Fungus for promoting growth of saussurea involucrata seedlings, and preparation method and application thereof
By promoting the growth and root development of snow lotus seedlings through the use of the dark-colored septate endophytic fungal strain SI-16, the problem of snow lotus being difficult to cultivate on a large scale has been solved, and the growth and environmental adaptability of snow lotus seedlings have been enhanced.
Patent Information
- Application Number
- CN202510910463.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-02
- Publication Date
- 2026-01-23
- Estimated Expiration
- 2045-07-02
AI Technical Summary
The number of snow lotus flowers is decreasing, making large-scale artificial cultivation difficult. Existing technologies lack effective fungi to promote the growth of snow lotus seedlings, leading to the depletion of resources.
A dark-colored septate endophytic fungal strain SI-16 (Leptodophorasp.) is provided. By preparing it and inoculating it into a substrate, it promotes the growth and root development of snow lotus seedlings, enhances the antioxidant capacity of seedlings, and improves their environmental adaptability.
It promotes the growth and root development of snow lotus seedlings, enhances the antioxidant capacity of seedlings, improves environmental adaptability, and enables the artificial cultivation of snow lotus.
Smart Images
Figure CN120624229B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of microbial technology, in particular to a fungus for promoting the growth of Saussurea involucrata seedlings and a preparation method and application thereof. BACKGROUND
[0002] Saussurea involucrata Kar. et Kir. Saussurea involucrate , also known as Saussurea involucrata, is a medicinal plant of the Asteraceae family. Saussurea involucrata in China is mainly distributed in the Tianshan Mountains, the Altai Mountains and the Kunlun Mountains of Xinjiang Uygur Autonomous Region, and grows in the cold and frozen weathering zone of alpine ice and stone slopes, valleys, cracks, water edges and meadows at an altitude of 2400-4100m. Saussurea involucrata is a perennial plant that flowers and bears fruit once a year, and its life cycle under wild conditions is 5-8 years. At present, Saussurea involucrata cannot be artificially planted on a large scale, and the medicinal material completely depends on wild resources. Due to long-term overexploitation and insufficient resource protection measures, the number of Saussurea involucrata has decreased, and the plant resources are close to exhaustion. In 2021, Saussurea involucrata was listed as a national second-class protected wild plant.
[0003] The dry aboveground parts of Saussurea involucrata Kar. et Kir. are used as Uygur traditional medicine and are recorded in the 2025 edition of Chinese Pharmacopoeia. Uygur medicine believes that Saussurea involucrata has the functions of tonifying kidney and promoting blood circulation, strengthening bones and tendons, nourishing nerves, and regulating abnormal body fluids, and is used for the treatment of rheumatoid arthritis, joint pain, cold cough, cold pain in the kidney and small abdomen, and excessive leukorrhea. Traditional Chinese medicine believes that Saussurea involucrata has the functions of warming kidney and assisting yang, dispelling wind and dampness, and promoting blood circulation, and is used for the treatment of arthralgia due to wind, cold and dampness, rheumatoid arthritis, cold pain in the small abdomen, and irregular menstruation. Modern research shows that Saussurea involucrata contains various phenylpropanoids, flavonoids, coumarins and sesquiterpenes, and has various pharmacological activities such as anti-inflammatory, anti-aging, antioxidant and anti-tumor activities.
[0004] Dark septate endophytes (DSE) refer to a group of small soil fungi that colonize in plant roots, and their functions are not clear. The general characteristics of DSE are that the mycelium is dark in color, has obvious septa, and can form microsclerotia in plant root cells or intercellular space, but will not form pathological characteristics caused by pathogenic fungi. According to existing reports, the host range of DSE is very wide, especially in low temperature, drought, saline-alkali and heavy metal pollution habitats, and DSE is a major group of endophytic fungi in Saussurea involucrata root tissues. It is found that the fungi in Saussurea involucrata root endophytic fungi are beneficial to the survival and growth of Saussurea involucrata seedlings, and the fungi are applied to the seedling cultivation of Saussurea involucrata, which has a credible theoretical basis and good application prospect. Therefore, it is necessary to develop a new endophytic fungus that can promote the growth and development of Saussurea involucrata seedlings. SUMMARY
[0005] In order to solve the above-mentioned deficiencies existing in the prior art, the purpose of the present application is to provide a fungus for promoting the growth of Saussurea involucrata seedlings and a preparation method and application thereof, so as to promote the growth and root development of Saussurea involucrata seedlings, enhance the antioxidant capacity of seedlings, and improve the environmental adaptability of seedlings.
