Universal donor cells

Abstract

Provided herein are genetically modified cells, such as universal donor cells, compatible with multiple subjects; and methods of producing the genetically modified cells. The invention relates to universal donor cells comprising at least one genetic modification within or near at least one gene of a component or transcriptional regulatory factor encoding one or more MHC-I or MHC-II human leukocyte antigens or MHC-I or MHC-II complexes, at least one genetic modification that increases expression of at least one polynucleotide encoding a tolerogenic factor, and optionally at least one genetic modification to increase or decrease the expression of at least one gene encoding a survival factor.

Description

[0001] This application is a divisional application of a patent application with the application date of September 7, 2019, application number 201980073104.6, and name “Universal Donor Cells”.

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of U.S. Provisional Application No. 62 / 728,529, filed September 7, 2018, the disclosure of which is hereby incorporated by reference in its entirety. Technical Field

[0004] The present invention relates to the field of gene editing and, in some embodiments, to genetic modification for the purpose of generating cells that are compatible with multiple subjects (e.g., universal donor cells). Background Art

[0005] A variety of methods have been proposed to overcome the allogeneic rejection of transplanted or implanted cells, including HLA matching, blocking the pathways that trigger T cell activation with antibodies, using immunosuppressive drug mixtures and autologous cell therapy. Another strategy for suppressing graft rejection involves minimizing the allogeneic differences between transplanted or implanted cells and the recipient. Human leukocyte antigens (HLA) expressed on the cell surface, i.e., molecules encoded by genes in the major histocompatibility complex of the human body on chromosome 6, are the main mediators of immune rejection. The mismatch of a single HLA gene between a donor and a subject may cause a robust immune response (Fleischhauer K. et al. " Bone marrow-allograft rejection by T lymphocytes recognizing as single amino acid difference in HLA-B44 [bone marrow allograft rejection by T lymphocytes recognizing a single amino acid difference in HLA-B44], " NEngl J Med. [New England Journal of Medicine], 1990, 323:1818-1822). HLA genes are divided into MHC class I (MHC-I) and MHC class II (MHC-II). MHC-I genes (HLA-A, HLA-B, and HLA-C) are expressed on almost all tissue cell types and present peptides processed by "non-self" antigens to CD8+ T cells, thereby promoting their activation into cytolytic CD8+ T cells. Transplanted or implanted cells expressing "non-self" MHC-I molecules will elicit a robust cellular immune response against these cells, ultimately leading to the death of these cells through activated cytolytic CD8+ T cells. MHC-I proteins are closely associated with beta-2-microglobulin (B2M) in the endoplasmic reticulum, which is essential for the formation of functional MHC-I molecules on the cell surface.

[0006] In the present invention, the present invention relates to the method for the generation of " universal donor " cell that is compatible with any HLA genotype, and the method for the generation of " universal donor " cell is provided.The method for the generation of " universal donor " cell that is compatible with any HLA genotype provides the alternative strategy that can solve immune rejection and the relevant economic cost of the current method for immune escape.

[0007] In order to produce this or such universal donor cell line, a previous method is to functionally destroy the expression of MHC-I and MHC-II class genes.This can be achieved by the genetic destruction of two genetic alleles such as encoding MHC-I light chain B2M.It is expected that the resulting B2MKO cell line and its derivatives will show greatly reduced surface MHC-I, thereby showing the immunogenicity of the reduction to allogeneic CD8+T cells.Transcription activator-like effector nuclease (TALEN) targeting method has been used to produce B2M defective hESC system (Lu, P. et al., " Generating hypoimmunogenic human embryonic stem cells by the disruption of beta2-microglobulin [producing low immunogenic human embryonic stem cells by destroying beta2-microglobulin], " Stem Cell Rev. [stem cell review] 2013, 9:806-813). Although the B2M-targeted hESC lines appear to be surface HLA-I deficient, they were found to still contain mRNA specific for B2M and MHC-I. The expression levels of B2M and MHC-I mRNA were comparable to those of non-targeted hESCs (both constitutive and IFN-g inducible). Therefore, there is concern that these TALEN B2M-targeted hESC lines may express residual cell surface MHC-I sufficient to cause immune rejection, as has been observed in B2M2 / 2 mouse cells that also express B2M mRNA (Gross, R. and Rappuoli, R. "Pertussis toxin promoter sequences involved in modulation," Proc Natl Acad Sci, 1993, 90: 3913-3917).Although off-target cleavage events were not examined in the TALEN B2M-targeted hESC line, the occurrence of nonspecific cleavage remains a significant problem when using TALENs, which will pose a major safety concern for their clinical use (Grau, J. et al. “TALENoffer: genome-wide TALEN off-target prediction,” Bioinformatics, 2013, 29:2931-2932; Guilinger JP et al. “Broadspecificity profiling of TALENs results in engineered nucleases with improved DNA-cleavage specificity,” Nat Methods 2014, 11:429-435). In addition, another report generated IPS cells that escaped allorecognition by knocking out the first B2M allele and knocking in the HLA-E gene at the second B2M allele, resulting in surface expression of HLA-E dimers or trimers in the absence of surface expression of HLA-A, HLA-B, or HLA-C (Gornalusse, GG et al., “HLA-E-expressing pluripotent stem cells escape allogeneic responses and lysis by NK cells,” Nature Biotechnology, 2017, 35, 765-773).

[0008] A potential limitation of some of the above strategies is that MHC class I-negative cells are susceptible to lysis by natural killer (NK) cells because HLA molecules serve as the primary ligand inhibitor of natural killer (NK) cells. Host NK cells have been shown to eliminate transplanted or engrafted B2M- / - donor cells, and a similar phenomenon has occurred in vitro with MHC class I-negative human leukemia cell lines (Bix, M. et al., "Rejection of class I MHC-deficient heemopoietic cells by irradiated MHC-matched mice," Nature, 1991, 349, 329-331; Zarcone, D. et al., "Human leukemia-derived cell lines and clones as models for mechanistic analysis of natural killer cell-mediated cytotoxicity," Cancer Res. 1987, 47, 2674-2682). Therefore, there is the need to improve previous methods to produce universal donor cells that can escape immune response, and the need to produce cells that can survive after implantation. As described herein, after implantation, cell survival can be mediated by other pathways (e.g., hypoxia, reactive oxygen species, nutritional deprivation and oxidative stress) independent of allogeneic rejection of the host. In addition, as described herein, the hereditary introduction of survival factors (genes and / or proteins) can contribute to cell survival after implantation. As described herein, universal donor cell lines can combine the characteristics of solving allogeneic rejection and survival after implantation. Summary of the Invention

