Talaromyces purpureogenus strain d01 and application thereof
By isolating and purifying *Bacillus purpureus* DO1, its fermentation antibacterial active substance was prepared, solving the problems of irritation and insignificant effect of existing antibacterial agents, and enabling its wide application in food, health products and daily chemical products.
Patent Information
- Application Number
- CN202511106213.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-08
- Publication Date
- 2025-11-28
- Estimated Expiration
- 2045-08-08
AI Technical Summary
Existing antibacterial agents in cosmetics suffer from high irritation, while natural antibacterial agents are not very effective, which limits their application in food, health products, and daily chemical products.
The purple basket-shaped bacterium D01 (Talaromyces purpureogenus) was isolated and purified, and antibacterial active substances were prepared by fermentation and ethyl acetate extraction for application in food, health products and daily chemical products.
The fermentation product of *Bacillus purpureus* D01 has good antibacterial and preservative properties, and remains effective even at high temperatures, making it suitable for food, health products, and daily chemical products.
Smart Images

Figure CN120624231B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of microbial technology, in particular to Talaromyces purpureogenus D01 and its application. BACKGROUND
[0002] Food, health products, daily chemical products often need to add bacteriostatic agents to ensure product quality stability and safety. For example, cosmetics contain many nutritional ingredients, which provide a good condition and environment for the growth and reproduction of microorganisms. In order to avoid the pollution of cosmetics by bacteria, molds, yeasts and other microorganisms during the shelf life, one or more bacteriostatic agents need to be added to inhibit the proliferation of microorganisms and ensure that the product will not deteriorate due to pollution during the shelf life. Selecting a suitable bacteriostatic system not only considers the bacteriostatic effect, but also considers environmental safety and does not interfere with other ingredients in the product, which is the focus of research and development.
[0003] However, traditional bacteriostatic agents have high irritation, such as in cosmetics, some bacteriostatic agents may irritate the skin, and severe cases may cause pore blockage or chronic poisoning of the mucous membrane, leading to allergic dermatitis of the skin, or cause photosensitivity reactions, and even have the risk of carcinogenesis; and natural bacteriostatic agents have the problem of insufficient effect, such as poor stability of active ingredients of plant-derived bacteriostatic agents, and the problem of inability of plant essential oil bacteriostatic agents to dissolve with water, which limits the application of natural preservatives.
[0004] In summary, the existing bacteriostatic agents have various problems, and the natural products obtained by microbial fermentation currently have bactericidal function, which are natural source bacteriostatic agents with excellent and mild bacteriostatic effect. Therefore, in order to meet the broad market application prospect of natural bacteriostatic agents, it is urgent to isolate and obtain microorganisms producing high bacteriostatic activity substances, which is of great significance to the development of food, health products and daily chemical products. SUMMARY
[0005] The purpose of the present application is to overcome the shortcomings of the prior art and provide a Talaromyces purpureogenus D01 producing high bacteriostatic activity substances. The strain is isolated and purified from soil samples near the exit of Guangzhou Taihe subway station, and has been preserved in the Guangdong Microbial Culture Collection Center, with the preservation number GDMCC NO.66458.
[0006] In a first aspect, the present application provides Talaromyces purpureogenus D01, Talaromyces purpureogenus ) D01, which has been preserved in the Guangdong Microbial Culture Collection Center on June 4, 2025, with the preservation number GDMCC NO.66458 and the preservation address being No. 59 Building, 5th Floor, 100 Middle Xianlie Road, Guangzhou.
[0007] In a second aspect, the present application provides the application of Talaromyces purpureogenus D01 in the preparation of bacteriostatic active substances.
[0008] In a third aspect, the present application provides a method for preparing the antibacterial active substance fermented by T. purpurescens D01 according to the first aspect, comprising the following steps:
[0009] S1, seed liquid culture: picking the culture medium block containing bacterial colonies and adding it to PDB liquid culture medium for culture to obtain a seed liquid;
[0010] S2, solid fermentation: uniformly coating the seed liquid on the solid fermentation medium for fermentation;
[0011] S3, after the fermentation is completed, the bacterial cells and the culture medium are collected, crushed, and then equal volume of ethyl acetate is added for ultrasonic-assisted extraction, followed by room temperature standing extraction to obtain an extract;
[0012] S4, collecting the extract for filtration, taking the filtrate for rotary evaporation concentration treatment to obtain the antibacterial active substance.