[0006] The technical scheme for solving the above-mentioned technical problems of the present application is as follows: a fungus for promoting the growth of Saussurea involucrata seedlings is provided, the strain of the fungus is named SI-16, belongs to Leptodophora sp., and was preserved in the China General Microbiological Culture Collection Center on June 9, 2025, with the preservation number of CGMCC No.42028.
[0007] Further, the fungus colony is round, gray-black, the surface is felt-like, the aerial hypha is not developed, the hypha is dark brown, has septa, and occasionally branches, and no conidium is observed.
[0008] Further, the ribosomal internal transcribed spacer sequence, the second RNA polymerase II gene sequence and the ß-tubulin gene sequence of the fungus are respectively shown as SEQ ID NO.1-SEQ ID NO.3.
[0009] The present application provides a preparation method of the above-mentioned fungus, comprising the following steps: uniformly mixing sawdust and wheat bran, adding water and stirring uniformly, then sterilizing the substrate in a strain bottle by 121 DEG C steam, and then inoculating PDA fungus slices of the strain SI-16 after cooling, and then dark culture for 55-65 days until the hypha covers half to two-thirds of the substrate volume.
[0010] Further, the volume ratio of the sawdust and the wheat bran is 2-5:1.
[0011] Further, the water content of the substrate is 30-40%.
[0012] Further, the temperature of the dark culture is 18-22 DEG C.
[0013] The present application provides the application of the above-mentioned fungus in promoting the growth and development of Saussurea involucrata seedlings.
[0014] Further, the fungus for promoting the growth of Saussurea involucrata seedlings is adding the solid culture of the strain SI-16 in the substrate when Saussurea involucrata seeds are sowed or Saussurea involucrata seedlings are transplanted.
[0015] The present application also provides a preparation for promoting the growth of Saussurea involucrata seedlings, and the preparation comprises the solid culture of the above-mentioned fungus.
[0016] The present application has the following beneficial effects: a new dark septate endophytic fungus is found, the strain of which is named SI-16, and it is identified that it belongs to LeptodophoraThe strain SI-16 was deposited in China General Microbiological Culture Collection Center on June 9, 2025, and the deposit number is CGMCC No. 42028. It is found through experiments that the strain SI-16 can produce multiple hydrolytic enzymes such as sucrose and phosphatase, and can produce plant hormones such as auxins, cytokinins and gibberellins. After adding the solid culture of the strain SI-16 to the substrate when the seeds of Saussurea involucrata are sown or when the seedlings of Saussurea involucrata are transplanted or translocated, the growth and root development of the seedling of Saussurea involucrata can be promoted, the oxidation resistance of the seedling can be enhanced, and the environmental adaptability of the seedling can be improved. Therefore, the strain SI-16 can be used for artificial planting of Saussurea involucrata. BRIEF DESCRIPTION OF DRAWINGS
[0017] Figure 1 Fig. 1 is a colony and mycelium diagram of the strain SI-16. DETAILED DESCRIPTION
[0018] The following examples are only used to explain the present application, and are not used to limit the scope of the present application. If the specific conditions are not indicated in the examples, the conventional conditions or the conditions recommended by the manufacturer are used. If the manufacturers of the reagents or instruments are not indicated, they are all conventional products that can be purchased on the market.
[0019] SI-16 is an endophytic fungus isolated from the roots of Primula Primula matthioli The strain SI-16 has the morphological characteristics of DSE. In the sampling habitat Primula matthioli The strain SI-16 grows together with Saussurea involucrata. By observing the roots of Saussurea involucrata co-cultured with SI-16, it is found that SI-16 can colonize in the roots of Saussurea involucrata, so SI-16 is an endophytic fungus of Saussurea involucrata. This result is consistent with the generally accepted DSE lacking strict host specificity.