[0009] In some aspects, the present disclosure includes methods for producing universal donor cells. A first method includes genetically modifying a cell by: (i) introducing a deletion and / or insertion of at least one base pair at a site within or near at least one gene in the genome of the cell, the at least one gene encoding one or more of an MHC-I or MHC-II human leukocyte antigen, a component of an MHC-I or MHC-II complex, or a transcriptional regulatory factor; and (ii) introducing an insertion of at least one polynucleotide encoding a tolerogenic factor at a site in the genome of the cell that partially overlaps, completely overlaps, or is contained within the site of (i), thereby producing the universal donor cell. The second method comprises genetically modifying a cell by (i) introducing a deletion and / or insertion of at least one base pair at a site within or near at least one gene in the genome of the cell, the at least one gene encoding one or more of an MHC-I or MHC-II human leukocyte antigen or a component of an MHC-I or MHC-II complex or a transcriptional regulatory factor; and (ii) introducing an insertion of at least one polynucleotide encoding a tolerogenic factor into a safe harbor locus in the genome of the cell, thereby generating the universal donor cell. In some embodiments, the universal donor cell has increased immune evasion and / or cell survival compared to unmodified cells.

[0010] In some embodiments, the at least one gene encoding one or more MHC-I or MHC-II human leukocyte antigens, or components of the MHC-I or MHC-II complex, or transcriptional regulatory factors is an MHC-I gene selected from HLA-A, HLA-B, or HLA-C, an MHC-II gene selected from HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, or HLA-DR, or a gene selected from B2M, NLRC5, CIITA, RFX5, RFXAP, or RFXANK.

[0011] In some embodiments, the at least one polynucleotide encoding the tolerogenic factor is one or more polynucleotides encoding one or more of PD-L1, HLA-E, HLA-G, CTLA-4, or CD47. In some embodiments, the at least one polynucleotide encoding the tolerogenic factor is operably linked to an exogenous promoter. In some embodiments, the exogenous promoter is a constitutive promoter, an inducible promoter, a temporal specific promoter, a tissue specific promoter, or a cell type specific promoter, optionally wherein the exogenous promoter is a CMV, EF1a, PGK, CAG, or UBC promoter.

[0012] In some embodiments, the deletion and / or insertion of (i) is within or near B2M, and the insertion of (ii) is an insertion of a polynucleotide encoding PD-L1 or HLA-E.

[0013] In some embodiments, the method further comprises introducing at least one genetic modification that increases or decreases the expression of at least one survival factor relative to an unmodified cell. In some embodiments, the at least one genetic modification that increases or decreases the expression of at least one survival factor is an insertion of a polynucleotide encoding MANF that increases the expression of MANF relative to the unmodified cell; or a deletion and / or insertion of at least one base pair within or near a gene encoding ZNF143, TXNIP, FOXO1, or JNK that reduces or eliminates the expression of ZNF143, TXNIP, FOXO1, or JNK relative to the unmodified cell. In some embodiments, the polynucleotide encoding MANF is inserted into a safe harbor locus or into a gene for a transcriptional regulator of MHC-I, MHC-II, or MHC-I or MHC-II.

[0014] In some embodiments, the cell is genetically modified and includes delivering an endonuclease system guided by at least one RNA to the cell. In some embodiments, the endonuclease system guided by the at least one RNA is a CRISPR system comprising a CRISPR nuclease and a guide RNA. In some embodiments, the CRISPR nuclease is Cas9, Cpf1, a homologue thereof, a modified form thereof, a codon-optimized form thereof, or any combination thereof. In some embodiments, the CRISPR nuclease is Streptococcus pyogenes (S.pyogenes) Cas9. In some embodiments, the CRISPR nuclease comprises an N-terminal nuclear localization signal (NLS) and / or a C-terminal NLS. In some embodiments, the CRISPR nuclease and the guide RNA are present in a weight ratio of 1: 1.

[0015] In some embodiments, the deletion and / or insertion of (i) is within or near the B2M locus, and the insertion of (ii) is an insertion of a polynucleotide encoding PD-L1. In some embodiments, the guide RNA for (i) and (ii) comprises a nucleotide sequence comprising at least one of SEQ ID NOs: 1-3 or SEQ ID NOs: 35-44. In some embodiments, the polynucleotide encoding PD-L1 is flanked by (a) a nucleotide sequence having sequence homology to a region to the left of the site in (i) and (b) a nucleotide sequence having sequence homology to a region to the right of the site in (i). In some embodiments, the polynucleotide encoding PD-L1 is inserted into the B2M locus within 50 base pairs of the site in (i). In some embodiments, (a) of the polynucleotide consists essentially of the nucleotide sequence of SEQ ID NO: 13, and (b) of the polynucleotide consists essentially of the nucleotide sequence of SEQ ID NO: 19. In some embodiments, the polynucleotide encoding PD-L1 is operably linked to an exogenous promoter, optionally wherein the exogenous promoter is a CAG promoter.

[0016] In some embodiments, the cell is a mammalian cell, optionally wherein the cell is a human cell. In some embodiments, the cell is a stem cell, optionally wherein the stem cell is a pluripotent stem cell (PSC), embryonic stem cell (ESC), adult stem cell (ASC), induced pluripotent stem cell (iPSC) or hematopoietic stem and progenitor cell (HSPC). In some embodiments, the cell is a differentiated cell or a somatic cell.

[0017] In some embodiments, the universal donor cell is capable of differentiating into lineage-restricted progenitor cells or fully differentiated somatic cells. In some embodiments, the lineage-restricted progenitor cells are pancreatic endoderm progenitor cells, pancreatic endocrine progenitor cells, mesenchymal progenitor cells, muscle progenitor cells, blast cells, or neural progenitor cells. In some embodiments, the fully differentiated somatic cells are endocrine cells such as pancreatic beta cells, epithelial cells, endoderm cells, macrophages, hepatocytes, adipocytes, kidney cells, blood cells, or immune system cells.

[0018] In other aspects, the disclosure includes a plurality of universal donor cells produced by any of the methods disclosed herein. In some embodiments, the plurality of universal donor cells can be maintained for a time and under conditions sufficient to allow the cells to undergo differentiation.

[0019] In yet another aspect, the present disclosure provides a cellular composition comprising (i) at least one deletion within or near at least one gene encoding one or more MHC-I and MHC-II human leukocyte antigens, or components of the MHC-I or MHC-II complex, or transcriptional regulatory factors; and (ii) at least one insertion of a polynucleotide encoding at least one tolerogenic factor at a site that partially overlaps with, completely overlaps with, or is contained within the genetic deletion site of (i).