[0013] Preferably, the culture temperature in step S1 is 26-30℃, the culture rotation speed is 160-200 rpm, and the culture time is 12-18 h.
[0014] Preferably, the fermentation temperature in step S2 is 26-30℃, and the fermentation time is 5-7 days.
[0015] Preferably, the ultrasonic power in step S3 is 100-800 w, the ultrasonic time is 5-30 min, and the room temperature standing extraction time is 1-3 h.
[0016] Preferably, the steps of ethyl acetate ultrasonic-assisted extraction and room temperature standing extraction in step S3 are repeated for 2-3 times.
[0017] In a fourth aspect, the present application provides a product comprising the T. purpurescens D01 according to the first aspect.
[0018] In a fifth aspect, the present application provides the use of the T. purpurescens D01 according to the first aspect in the preparation of food, health care products or daily chemical products, wherein the T. purpurescens D01 according to the first aspect is fermented to prepare the antibacterial active substance, and then the antibacterial active substance is applied to the preparation of food, health care products or daily chemical products.
[0019] In a sixth aspect, the present application provides the use of the antibacterial active substance prepared by the method according to the third aspect in the preparation of food, health care products or daily chemical products.
[0020] Compared with the prior art, the present application has the following beneficial effects:
[0021] The inventors of the present application isolated and purified the T. purpurescens D01 from soil samples near the exit of Guangzhou Taihe subway station.
[0022] 1. The bacteriostatic test results show that the Talaromyces purpureofuscus D01 in the application has good bacteriostatic effect on Burkholderia cenocepacia, Staphylococcus aureus, Pseudomonas putida, Pseudomonas aeruginosa, Escherichia coli and Candida albicans, and the diameters of the bacteriostatic circles are all greater than 14 mm.
[0023] 2. The heat resistance test results show that the bacteriostatic active substance produced by the Talaromyces purpureofuscus D01 in the application still has good bacteriostatic performance after being treated at 80 DEG C or 60 DEG C for 40 min, indicating that the bacteriostatic active substance prepared in the application has high temperature resistance.
[0024] 3. The preservative test results show that the bacteriostatic active substance produced by the Talaromyces purpureofuscus D01 in the application has excellent preservative effect on Burkholderia cenocepacia, Staphylococcus aureus, Pseudomonas putida, Pseudomonas aeruginosa, Escherichia coli and Candida albicans; the viable bacterial count of the bacteriostatic active substance in the bacterial group and the fungal group presents a downward trend after 6 h of action; after 7 days of action, the viable bacterial count of all test groups is not higher than 100 CFU / mL; after 14 to 28 days of action, the viable bacterial count of the bacterial group and the fungal group is 0, indicating that the test groups pass the test and have excellent preservative effect. Accordingly, the bacteriostatic active substance produced by the Talaromyces purpureofuscus strain D01 can be used as a bacteriostatic and preservative raw material, and has excellent preservative performance when applied to the preparation of food, health products or daily chemical products, and has broad application prospect and important transformation research value.
[0025] Biological material preservation
[0026] A Talaromyces purpureofuscus strain D01, which is classified and named as Talaromyces purpureogenus , was preserved in the Guangdong Microbial Culture Collection Center on June 4, 2025, with a preservation number of GDMCC NO.66458 and a preservation address of No. 59 Building, 5th Floor, 100 Middle Martyrs Road, Guangzhou. DETAILED DESCRIPTION
[0027] Figure 1 is a colony morphology diagram of the Talaromyces purpureofuscus D01;
[0028] Figure 2 is a phylogenetic tree of the Talaromyces purpureofuscus D01;
[0029] Figure 3 is a bacteriostatic effect diagram of the bacteriostatic active substance ① of the Talaromyces purpureofuscus D01 in Example 4; wherein S represents Staphylococcus aureus, C represents Candida albicans, B represents Pseudomonas aeruginosa, P represents Pseudomonas putida, H represents Burkholderia cenocepacia, and E represents Escherichia coli. DETAILED DESCRIPTION
[0030] For better illustrating the object, technical scheme and advantages of the present application, the present application will be further described in conjunction with specific examples.
