radiation-induced pulmonary fibrosis.

7. The use according to claim 6, characterized in that The detection index of respiratory dysfunction includes at least one of the following: conductivity parameters such as maximum inspiratory flow, maximum expiratory flow, tidal volume, and airway obstruction parameter such as airway stenosis index.

8. A drug for preventing and / or treating radiation damage, characterized in that: The invention uses Lactobacillus johnsonii as an active ingredient and further comprises pharmaceutically acceptable excipients.

9. The drug according to claim 8, characterized in that When the drug is administered in the form of a solution, PBS is used as the solution.

10. The drug according to claim 8 or 9, characterized in that The daily dosage of Lactobacillus johnsonii in the drug is not less than 10 8 CFU / d.

Images