[0020] In other aspects, present disclosure provides a method for administering any universal donor cell disclosed herein to a subject in need of treatment. In certain embodiments, these methods include obtaining or obtaining a variety of universal donor cells as disclosed herein after differentiation into lineage-restricted progenitor cells or fully differentiated somatic cells; and administering these lineage-restricted progenitor cells or fully differentiated somatic cells to the subject. Present disclosure also provides a method for obtaining cells for administration to a subject in need. The method includes (i) obtaining or obtaining any universal donor cell disclosed herein, and (ii) maintaining these universal donor cells under the time and conditions sufficient to differentiate these cells into lineage-restricted progenitor cells or fully differentiated somatic cells. In certain embodiments, these lineage-restricted progenitor cells are pancreatic endoderm progenitor cells, pancreatic endocrine progenitor cells, mesenchymal progenitor cells, muscle progenitor cells, mother cells or neural progenitor cells. In certain embodiments, these fully differentiated somatic cells are endocrine cells such as pancreatic β cells, epithelial cells, endodermal cells, macrophages, hepatocytes, adipocytes, kidney cells, blood cells or immune system cells. In some embodiments, the subject is a human having, suspected of having, or at risk for a disease, wherein the disease may be a genetically inheritable disease.

[0021] While the present disclosure is susceptible to various modifications and alternative forms, specific embodiments thereof are shown by way of example in the drawings and will be described in detail herein. However, it should be understood that the drawings and detailed description given herein are not intended to limit the present disclosure to the specific embodiments disclosed, but on the contrary, are intended to cover all modifications, equivalents, and alternatives falling within the spirit and scope of the present disclosure as defined by the appended claims.

[0022] Other features and advantages of the present invention will become apparent from the following detailed description of preferred embodiments of the present invention with reference to the accompanying drawings.

[0023] This application also includes the following embodiments.

[0024] 1. A method for producing universal donor cells, the method comprising genetically modifying the cells by:

[0025] (i) introducing a deletion and / or insertion of at least one base pair into the genome of the cell at a site within or near at least one gene encoding one or more of an MHC-I or MHC-II human leukocyte antigen or a component of the MHC-I or MHC-II complex or a transcriptional regulator; and

[0026] (ii) introducing an insertion of at least one polynucleotide encoding a tolerogenic factor into the genome of the cell at a site that partially overlaps with, completely overlaps with, or is contained within the site of (i), thereby generating the universal donor cell.

[0027] 2. A method for producing universal donor cells, the method comprising genetically modifying the cells by:

[0028] (i) introducing a deletion and / or insertion of at least one base pair into the genome of the cell at a site within or near at least one gene encoding one or more of an MHC-I or MHC-II human leukocyte antigen or a component of the MHC-I or MHC-II complex or a transcriptional regulator; and

[0029] (ii) introducing an insertion of at least one polynucleotide encoding a tolerogenic factor into a safe harbor locus in the genome of the cell, thereby generating the universal donor cell.

[0030] 3. The method of embodiment 1 or 2, wherein the universal donor cells have increased immune evasion and / or cell survival compared to unmodified cells.

[0031] 4. The method of any one of embodiments 1 to 3, wherein the at least one gene encoding one or more MHC-I or MHC-II human leukocyte antigens, or components of the MHC-I or MHC-II complexes, or transcriptional regulators is an MHC-I gene selected from HLA-A, HLA-B, or HLA-C, an MHC-II gene selected from HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, or HLA-DR, or a gene selected from B2M, NLR C5, CIITA, RFX5, RFXAP, or RFXANK.

[0032] 5. The method of any one of embodiments 1 to 4, wherein the at least one polynucleotide encoding a tolerogenic factor is one or more polynucleotides encoding one or more of PD-L1, HLA-E, HLA-G, CTLA-4, or CD47.

[0033] 6. The method of any one of embodiments 1 to 5, wherein the at least one polynucleotide encoding the tolerogenic factor is operably linked to an exogenous promoter.

[0034] 7. A method as described in embodiment 6, wherein the exogenous promoter is a constitutive promoter, an inducible promoter, a time-specific promoter, a tissue-specific promoter or a cell type-specific promoter, optionally wherein the exogenous promoter is CMV, EF1a, PGK, CAG or UBC promoter.

[0035] 8. The method of any one of embodiments 1 to 7, wherein the deletion and / or insertion of (i) is within or near B2M, and the insertion of (ii) is an insertion of a polynucleotide encoding PD-L1 or HLA-E.

[0036] 9. The method of any one of embodiments 1 to 8, further comprising introducing at least one genetic modification that increases or decreases expression of at least one survival factor relative to unmodified cells.

[0037] 10. The method of embodiment 9, wherein the at least one genetic modification that increases or decreases expression of at least one survival factor is an insertion of a polynucleotide encoding MANF, which increases expression of MANF relative to the unmodified cell; or a deletion and / or insertion of at least one base pair within or near a gene encoding ZNF143, TXNIP, FOXO1, or JNK, which decreases or eliminates expression of ZNF143, TXNIP, FOXO1, or JNK relative to the unmodified cell.

[0038] 11. The method of embodiment 10, wherein the polynucleotide encoding MANF is inserted into a safe harbor locus or into a gene belonging to MHC-I, MHC-II, or a transcriptional regulator of MHC-I or MHC-II.

[0039] 12. The method of any one of embodiments 1 to 11, wherein the genetic modification comprises delivering at least one RNA-guided endonuclease system to the cell.

[0040] 13. The method of embodiment 12, wherein the at least one RNA-guided endonuclease system is a CRISPR system comprising a CRISPR nuclease and a guide RNA.

[0041] 14. The method of embodiment 13, wherein the CRISPR nuclease is Cas9, Cpf1, a homolog thereof, a modified form thereof, a codon-optimized form thereof, or any combination thereof.

[0042] 15. The method of embodiment 13 or 14, wherein the CRISPR nuclease is Streptococcus pyogenes Cas9.

[0043] 16. The method of any one of embodiments 13 to 15, wherein the CRISPR nuclease comprises an N-terminal nuclear localization signal (NLS) and / or a C-terminal NLS.

[0044] 17. The method of any one of embodiments 13 to 16, wherein the CRISPR nuclease and the guide RNA are present in a 1:1 weight ratio.