[0031] Other materials, reagents and the like used in the examples can be obtained from commercial channels unless otherwise specified.
[0032] Culture medium involved in the present application:
[0033] PDA culture medium: 20 g / L glucose, 10 g / L potato extract powder, 10 g / L yeast extract, 20 g / L agar, distilled water, pH natural.
[0034] PDB liquid culture medium: 20 g / L glucose, 5 g / L potato extract powder, distilled water, pH natural.
[0035] Solid fermentation culture medium: PDA culture medium.
[0036] Bengal red culture medium: 5 g / L peptone, 10 g / L glucose, 1 g / L potassium dihydrogen phosphate, 0.5 g / L magnesium sulfate, 20 g / L agar, 0.033 g / L Bengal red dye, pH 6.0.
[0037] The above culture media all need to go through a sterilization step, and the sterilization condition is 121℃ for 20 min.
[0038] Example 1: Strain isolation and purification
[0039] A soil sample near the exit of Guangzhou Taihe subway station was collected, 10 g of the collected soil sample was weighed, 90 mL of sterile water was added, and the mixture was cultured at room temperature with 150 rpm shaking for 30 min. Then, the supernatant was taken and subjected to strain isolation by 10-fold gradient dilution method, 100 μL of the dilution solution with dilution factor of 10 -3 , 10 -4 , 10 -5 , 10 -6 were respectively spread on the Bengal red culture medium plates, and incubated at 28℃ until colonies were observed on the culture medium. Single colonies with different colony morphological characteristics and good growth conditions were picked, and repeated isolation and purification were performed by plate streaking method to obtain purified strains and numbered and recorded. The purified strains were inoculated in 30% glycerol solution and stored in a -80℃ refrigerator.
[0040] Example 2: Strain identification
[0041] Morphological characteristics: After the strain was incubated at 28℃ for 4-6 days, green-black spores were formed on the front of the colony, and the colony surface was velvety (as shown in Figure 1 Under an optical microscope, typical broom-like branches were observed, the broom-like branches were closely arranged, and the mycelium had septa; the conidia were spherical or ellipsoidal.
[0042] Molecular biology method identification: 18S rRNA identification was performed. The genomic DNA of Talaromyces purpureogenus D01 was extracted as a template according to the operation instruction of the fungal genomic DNA extraction kit, and the universal primer (NS1: 5'-GTAGTCATATGCTTGTCTC-3'(SEQ ID NO. 2), FUNG: 5'-ATTCCCCGTTACCCGTTG-3'(SEQ ID NO. 3)) was used for PCR amplification to obtain its 18S rRNA. Subsequently, the sequencing company Huada Gene was commissioned to perform sequencing, the sequence information (SEQ ID NO. 1) obtained by sequencing was subjected to sequence alignment, homology analysis in the NCBI database, and a phylogenetic tree was constructed using MEGA 12 software; the phylogenetic tree is shown in Figure 2 Talaromyces purpureogenus The results show that the strain D01 is in the same branch as Talaromyces purpureogenus .
[0043] The 18S rRNA sequence of the strain is shown as SEQ ID NO. 1:
[0044] CCTATTCCCCGGTATACGTTGCCACCATGGTAGGCCACTATCCTACCATCGAAAGTTGATAGGGCAGAAATTTGAATGAACCATCGCCGGCGCAAGGCCATGCGATTCGTGAAGTTATTATGAATCACCAAGGAGCCCCGAAGGGCATTGGTTTTTTATCTAATAAATACACCCCTTCCGAAGTCGGGGTTTTGCGCATGTATTAGCTCTAGAATTACCACAGGTATCCATGTAGTAGGGTACTATCAAATAAACGATAACTGATTTAATGAGCCATTCGCAGTTTCACAGTAAAAGAGTGCTTATACTTAGACATGCATGGCTTAATCTTTGAGACAATTTTTATGACTACAG.
[0045] Example 3 Preparation of bacteriostatic active substance
[0046] The preparation method of the bacteriostatic active substance ① specifically includes the following steps:
[0047] S1, seed liquid culture: use an inoculation needle to pick an area of 1 cm 2 The square culture medium block containing D01 colonies was added to 200 mL of PDB liquid medium, and cultured at 180 rpm and 28°C for 16 h to obtain a seed liquid.