[0020] Example 1: Preparation of the solid culture of the strain SI-16
[0021] Sawdust and wheat bran are uniformly mixed at a volume ratio of 3:1, and water is added and mixed uniformly to keep the water content of the substrate at 35%. Then the substrate is divided and packed in polypropylene culture bottles (the substrate loading amount is 75% of the volume of the culture bottle), and then sterilized by steam at 121°C for 2 hours, and then cooled to access the PDA culture piece of the strain SI-16, and placed at 20°C for dark culture for 60 days. When the mycelium covers half to two-thirds of the volume of the substrate, it can be used.
[0022] Characteristics of the strain SI-16: it can grow at 4-25°C, and grows fastest at 15-20°C, the colony diameter is 4.5-5cm after 20 days of PDA culture; the colony is round, gray-black, the surface is felt-like, and the aerial mycelium is not well developed; the mycelium is dark brown, has septa, occasionally branches, and no conidia are found (see Figure 1). The ribosomal internal transcribed spacer (ITS) sequence, the second RNA polymerase II (RPB2) gene sequence and the beta-tublin gene sequence of the strain SI-16 are shown in SEQ ID NO. 1-3, respectively.
[0023] Example 2: Fungal infection rate of seedling roots when the strain SI-16 is co-cultured with seedlings of Saussurea involucrata
[0024] (1) The Pinus matrix and the vermiculite are uniformly mixed at a volume ratio of 3:1, and water is added and mixed evenly, which is the seedling culture medium. The seedling culture medium is divided and packaged in PC plastic tissue culture bottles, with a filling height of 3 cm, 121 ℃ steam sterilization for 3 hours, and then used after cooling.
[0025] (2) The seedlings and seeds of Saussurea involucrata are inoculated into the tissue culture bottles of step (1) respectively, and the specific operation is as follows:
[0026] ① The aseptic seedlings of Saussurea involucrata with 2 cotyledons and root length of 0.8-1.2 cm are inoculated into the tissue culture bottles of step (1), and then the SI-16 PDA fungus pieces are inoculated. Then the tissue culture bottles are placed at culture temperatures of 15℃, 20℃ and 25℃, respectively, with 12h light: 12h darkness, light intensity of 3000-5000 lx, and cultured for 6 weeks.
[0027] ② The surface-sterilized seeds of Saussurea involucrata are inoculated into the tissue culture bottles of step (1), and then the SI-16 solid strain and SI-16 PDA fungus pieces are inoculated, respectively. The above tissue culture bottles are placed under the conditions of 12h light / 20℃, 12h darkness / 10℃, light intensity of 5000-7000 lx and cultured for 6 weeks.
[0028] (3) After the culture is completed, the seedlings of step (2) are taken out, the roots are cut into small pieces of 4-6 mm, stained with acid fuchsin, and the fungal colonization in the root tissue is observed under an optical microscope to calculate the infection rate. The calculation results are as follows: the fungal infection rates of seedling roots cultured at constant temperatures of 15℃, 20℃ and 25℃ are all greater than 95%; the fungal infection rates of seedling roots cultured at alternating temperatures of 20℃ / 10℃ are all greater than 90%.
[0029] Example 3: The ability of strain SI-16 to produce hydrolytic enzymes and antioxidant enzymes and to produce plant hormones
[0030] (1) The Pinus matrix and the vermiculite are uniformly mixed at a volume ratio of 3:1, and water is added and mixed evenly, which is the seedling culture medium. The seedling culture medium is divided and packaged in PC plastic tissue culture bottles, with a filling height of 3.5 cm, 121 ℃ steam sterilization for 3 hours, and then used after cooling.