[0045] 18. The method of any one of embodiments 1 or 3 to 17, wherein the deletion and / or insertion of (i) is within or near the B2M locus, and the insertion of (ii) is an insertion of a polynucleotide encoding PD-L1.

[0046] 19. The method of embodiment 18, wherein the guide RNA used for (i) and (ii) comprises a nucleotide sequence comprising at least one of SEQ ID NOs: 1-3 or SEQ ID NOs: 35-44.

[0047] 20. The method of embodiment 18 or 19, wherein the polynucleotide encoding PD-L1 is flanked by (a) a nucleotide sequence having sequence homology to the region to the left of the site in (i) and (b) a nucleotide sequence having sequence homology to the region to the right of the site in (i).

[0048] 21. The method of embodiment 20, wherein the polynucleotide encoding PD-L1 is inserted into the B2M locus within 50 base pairs of the site in (i).

[0049] 22. The method of embodiment 20 or 21, wherein (a) consists essentially of the nucleotide sequence of SEQ ID NO: 13, and (b) consists essentially of the nucleotide sequence of SEQ ID NO: 19.

[0050] 23. The method of any one of embodiments 18 to 22, wherein the polynucleotide encoding PD-L1 is operably linked to an exogenous promoter, optionally wherein the exogenous promoter is a CAG promoter.

[0051] 24. The method of any one of embodiments 1 to 23, wherein the cell is a mammalian cell, optionally wherein the cell is a human cell.

[0052] 25. The method of any one of embodiments 1 to 24, wherein the cell is a stem cell.

[0053] 26. The method of any one of embodiments 1 to 25, wherein the cell is a pluripotent stem cell (PSC), an embryonic stem cell (ESC), an adult stem cell (ASC), an induced pluripotent stem cell (iPSC), or a hematopoietic stem and progenitor cell (HSPC).

[0054] 27. The method of any one of embodiments 1 to 24, wherein the cell is a differentiated cell or a somatic cell.

[0055] 28. The method of any one of embodiments 1 to 24, wherein the universal donor cell is capable of differentiating into lineage-restricted progenitor cells or fully differentiated somatic cells.

[0056] 29. The method of embodiment 28, wherein the lineage-restricted progenitor cells are pancreatic endoderm progenitor cells, pancreatic endocrine progenitor cells, mesenchymal progenitor cells, muscle progenitor cells, blast cells, or neural progenitor cells.

[0057] 30. The method of embodiment 28, wherein the fully differentiated somatic cells are endocrine cells such as pancreatic β cells, epithelial cells, endoderm cells, macrophages, hepatocytes, adipocytes, kidney cells, blood cells or immune system cells.

[0058] 31. A plurality of universal donor cells produced by the method of any one of embodiments 1 to 30.

[0059] 32. The plurality of universal donor cells of embodiment 31, wherein the plurality of universal donor cells is maintained for a time and under conditions sufficient to allow the cells to undergo differentiation.

[0060] 33. A composition comprising cells comprising:

[0061] (i) at least one deletion in or near at least one gene encoding one or more MHC-I and MHC-II human leukocyte antigens or components of the MHC-I or MHC-II complex or transcriptional regulators; and

[0062] (ii) at least one insertion of a polynucleotide encoding at least one tolerogenic factor at a site that partially overlaps with, completely overlaps with, or is contained within the genetic deletion site of (i).

[0063] 34. A method comprising administering to a subject a plurality of universal donor cells as described in embodiment 31 or 32.

[0064] 35. A method for treating a subject in need thereof, the method comprising:

[0065] (i) obtaining or having obtained a plurality of universal donor cells according to embodiment 31 or 32 after differentiation into lineage-restricted progenitor cells or fully differentiated somatic cells; and

[0066] (ii) administering the lineage-restricted progenitor cells or fully differentiated somatic cells to the subject.

[0067] 36. A method of obtaining cells for administration to a subject in need thereof, the method comprising:

[0068] (i) obtaining or having obtained the universal donor cell of embodiment 31 or 32; and

[0069] (ii) maintaining the universal donor cells for a time and under conditions sufficient to allow the cells to differentiate into lineage-restricted progenitor cells or fully differentiated somatic cells.

[0070] 37. The method of embodiment 35 or 36, wherein the lineage-restricted progenitor cells are pancreatic endoderm progenitor cells, pancreatic endocrine progenitor cells, mesenchymal progenitor cells, muscle progenitor cells, blast cells, or neural progenitor cells.

[0071] 38. The method of embodiment 35 or 36, wherein the fully differentiated somatic cells are endocrine cells such as pancreatic β cells, epithelial cells, endoderm cells, macrophages, hepatocytes, adipocytes, kidney cells, blood cells, or immune system cells.

[0072] 39. The method of any one of embodiments 34 to 38, wherein the subject is a human having, suspected of having, or at risk of having a disease.

[0073] 40. The method of embodiment 39, wherein the disease is a genetically heritable disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0074] Figures 1A-1C Specific gene editing strategies targeting immune evasion are provided. Figure 1A is a table describing exemplary modifications directed against immune evasion in the indicated cell types. Figure 1B Exemplary strategies for modifying the B2M locus are provided. Figure 1C Exemplary strategies for modifying the HLA-A, HLA-B / C, and CIITA loci are provided.

[0075] Figure 2 Depicted is a portion of the B2M gene (SEQ ID NO: 6) and the locations of gRNAs (B2M-1, B2M-2, and B2M-3) used to target exon 1. The locations of PCR primers (B2MF2 and B2MR2) are also shown.

[0076] Figures 3A-3C Shown are the results of screening B2M gRNA in the TC-1133 iPSC cell line. Figure 3A Graph showing the indel (indel) frequency of each B2M gRNA. B2M-1 gRNA provided an indel frequency of 2.5% ± 1.1% (n = 2). B2M-2 gRNA provided an indel frequency of 87.6% ± 14.1% (n = 2). B2M-3 gRNA provided an indel frequency of 63.9% ± 0.9% (n = 2). Figure 3B and 3C It shows the B2M-2 ( Figure 3B ) and B2M-3( Figure 3C ) A summary of the distribution of insertion / deletion results of gRNA.

[0077] Figures 4A-4B Shown are the results of B2M knockout (KO) in iPSCs using B2M-2gRNA. Figure 4A is a graph showing a summary of the distribution of indel results for B2M-2 gRNA in iPSCs. Figure 4B Clones homozygous for B2M knockout (KO) ("Homo") and clones heterozygous for B2M KO ("Hets") are presented.