[0048] S2, solid fermentation: 4% (volume / mass ratio) of the seed liquid was uniformly coated on the dried solid fermentation medium, dried, and fermented at 28°C for 6 days.
[0049] S3, after the fermentation was completed, the bacterial cells and the medium were collected, crushed, and an equal volume of ethyl acetate was added. Ultrasonic-assisted extraction was performed at an ultrasonic power of 400 W for 15 min, and then the extraction was performed at room temperature for 2 h to obtain an extract;
[0050] S4, the ultrasonic-assisted extraction and room temperature extraction steps in step S3 were repeated three times to obtain ethyl acetate extract. The ethyl acetate extract was filtered, and the filtrate was concentrated by rotary evaporation to completely remove the solvent to obtain the antibacterial active substance ①.
[0051] Antibacterial active substance ②: Compared with the preparation steps of antibacterial active substance ①, the only difference is that the spore mycelium part and the medium part are obtained by scraping the surface spore layer with a scraper after the fermentation is completed in step S3. The medium part is crushed and then extracted with an equal volume of ethyl acetate (i.e., only the medium is extracted with ethyl acetate). The remaining steps and parameters are consistent with those of antibacterial active substance ①.
[0052] Antibacterial active substance ③: Compared with the preparation steps of antibacterial active substance ①, the only difference is that the antibacterial active substance is prepared by replacing D01 with the purple-brown basket fungus ZCMU-Z6 with the preservation number CCTCC NO: M 20211369 (donated by Zhejiang Chinese Medical University) through seed liquid culture, solid fermentation and other steps. The remaining steps and parameters are consistent with those of antibacterial active substance ①.
[0053] Antibacterial active substance ④: Compared with the preparation steps of antibacterial active substance ①, the only difference is that the antibacterial active substance is prepared by replacing D01 with the purple-brown basket fungus D2 with the preservation number GDMCC NO.66320 (which has been disclosed in the patent document CN120349902A and is a strain owned by the applicant) through seed liquid culture, solid fermentation and other steps. The remaining steps and parameters are consistent with those of antibacterial active substance ①.
[0054] Example 4: Antibacterial test
[0055] Test substance: The antibacterial active substances ①-④ prepared in Example 3 were dissolved in methanol to obtain a test solution with a concentration of 10 mg / mL for antibacterial experiments.
[0056] Indicator bacteria: Burkholderia cepacia, Staphylococcus aureus, Pseudomonas putida, Pseudomonas aeruginosa, Escherichia coli, and Candida albicans were selected.
[0057] The specific steps of the bacteriostatic test are as follows:
[0058] The test adopts a double-layer agar diffusion method, 10 mL of sterilized 1% water agar medium is poured into a sterile plate, and after it is solidified, an Oxford cup is placed; 200 μL of an indicator bacteria solution is added to 20 mL of nutrient agar medium at about 50°C and mixed, wherein the final concentration of the indicator bacteria is 3 x 10 6 CFU / mL, the mixed nutrient agar medium containing the indicator bacteria is poured into a sterile plate; after the nutrient agar medium is completely solidified, the Oxford cup is taken out, 200 μL of the test substance is added to the sample hole, and an equal amount of methanol is used instead of the test substance in the blank control group; the plate is placed at 36°C and incubated for 24 h, and the fungi are incubated at 28°C for 72 h; the diameter of the bacteriostatic ring is measured; wherein 3 parallel experiments are set for each indicator bacteria, and 3 directions are measured for each bacteriostatic ring, and the data is presented as an average value.