[0031] (2) The diameter of 1 cm of strain SI-16 PDA fungus piece is connected to the seedling raising substrate of step (1), which is recorded as F group. The seedling of Saussurea involucrata with 2 cotyledons and root length of 0.8-1.2 cm is connected to the seedling raising substrate of step (1), which is recorded as P group. The seedling of Saussurea involucrata and SI-16 PDA fungus piece are connected to the seedling raising substrate of step (1) in turn, which is recorded as FP group. The above 3 groups are cultured for 27 days under the condition of 20℃, 12h light: 12h dark, light intensity of 5000-7000 lx, and the sterile seedling raising substrate is blank control group (CK).
[0032] (3) The activities of acid phosphatase, alkaline phosphatase, sucrose, urease and catalase in the substrates of the above 4 groups are detected, and the results are shown in Table 1. As shown in Table 1, compared with CK, the activities of the 5 enzymes in the substrate of F group are significantly improved (P<0.05), which indicates that strain SI-16 can produce hydrolytic enzymes and antioxidant enzymes. Compared with P group, the activities of the 5 enzymes in the substrate of FP group are significantly improved (P<0.05), which indicates that when strain SI-16 is cultured with Saussurea involucrata seedlings, the activities of hydrolytic enzymes and antioxidant enzymes in the substrate are significantly improved due to the effect of SI-16.
[0033] Table 1 Enzyme activity in the substrate (n=3)
[0034]
[0035] Note: * indicates significant difference (P<0.05) compared with CK; # indicates significant difference (P<0.05) compared with P.
[0036] The contents of various plant hormones in the substrates of the above 4 groups are detected, and the results are shown in Table 2. As shown in Table 2, compared with CK, the contents of 4 auxin hormones (methyl indole acetic acid, indole acetic acid, indole butyric acid and indole-3-carboxylic acid), 2 gibberellin hormones (gibberellin GA1 and gibberellin GA3) and 6 cytokinin hormones (trans-zeatin, trans-zeatin riboside, dihydro-zeatin riboside, isopentenyladenosine, isopentenyladenosine riboside and cis-zeatin) in the substrate of F group are significantly improved (P<0.05), which indicates that strain SI-16 can produce auxin, gibberellin and cytokinin plant hormones. Compared with P group, the contents of 2 auxin hormones (methyl indole acetic acid and indole acetic acid) and 4 cytokinin hormones (trans-zeatin riboside, isopentenyladenosine, isopentenyladenosine riboside and cis-zeatin) in the substrate of FP group are significantly improved (P<0.05), which indicates that when strain SI-16 is cultured with Saussurea involucrata seedlings, the contents of 2 auxin hormones and 4 cytokinin hormones in the substrate are significantly improved due to the effect of strain SI-16.
[0037] The above results show that the strain SI-16 can produce multiple hydrolytic enzymes such as sucrose and phosphatase, and can produce plant hormones such as auxins, cytokinins and gibberellins.
[0038] Table 2 Plant hormone content in the substrate (ng / g, n=3)
[0039]
[0040] Note: * indicates a significant difference compared with CK (P<0.05); # indicates a significant difference compared with P (P<0.05).
[0041] Example 4: Effect of co-culturing strain SI-16 with Saussurea involucrata seedlings at 20°C on the seedlings
[0042] (1) Mix the Pin's substrate and vermiculite at a volume ratio of 3:1, and mix well with water. This is the seedling substrate. Divide the seedling substrate into PC plastic tissue culture bottles, fill to a height of 3 cm, and sterilize at 121°C for 3 hours. After cooling, use.
[0043] (2) Insert Saussurea involucrata seedlings with 2 cotyledons and root length of 0.8-1.2 cm into the seedling substrate of step (1), and mark as the control group. Insert Saussurea involucrata seedlings and SI-16 PDA slices into the seedling substrate of step (1) in turn, and mark as the treatment group. The above two groups are cultured at 20°C, 12h light: 12h dark, light intensity 5000-7000 lx for 27 days. Randomly select 12 seedlings from each group, separate the leaves and roots, dry them at 60°C, weigh the dry weight, and calculate the total plant dry weight. Take fresh leaves from each group of seedlings, and measure the contents of malondialdehyde (MDA), proline (PRO) and soluble sugar (SS), and the activities of superoxide dismutase (SOD), peroxidase (POD) and catalase (CAT). The results are shown in Table 3.