[0078] Figure 5 Evaluation of B2M KO iPSC clones is shown. All three B2M KO clones tested showed reduced mRNA expression of B2M relative to wild-type or unmodified cells.

[0079] Figures 6A-6D Shown are the expressions of B2M and HLA-ABC in B2M KO iPSC clones after 47 hours of treatment with interferon-γ. Figure 6A Expression in wild-type cells is presented. Figure 6B Expression in B2M KO clone C4 is shown. Figure 6C Expression in B2MKO clone C9 is presented. Figure 6D Expression in B2M KO clone C12 is shown.

[0080] Figures 7A-7D The pluripotency of B2M KOiPSC clones was demonstrated by evaluating the expression levels of SSEA-4 and TRA-1-60. Figure 7A Expression in wild-type cells is presented. Figure 7B Expression in B2M KO clone C4 is shown. Figure 7C Expression in B2M KO clone C9 is presented. Figure 7D Expression in B2M KO clone C12 is shown.

[0081] Figure 8 Figure 2 shows TIDE analysis of B2M gRNA cleavage in CyT49 cells. B2M gRNA-1, -2, or -3 were tested.

[0082] Figures 9A-9B Shown in WT CyT49 cells ( Figure 9A ) and edited CyT49 cells ( Figure 9B ) Flow cytometric assessment of B2M expression in the presence and absence of IFN-γ.

[0083] Figure 10 The plasmid map of the B2M-CAGGS-PD-L1 donor vector for HDR is shown.

[0084] Figure 11 Flow cytometric analysis of the pluripotency of B2M KO+PD-L1 KI CyT49 stem cells is shown. Derived clones were >99% double positive for OCT4 and SOX2, two transcription factors crucial for pluripotency. IgG was used as a negative control.

[0085] Figures 12A-12B WT CyT49 ( Figure 12A ) and B2M KO / PD-L1 KI( Figure 12B Flow cytometric analysis of stem cell clones derived from WT cells. WT cells upregulate B2M expression in response to IFNγ. B2M KO / PD-L1 KI clones fully express PD-L1 and do not express B2M with or without IFNγ treatment. NT-1 = untreated. INTG-1 = cells treated with 50 ng / mL IFNγ for 48 hours.

[0086] Figure 13 The plasmid map of the B2M-CAGGS-HLA-E donor vector used for HDR is shown.

[0087] Figure 14 Flow cytometric analysis of the pluripotency of B2M KO / HLA-E KI CyT49 stem cells is shown. Derived clones were >99% double positive for OCT4 and SOX2, two transcription factors crucial for pluripotency. IgG was used as a negative control.

[0088] Figure 15Flow cytometric analysis of WT CyT49 and B2M KO / HLA-E KI CyT49 stem cell clones is shown. WT cells upregulate HLA-A, B, and C expression in response to IFNγ. B2M KO / HLA-E KI clones express no HLA-A, B, and C with or without IFNγ treatment. IFNγ = 50 ng / mL. Cells were treated with IFNγ for 48 hours.

[0089] Figure 16 Flow cytometric analysis of HLA-E expression in B2M KO / HLA-E KI CyT49 stem cell clones is shown. Unedited clones were used as controls for HLA-E expression.

[0090] Figure 17 Shown are flow cytometry for FOXA2 and SOX17 at stage 1 (definitive endoderm) cells differentiated from wild-type, PD-L1 KI / B2M KO, or B2MKO hESCs.

[0091] Figure 18 Shown are the quantitative percentages of FOXA2 and SOX17 expression in stage 1 (definitive endoderm) cells differentiated from wild-type, PD-L1 KI / B2M KO, or B2M KO cells.

[0092] Figure 19 Shown are the quantitative percentages of CHGA, PDX1, and NKX6.1 expression in stage 4 (PEC) cells differentiated from wild-type, B2M KO, PD-L1 KI / B2M KO (V1A), or HLA-E KI / B2M KO (V2A) cells.

[0093] Figure 20 A heterogeneous cell population at stage 4 (PEC) is shown.

[0094] Figures 21A-21B Shown are cells differentiated from wild-type, PD-L1KI / B2MKO or B2MKO cells ( Figure 21A ) and cells differentiated from B2M KO / HLA-E KI (V2A) cells ( Figure 21B ) along the differentiation time course.

[0095] Figures 22A-22F Shown are B2M and PD-L1 expression at the PEC stage in cells differentiated from wild-type, PD-L1 KI / B2M KO, or B2M KO cells. Figure 22A B2M expression in wild-type cells is shown. Figure 22B Shown is B2M expression in B2MKO cells. Figure 22CShown is B2M expression in PD-L1 KI / B2M KO cells. Figure 22D PD-L1 expression in wild-type cells is shown. Figure 22E Shown is PD-L1 expression in B2MKO cells. Figure 22F Shown is PD-L1 expression in PD-L1 KI / B2M KO cells.

[0096] Figures 23A-23F Shown are MHC class I and class II expression at the PEC stage in cells differentiated from wild-type, PD-L1 KI / B2M KO, or B2M KO cells. Figure 23A MHC class I expression in wild-type cells is shown. Figure 23B Shown is MHC class I expression in B2M KO cells. Figure 23C Shown is MHC class I expression in PD-L1 KI / B2M KO cells. Figure 23D MHC class II PD-L1 expression in wild-type cells is shown. Figure 23E Shown is MHC class II expression in B2M KO cells. Figure 23F Shown is MHC class II expression in PD-L1 KI / B2M KO cells.

[0097] Figures 24A-24D Shown is a flow cytometric analysis of T cell activation using a CFSE proliferation assay. Human primary CD3+ T cells were co-incubated with PECs derived from WT, B2M KO, or B2M KO / PD-L1 KI CyT49 clones. Figure 24A Activation in wild-type cells is shown. Figure 24B Activation in PD-L1 KI / B2M KO cells is shown. Figure 24C Activation in B2MKO cells is shown. Figure 24D T cell activation in various cell types is summarized. One-way ANOVA (α = 0.05, using Dunnett's multiple comparison test) was performed using the "CFSE-T alone" group as a control. *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001. ns = not significant. DETAILED DESCRIPTION

[0098] I. Definition

[0099] Deletion: As used herein, the term "deletion", which can be used interchangeably with the term "genetic deletion" or "knockout", generally refers to the following genetic modification, wherein a site or region of genomic DNA is removed by any molecular biological method, such as the method described herein, for example, by delivering an endonuclease and at least one gRNA to the site of genomic DNA. Any number of nucleotides can be deleted. In some embodiments, the deletion involves removing at least one, at least two, at least three, at least four, at least five, at least ten, at least fifteen, at least twenty, or at least 25 nucleotides. In some embodiments, the deletion involves removing 10-50, 25-75, 50-100, 50-200, or more than 100 nucleotides. In some embodiments, the deletion involves removing an entire target gene, such as the B2M gene. In some embodiments, the deletion involves removing a portion of the target gene, such as all or part of the promoter and / or coding sequence of the B2M gene. In some embodiments, the deletion involves removing a transcriptional regulatory factor of the target gene, such as a promoter region. In some embodiments, the deletion involves removing all or part of the coding region so that the product normally expressed by the coding region is no longer expressed, is expressed in a truncated form, or is expressed at a reduced level. In some embodiments, the deletion results in reduced expression of the gene relative to unmodified cells.