[0059] The test results are shown in Figure 3 and Table 1: the diameters of the bacteriostatic rings of the bacteriostatic active substance ① on Burkholderia cepacia, Staphylococcus aureus, Pseudomonas putida, Pseudomonas aeruginosa, Escherichia coli and Candida albicans are 19.01 mm, 14.24 mm, 22.58 mm, 23.50 mm, 19.45 mm and 17.09 mm, respectively, indicating that the fermentation product of Talaromyces purpureogenus D01 has good bacteriostatic effect; the bacteriostatic activity of the bacteriostatic active substance ② on the above indicator bacteria is almost the same as that of the bacteriostatic active substance ①, and the applicant further prepared the bacteriostatic active substance from the spore mycelium part obtained after fermentation according to the method described in Example 3 and conducted a bacteriostatic test according to Example 4, and the results showed that the bacteriostatic active substance prepared only from the spore mycelium part had no obvious bacteriostatic effect on the aforementioned 6 kinds of indicator bacteria (the results are not shown in Table 1), so it can be known that the bacteriostatic active substance in the present application is mainly the extracellular compounds released into the culture medium during the fermentation of Talaromyces purpureogenus D01.
[0060] It can be known from the bacteriostatic effect of the bacteriostatic active substances ①-④ on Burkholderia cepacia, Staphylococcus aureus, Pseudomonas putida, Pseudomonas aeruginosa, Escherichia coli and Candida albicans in Table 1 that not all Talaromyces purpureogenus has bacteriostatic effect on the above 6 kinds of bacteria, and the Talaromyces purpureogenus D01 separated and obtained in the present application can ferment to produce active substances with good bacteriostatic performance.
[0061] Table 1 Bacteriostatic test data
[0062] Indicator bacteria Blank control Antibacterial active substance 1 Antibacterial active substance 2 Antibacterial active substance 3 Antibacterial active substance 4 Burkholderia cepacia - 19.01 18.18 - 21.26 Staphylococcus aureus - 14.24 14.04 - - Pseudomonas putida - 22.58 21.92 - 15.19 Pseudomonas aeruginosa - 23.50 23.15 - 19.57 Escherichia coli - 19.45 19.08 - 17.35 Candida albicans - 17.09 16.63 12.64 -
[0063] Note: unit (mm), "-" indicates no obvious bacteriostatic activity.
[0064] Example 5 Heat resistance test
[0065] Test substance: bacteriostatic active substance ① prepared in Example 3;
[0066] Test substance treatment: the bacteriostatic active substance ① was dissolved in methanol to a concentration of 10 mg / mL of the test solution for the heat resistance test;
[0067] After the foregoing test substances were treated at 80°C and 60°C, respectively, for 40 min, and cooled to room temperature, the bacteriostatic test was performed according to the method of Example 4; the control group used an equal amount of methanol instead of the test substance, and each group had three parallel experiments, and the data were presented as the average value;
[0068] Indicator bacteria: only Candida albicans was used for the experiment.
[0069] The experimental results showed that after the bacteriostatic active substance ① was treated at 80°C and 60°C, respectively, for 40 min, and the bacteriostatic test was performed according to the procedure described in Example 4, the experimental results showed that the bacteriostatic active substance ① after the above two treatments had almost the same bacteriostatic circle diameter as the results in Table 1, with a bacteriostatic circle diameter of 17.36 mm and 16.91 mm, respectively, indicating that the bacteriostatic active substance produced by the purple-blue-shaped bacterium D1 had high temperature resistance.
[0070] Example 6 Preservative test
[0071] Test substance: the bacteriostatic active substance ① prepared in Example 3 was dissolved in 1,2-butanediol to a mass fraction of 5% of the test solution;
[0072] The test substance was added as a natural preservative to cosmetics, and the preservative test was performed according to the known Cosmetic, Toiletry, and Fragrance Association (CTFA) and the United States Pharmacopoeia microbial challenge test method, and the specific test procedure was as follows:
[0073] First, a certain amount of preservative-free mask liquid 12 parts was prepared according to the basic formula, and randomly divided into four groups, with three mask liquids in each group; the test substance group added the bacteriostatic active substance ① produced by the purple-blue-shaped bacterium strain D01 to make the mass fraction of the test substance in the mask liquid finally 0.5%, and the blank control group added an equal amount of 1,2-butanediol as the test substance; the test bacteria in the logarithmic growth phase, Escherichia coli, Staphylococcus aureus, Pseudomonas putida, Pseudomonas aeruginosa, Burkholderia cepacia and Candida albicans were diluted to 4×10 9 CFU / mL with PBS buffer, and the mixed bacteria solution was added to the sample; the bacteria group made the final concentration of bacteria in the mask liquid 4×10 7 CFU / mL, and the fungus group made the final concentration of fungus in the mask liquid 4×10 6CFU / mL, respectively mixed evenly, the bacteria group was placed in a 36°C incubator, the fungus group was placed in a 28°C incubator; according to the colony count test method in the fifth chapter of the microbial test method in the cosmetic safety technical specification 2015 version, the viable bacteria number was determined at 6h, 7d, 14d, 28d after inoculation, to judge the preservative efficacy of the cosmetic; the judgment standard is: when each sample is inoculated, the surviving bacteria amount is reduced to not more than 0.1% of the initial concentration at 7d, then gradually reduced, no bacterial growth at 28d; then the preservative is effective, passed the test; otherwise, the preservative is invalid, failed the test.