[0044] As shown in Table 3, the dry weights of the roots, leaves and whole plants of the treatment group were higher than those of the control group, but there was no significant difference (P>0.05). There was no significant difference in MDA content between the leaves of the treatment group and the control group (P>0.05). Compared with the control group, the activities of POD and CAT in the treatment group were significantly increased (P<0.05), indicating that co-culturing with strain SI-16 at 20°C can improve the antioxidant capacity of Saussurea involucrata seedlings.
[0045] Table 3 Effect of co-culturing strain SI-16 with Saussurea involucrata seedlings at 20°C on the seedlings
[0046] (Leaf dry weight, root dry weight and total plant dry weight, n=12; other indicators, n=3)
[0047]
[0048] Note: * indicates a significant difference (P <0.05) compared with the control group.
[0049] Example 5: Effect of co-culturing of strain SI-16 and Saussurea involucrata seedlings at 20℃ / 10℃ on seedlings
[0050] (1) Mix Ping's medium and vermiculite at a volume ratio of 3:1, add water and mix well, which is the seedling culture medium. Divide the seedling culture medium into PC plastic tissue culture bottles, fill to a height of 3.5 cm, sterilize at 121℃ for 3 hours, and use after cooling.
[0051] (2) Surface-sterilized Saussurea involucrata seeds were inoculated into the tissue culture bottles of step (1), which were designated as the control group. Saussurea involucrata seeds and SI-16 solid bacterial inoculum were sequentially inoculated into the tissue culture bottles of step (1), which were designated as the treatment group. The two groups of tissue culture bottles were placed in conditions of 12h light / 20℃, 12h darkness / 10℃, and light intensity of 5000-7000 lx for 40 days. Then 12 seedlings were randomly selected from each group, the leaves and roots were separated, dried at 60℃, weighed, and the total dry weight was calculated. Fresh leaves of seedlings from each group were taken, and the contents of malondialdehyde (MDA), proline (PRO), and soluble sugar (SS) were measured, as well as the activities of superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT). The results are shown in Table 4.
[0052] As shown in Table 4, the root dry weight and total dry weight of the seedlings in the treatment group were 1.95 and 1.22 times those of the control group (P <0.05), respectively, and the leaf dry weight was slightly higher than that of the control group, but there was no significant difference (P >0.05), indicating that under the culture conditions of 20℃ / 10℃, strain SI-16 mainly promoted the growth and development of the root system to increase the biomass of Saussurea involucrata seedlings. There was no significant difference in the MDA content of the leaves between the treatment group and the control group (P >0.05). Compared with the control group, the PRO and SS contents of the leaves in the treatment group were significantly reduced (P <0.05), indicating that the seedlings in the treatment group had stronger low-temperature adaptability. Compared with the control group, the activities of SOD, POD, and CAT in the leaves of the treatment group were significantly increased (P <0.05), indicating that the seedlings in the treatment group had stronger antioxidant capacity.
[0053] Table 4 Effect of co-culturing of strain SI-16 and Saussurea involucrata seedlings at 20℃ / 10℃ on seedlings
[0054] (Leaf dry weight, root dry weight, and total dry weight, n=12; other indicators, n=3)
[0055]
[0056] Note: * indicates a significant difference (P <0.05) compared with the control group.