[0100] Endonuclease: As used herein, the term "endonuclease" generally refers to an enzyme that cleaves phosphodiester bonds within a polynucleotide. In some embodiments, the endonuclease specifically cleaves phosphodiester bonds within a DNA polynucleotide. In some embodiments, the endonuclease is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), a homing endonuclease (HE), a meganuclease, MegaTAL, or a CRISPR-associated endonuclease. In some embodiments, the endonuclease is an RNA-guided endonuclease. In certain aspects, the RNA-guided endonuclease is a CRISPR nuclease, such as a type II CRISPR Cas9 endonuclease or a type V CRISPR Cpf1 endonuclease. In some embodiments, the endonuclease is Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm

[00135] The invention further comprises a Cmr6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, or Cpf1 endonuclease, or a homolog thereof, a recombinant of a naturally occurring molecule thereof, a codon-optimized form thereof, or a modified form thereof, or a combination thereof. In some embodiments, the endonuclease can introduce one or more single-strand breaks (SSBs) and / or one or more double-strand breaks (DSBs).

[0101] Genetic modification: As used herein, the term "genetic modification" generally refers to a genomic DNA site that has been genetically edited or manipulated using any molecular biology method, such as the method described herein, for example, by delivering an endonuclease and at least one gRNA to the site of genomic DNA. Exemplary genetic modifications include insertions, deletions, duplications, inversions, and translocations and combinations thereof. In some embodiments, the genetic modification is a deletion. In some embodiments, the genetic modification is an insertion. In other embodiments, the genetic modification is an insertion-deletion mutation (or indel), which shifts the reading frame of the target gene, thereby resulting in a change in the gene product or the absence of a gene product.

[0102] Guide RNA (gRNA): As used herein, the term "guide RNA" or "gRNA" generally refers to a short ribonucleic acid that can interact with an endonuclease, e.g., bind to an endonuclease, and bind to or hybridize with a target genomic site or region. In some embodiments, the gRNA is a single-molecule guide RNA (sgRNA). In some embodiments, the gRNA may comprise a spacer extension. In some embodiments, the gRNA may comprise a tracrRNA extension. In some embodiments, the gRNA is single-stranded. In some embodiments, the gRNA comprises naturally occurring nucleotides. In some embodiments, the gRNA is a chemically modified gRNA. In some embodiments, the chemically modified gRNA is a gRNA comprising at least one nucleotide having a chemical modification (e.g., a 2'-O-methyl sugar modification). In some embodiments, the chemically modified gRNA comprises a modified nucleic acid backbone. In some embodiments, the chemically modified gRNA comprises 2'-O-methyl-phosphorothioate residues. In some embodiments, the gRNA can be pre-complexed with a DNA endonuclease.

[0103] Insertion: As used herein, the term "insertion", which can be used interchangeably with the term "genetic insertion" or "knock-in", generally refers to the following genetic modification, wherein a polynucleotide is introduced or added to a site or region of genomic DNA by any molecular biological method, such as the method described herein, for example, by delivering an endonuclease and at least one gRNA to the site of genomic DNA. In some embodiments, insertion can occur in or near a site of a site that has been previously genetically modified (e.g., a deletion or insertion-deletion mutation) of the genomic DNA. In some embodiments, insertion occurs at a site of the genomic DNA that partially overlaps, completely overlaps, or is contained within the site of the previous genetic modification (e.g., a deletion or insertion-deletion mutation). In some embodiments, insertion occurs at a safe harbor locus. In some embodiments, insertion involves the introduction of a polynucleotide encoding a protein of interest. In some embodiments, insertion involves the introduction of a polynucleotide encoding a tolerogenic factor. In some embodiments, insertion involves the introduction of a polynucleotide encoding a survival factor. In some embodiments, insertion involves the introduction of an exogenous promoter, such as a constitutive promoter (e.g., a CAG promoter). In some embodiments, insertion involves the introduction of a polynucleotide encoding a non-coding gene. Typically, the polynucleotide to be inserted is flanked by sequences (eg, homology arms) that share significant sequence homology with genomic DNA at or near the site of insertion.

[0104] Major Histocompatibility Complex Class I (MHC-I): As used herein, the term "major histocompatibility complex class I" or "MHC-I" generally refers to a class of biomolecules that are found on the cell surface of all nucleated cells in vertebrates (including mammals, such as humans) and function to display peptides of non-self or foreign antigens (e.g., proteins) from within the cell (i.e., the cytosol) to cytotoxic T cells (e.g., CD8+ T cells) in order to stimulate an immune response. In some embodiments, the MHC-I biomolecule is an MHC-I gene or MHC-I protein. Complexation of MHC-I proteins with beta-2 microglobulin (B2M) is required for cell surface expression of all MHC-I proteins. In some embodiments, reducing the expression of MHC-I human leukocyte antigens (HLAs) relative to unmodified cells involves a reduction (or decrease) in the expression of MHC-I genes. In some embodiments, reducing the expression of MHC-I human leukocyte antigens (HLAs) relative to unmodified cells involves a reduction (or decrease) in the expression of MHC-I proteins on the cell surface. In some embodiments, the MHC-I biomolecule is HLA-A (NCBI Gene ID No.: 3105), HLA-B (NCBI Gene ID No.: 3106), HLA-C (NCBI Gene ID No.: 3107), or B2M (NCBI Gene ID No.: 567).