[0074] The results of the preservative test are shown in Table 2 (data presented as mean values), the viable bacteria number of the bacteria group and the fungus group of the test group showed a downward trend at 6h; at 7d, the viable bacteria number of all test groups was not higher than 100 CFU / mL; at 14-28d, the viable bacteria number of the bacteria group and the fungus group was 0, indicating that the test group passed the test, and the preservative effect was excellent. It is shown that the bacteriostatic active substance produced by the fermentation of Talaromyces purpureogenus strain D01 can be used as a bacteriostatic preservative raw material, and when applied to the preparation of food, health products or daily chemical products, its preservative performance is excellent, has a broad application prospect and important transformation research value.
[0075] Table 2 Preservative test data
[0076]
[0077] Finally, it should be noted that the above examples are only used to illustrate the technical solutions of the present application and not to limit the scope of protection of the present application. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present application.
Claims
1. A strain of purple basket-shaped fungus ( Talaromyces purpureogenus D01, characterized in that, and has a preservation number of GDMCC NO. 66458.
2. Use of T. purpurescens DOl according to claim 1 for the preparation of antibacterially active substances, characterized in that The method comprises the following steps: S1, seed liquid culture: picking up the culture medium block containing colonies and adding to PDB liquid culture medium for culture to obtain seed liquid; S2, solid fermentation: uniformly coating the seed liquid on the solid fermentation medium for fermentation; S3, after the fermentation is completed, the mycelium and the culture medium are collected, crushed, and then equal volume of ethyl acetate is added for ultrasonic-assisted extraction, and then extraction is carried out at room temperature to obtain an extract; S4, the extract is collected and filtered, and the filtrate is taken for rotary evaporation concentration treatment until the solvent is completely removed to obtain the antibacterial active substance.
3. A method for producing an antibacterial active substance by fermentation using the T. purpurescens DOl according to claim 1, characterized by, The method comprises the following steps: S1, seed liquid culture: picking up the culture medium block containing colonies and adding to PDB liquid culture medium for culture to obtain seed liquid; S2, solid fermentation: uniformly coating the seed liquid on the solid fermentation medium for fermentation; S3, after the fermentation is completed, the mycelium and the culture medium are collected, crushed, and then equal volume of ethyl acetate is added for ultrasonic-assisted extraction, and then extraction is carried out at room temperature to obtain an extract; S4, the extract is collected and filtered, and the filtrate is taken for rotary evaporation concentration treatment until the solvent is completely removed to obtain the antibacterial active substance.
4. The method of claim 3, wherein, In the step S1, the culture temperature is 26-30 DEG C, the culture rotation speed is 160-200 rpm, and the culture time is 12 h-18 h.
5. The method of claim 3, wherein, In the step S2, the fermentation temperature is 26-30 DEG C, and the fermentation time is 5-7 days.
6. The method of claim 3, wherein, In the step S3, the ultrasonic power is 100-800 w, the ultrasonic time is 5-30 min, and the extraction time at room temperature is 1-3 h.
7. The method of claim 3, wherein, In the step S3, the steps of ultrasonic-assisted extraction of ethyl acetate and extraction at room temperature are repeated for 2-3 times.
8. A product characterized by, The Talaromyces purpureogenus D01 as claimed in claim 1.
Citation Information
Patent Citations
Talaromyces purpurogenum D2 and application thereof
CN120349902A
Cyclic peptide compounds as well as preparation method and application thereof
CN112300243A