[0057] The ribosome internal transcription spacer (ITS) sequence, the second RNA polymerase II (RPB2) gene sequence and the beta-tublin gene sequence of the strain SI-16 in the application are respectively shown as follows:
[0058] (1) ITS: ATGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAACCTTAAAAAAATTGGGGGTTGCTGGCAAGTAGACCTACCGGACTCAATCGCGAGGAGTATTACTACGCGTAGAGCCGACAGGCACCGCCACTGATTTTAGGGGCCGCGGAACCGCGAACCCCAAGACCAAGCGAGAGCTTGAGTGGTTATAATGACGCTCGAACAGGCATGCCCCCCGGAATACCAGAGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTAACTATTATATAGTACTCAGACATCACTAAAAACAAGAGTTGTGGTCCTCTGGCGGGCACTCAACAGCCGAAGCCGCTGGCACGAGGCGGCCCGCCAAAGCAACAAAGGTAGTTTATTCAAGGGTGGAGTTCAGGACCGAGCTTCTTCGAGAGGCCCGACGACTCTAAACCCTACGGGAGTAGGGTAGCCCCGGGAGCGAGCTCCGCGGGCGCTGTCTATCCTTTGCTCTAGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTAC (SEQ ID NO. 1);
[0059]
[0060] (3) beta-tublin: AGACCGGTCAGTGCGGTAACCAAATTGGGTATGTTGCTCTTCAGTCCCCTCTGCAAGTGCTTTTACTGACTGTGCTCTTATAGTGCTGCCTTTTGGTATGTCGAATCCAATCGCGACCTACCATGCCTGATACACGAACGCGACATGAAGGACTCCAGTGCTGATAAACATACAGGCAAACAATCTCAGGCGAGCACGGTCTTGATGGATCCGGCGTGTAAGTTCTATTTGGAATCTGCGATGCCATTTACGGCGGCCTGTTGACATCTGACTGACCTTGTTTACAGGTACAATGGTACATCCGATCTCCAACTTGAGCGATTGAACGTCTACTTCAACGAGGTTGGTACTAACATTTCCAGCACATACGCAGTCCCTAACATTTCATTAGGCCTCCGGTAACAAGTATGTTCCTCGTGCCGTCCTCGTCGATTTGGAGCCAGGTACCATGGATGCCGTCCGTGCGGGTCCTTTCGGTCAACTCTTCCGCCCCGACAACTTCGTCTTCGG (SEQ ID NO. 3).
[0061] The above description is merely that of the preferred embodiments of the present application, and is not intended to limit the present application. Any modification, equivalent replacement and improvement made without departing from the spirit and principle of the present application shall fall within the scope of protection of the present application.
Claims
1. A fungus for promoting the growth of seedlings of Saussurea involucrata, characterized by, The fungal strain is named SI-16, belongs to Leptodophora Aspergillus sp., and was preserved in China General Microbiological Culture Collection Center on June 9, 2025, with a preservation number of CGMCC No. 42028.
2. The fungus of claim 1, wherein, The fungal colony is round, gray-black, surface felt-like, aerial hyphae is not developed, hyphae is dark brown, septate, occasionally branched, and no conidium is observed.
3. The fungus of claim 1, wherein, The ribosomal internal transcribed spacer sequence, the second RNA polymerase II gene sequence and the beta-tubulin gene sequence of the fungus are shown in SEQ ID NO. 1-3, respectively.
4. A process for the production of a fungus as claimed in any one of claims 1 to 3, characterised in that, The method comprises the following steps: uniformly mixing sawdust and wheat bran, adding water and stirring, then sterilizing the substrate in a strain bottle by 121℃ steam, and after cooling, inoculating PDA fungus slice of strain SI-16, and then dark culture for 55-65 days until the mycelium covers half to two-thirds of the substrate volume.
5. The production method according to claim 4, characterized by, The volume ratio of the sawdust and wheat bran is 2-5:
1.
6. The preparation method according to claim 4, characterized in that, The water content of the substrate is 30-40%.
7. The preparation method according to claim 4, characterized in that, The temperature of the dark culture is 18-22℃.
8. The fungus of any one of claims 1-3 for use in promoting the growth and development of Saussurea involucrata seedlings.
9. Use according to claim 8, characterized in that, The promotion of the growth of Saussurea involucrata seedlings is adding the solid strain of strain SI-16 in the substrate when Saussurea involucrata seeds are sowed or Saussurea involucrata seedlings are transplanted.
10. A preparation for promoting the growth of seedlings of Saussurea involucrata Kar. et Kir., characterized by, The preparation comprises the solid strain of the fungus of any one of claims 1-3.