[0105] Major histocompatibility complex class II (MHC-II): As used herein, the term "major histocompatibility complex class II" or "MHC-II" generally refers to a class of biomolecules that are typically found on the cell surface of antigen-presenting cells in vertebrates (including mammals, such as humans); and function to display peptides of non-self or foreign antigens (e.g., proteins) from the outside (extracellular) of the cell to cytotoxic T cells (e.g., CD8+ T cells) in order to stimulate an immune response. In some embodiments, the antigen-presenting cell is a dendritic cell, a macrophage, or a B cell. In some embodiments, the MHC-II biomolecule is an MHC-II gene or an MHC-II protein. In some embodiments, reducing the expression of MHC-II human leukocyte antigens (HLAs) relative to unmodified cells involves a reduction (or decrease) in the expression of MHC-II genes. In some embodiments, reducing the expression of MHC-II human leukocyte antigens (HLAs) relative to unmodified cells involves a reduction (or decrease) in the cell surface expression of MHC-II proteins. In some embodiments, the MHC-II biomolecule is HLA-DPA (NCBI gene ID: 3113), HLA-DPB (NCBI gene ID: 3115), HLA-DMA (NCBI gene ID: 3108), HLA-DMB (NCBI gene ID: 3109), HLA-DOA (NCBI gene ID: 3111), HLA-DOB (NCBI gene ID: 3112), HLA-DQA (NCBI gene ID: 3117), HLA-DQB (NCBI gene ID: 3119), HLA-DRA (NCBI gene ID: 3122) or HLA-DRB (NCBI gene ID: 3123).

[0106] Polynucleotide: As used herein, the term "polynucleotide," which can be used interchangeably with the term "nucleic acid," generally refers to a biomolecule comprising two or more nucleotides. In some embodiments, the polynucleotide comprises at least two, at least five, at least ten, at least twenty, at least 30, at least 40, at least 50, at least 100, at least 200, at least 250, at least 500, or any number of nucleotides. The polynucleotide can be a DNA or RNA molecule or a hybrid DNA / RNA molecule. The polynucleotide can be single-stranded or double-stranded. In some embodiments, the polynucleotide is a site or region of genomic DNA. In some embodiments, the polynucleotide is an endogenous gene contained within the genome of an unmodified cell or a universal donor cell. In some embodiments, the polynucleotide is an exogenous polynucleotide that is not integrated into genomic DNA. In some embodiments, the polynucleotide is an exogenous polynucleotide that is integrated into genomic DNA. In some embodiments, the polynucleotide is a plasmid or an adeno-associated viral vector. In some embodiments, the polynucleotide is a circular or linear molecule.

[0107] Safe harbor locus: As used herein, the term "safe harbor locus" generally refers to any position, site, or region of genomic DNA that can accommodate genetic insertions into the position, site, or region without adverse effects on the cell. In some embodiments, the safe harbor locus is an intragenic or extragenic region. In some embodiments, the safe harbor locus is a region of genomic DNA that is typically transcriptionally silent. In some embodiments, the safe harbor locus is AAVS1 (PPP1 R12C), ALB, Angptl3, ApoC3, ASGR2, CCR5, FIX (F9), G6PC, Gys2, HGD, Lp (a), Pcsk9, Serpinal, TF, or TTR locus. In some embodiments, the safe harbor locus is described in Sadelain, M. et al., "Safe harbors for the integration of new DNA in the human genome," Nature Reviews Cancer, 2012, Vol. 12, pp. 51-58.

[0108] Safety switch: As used herein, the term "safety switch" generally refers to a biomolecule that causes a cell to undergo apoptosis. In some embodiments, the safety switch is a protein or a gene. In some embodiments, the safety switch is a suicide gene. In some embodiments, a safety switch (e.g., herpes simplex virus thymidine kinase (HSV-tk)) causes a cell to undergo apoptosis by metabolizing a prodrug (e.g., ganciclovir). In some embodiments, the overexpression of the safety switch alone causes a cell to undergo apoptosis. In some embodiments, the safety switch is a p53-based molecule, HSV-tk, or inducible caspase-9.

[0109] Subject: As used herein, the term "subject" refers to a mammal. In some embodiments, the subject is a non-human primate or rodent. In some embodiments, the subject is a human. In some embodiments, the subject has, is suspected of having, or is at risk for a disease or disorder. In some embodiments, the subject has one or more symptoms of a disease or disorder.

[0110] Survival factor: As used herein, the term "survival factor" generally refers to a protein (e.g., expressed by a polynucleotide as described herein) that, when increased or decreased in a cell, enables the cell (e.g., a universal donor cell) to survive at a higher survival rate relative to unmodified cells after transplantation or implantation into a host subject. In some embodiments, the survival factor is a human survival factor. In some embodiments, the survival factor is a member of a key pathway involved in cell survival. In some embodiments, the key pathway involved in cell survival is associated with hypoxia, reactive oxygen species, nutrient deprivation, and / or oxidative stress. In some embodiments, the genetic modification (e.g., deletion or insertion) of at least one survival factor enables universal donor cells to survive for a longer period of time after implantation than unmodified cells, for example, a period of at least 1.05 times, at least 1.1 times, at least 1.25 times, at least 1.5 times, at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 10 times, at least 20 times, or at least 50 times. In some embodiments, the survival factor is ZNF143 (NCBI gene ID number: 7702), TXNIP (NCBI gene ID number: 10628), FOXO1 (NCBI gene ID number: 2308), JNK (NCBI gene ID number: 5599) or MANF (NCBI gene ID number: 7873). In some embodiments, the survival factor is inserted into the cell (e.g., universal donor cell). In some embodiments, the survival factor is deleted from the cell (universal donor cell). In some embodiments, the insertion of a polynucleotide encoding MANF enables the cell (e.g., universal donor cell) to survive at a higher survival rate relative to unmodified cells after transplantation or implantation into a host subject. In some embodiments, a deletion or insertion-deletion mutation within or near the ZNF143, TXNIP, FOXO1 or JNK gene enables the cell (e.g., universal donor cell) to survive at a higher survival rate relative to unmodified cells after transplantation or implantation into a host subject.

[0111] Tolerogenic factor: As used herein, the term "tolerogenic factor" generally refers to a protein (e.g., expressed by a polynucleotide as described herein) that, when increased or decreased in a cell, enables the cell (e.g., a universal donor cell) to suppress or escape immune rejection at a higher rate relative to unmodified cells after transplantation or implantation into a host subject. In some embodiments, the tolerogenic factor is a human tolerogenic factor. In some embodiments, the genetic modification of at least one tolerogenic factor (e.g., insertion or deletion of at least one tolerogenic factor) enables the cell (e.g., universal donor cell) to suppress or escape immune rejection at a rate that is at least 1.05 times, at least 1.1 times, at least 1.25 times, at least 1.5 times, at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 10 times, at least 20 times, or at least 50 times higher than an unmodified cell after implantation. In some embodiments, the tolerogenic factor is HLA-E (NCBI gene ID number: 3133), HLA-G (NCBI gene ID number: 3135), CTLA-4 (NCBI gene ID number: 1493), CD47 (NCBI gene ID number: 961) or PD-L1 (NCBI gene ID number: 29126). In some embodiments, the tolerogenic factor is inserted into a cell (e.g., a universal donor cell). In some embodiments, the tolerogenic factor is deleted from a cell (e.g., a universal donor cell). In some embodiments, the insertion of a polynucleotide encoding HLA-E, HLA-G, CTLA-4, CD47 and / or PD-L1 enables the cell (e.g., universal donor cell) to suppress or escape immune rejection after transplantation or implantation into a host subject.

[0112] Transcriptional regulators of MHC-I or MHC-II: As used herein, the term "transcriptional regulator of MHC-I or MHC-II" generally refers to a biomolecule that regulates (e.g., increases or decreases) the expression of MHC-I and / or MHC-II human leukocyte antigens. In some embodiments, the biomolecule is a polynucleotide (e.g., a gene) or a protein. In some embodiments, a transcriptional regulator of MHC-I or MHC-II will increase or decrease the cell surface expression of at least one MHC-I or MHC-II protein. In some embodiments, a transcriptional regulator of MHC-I or MHC-II will increase or decrease the expression of at least one MHC-I or MHC-II gene. In some embodiments, the transcriptional regulator is CIITA (NCBI Gene ID No.: 4261) or NLRC5 (NCBI Gene ID No.: 84166). In some embodiments, the loss or reduction of CIITA or NLRC5 expression reduces the expression of at least one MHC-I or MHC-II gene.

[0113] Universal donor cells: As used herein, the term "universal donor cells" generally refers to genetically modified cells that are less susceptible to allogeneic rejection during cell transplantation and / or exhibit increased survival after transplantation relative to unmodified cells. In some embodiments, genetically modified cells as described herein are universal donor cells. In some embodiments, universal donor cells have increased immune escape and / or cell survival compared to unmodified cells. In some embodiments, universal donor cells have increased cell survival compared to unmodified cells. In some embodiments, universal donor cells can be stem cells. In some embodiments, universal donor cells can be embryonic stem cells (ESCs), adult stem cells (ASCs), induced pluripotent stem cells (iPSCs), or hematopoietic stem or progenitor cells (HSPCs). In some embodiments, universal donor cells can be differentiated cells. In some embodiments, universal donor cells can be somatic cells (e.g., immune system cells). In some embodiments, universal donor cells are administered to subjects. In some embodiments, universal donor cells are administered to subjects suffering from, suspected of having, or at risk of a disease. In some embodiments, universal donor cells are capable of differentiating into lineage-restricted progenitor cells or fully differentiated somatic cells. In some embodiments, the lineage-restricted progenitor cell is a pancreatic endoderm progenitor cell, a pancreatic endocrine progenitor cell, a mesenchymal progenitor cell, a muscle progenitor cell, a blast cell, or a neural progenitor cell. In some embodiments, the fully differentiated somatic cell is an endocrine cell such as a pancreatic β cell, an epithelial cell, an endoderm cell, a macrophage, a hepatocyte, a fat cell, a kidney cell, a blood cell, or a cell of the immune system.

[0114] Unmodified cells: As used herein, the term "unmodified cells" refers to cells that have not yet undergone genetic modification involving polynucleotides or genes encoding transcriptional regulatory factors, survival factors and / or tolerogenic factors encoding MHC-I, MHC-I, MHC-I or MHC-II. In some embodiments, the unmodified cells can be stem cells. In some embodiments, the unmodified cells can be embryonic stem cells (ESCs), adult stem cells (ASCs), induced pluripotent stem cells (iPSCs) or hematopoietic stem or progenitor cells (HSPCs). In some embodiments, the unmodified cells can be differentiated cells. In some embodiments, the unmodified cells can be selected from somatic cells (e.g., immune system cells, such as T cells, such as CD8+ T cells). If a universal donor cell is compared "relative to an unmodified cell," the universal donor cell and the unmodified cell are the same cell type or have a common parental cell line, for example, a universal donor iPSC is compared relative to an unmodified iPSC.

[0115] In or near a gene: As used herein, the term "in or near a gene" refers to a site or region of genomic DNA that is an intron or exon component of the gene or that is located near the gene. In certain embodiments, if the site of the genomic DNA comprises at least a portion of an intron or exon of a gene, the site of the genomic DNA is in the gene. In certain embodiments, the site of the genomic DNA located near a gene can be at the 5' or 3' end of the gene (e.g., the 5' or 3' end of the coding region of the gene). In certain embodiments, the site of the genomic DNA located near a gene can be a promoter region or a repressor region that regulates the expression of the gene. In certain embodiments, the site of the genomic DNA located near a gene can be on the same chromosome as the gene. In certain embodiments, if the site or region of the genomic DNA is within or closer to 50Kb, 40Kb, 30Kb, 20Kb, 10Kb, 5Kb, 1Kb of the 5' or 3' end of the gene (e.g., the 5' or 3' end of the coding region of the gene), the site or region of the genomic DNA is near the gene.

[0116] II. Genome Editing Methods

[0117] Genome editing generally refers to a process of modifying a genomic nucleotide sequence preferably in an accurate or predetermined manner. In some embodiments, genome editing methods as described herein (e.g., CRISPR- endonuclease systems) can be used to genetically modify cells as described herein, for example to produce universal donor cells. In some embodiments, genome editing methods as described herein (e.g., CRISPR- endonuclease systems) can be used to genetically modify cells as described herein, for example to introduce at least one genetic modification in or near at least one gene that reduces the expression of one or more MHC-I and / or MHC-II human leukocyte antigens or other components of the MHC-I or MHC-II complex relative to unmodified cells; to introduce at least one genetic modification that increases the expression of at least one polynucleotide encoding a tolerogenic factor relative to unmodified cells; and / or to introduce at least one genetic modification that increases or decreases the expression of at least one gene encoding a survival factor relative to unmodified cells.

[0118] Examples of genome editing methods described herein include methods for cutting deoxyribonucleic acid (DNA) at precise target locations in the genome using a site-directed nuclease, thereby generating single-stranded or double-stranded DNA breaks at specific locations within the genome. Such breaks can and are regularly repaired by natural endogenous cellular processes such as homology-directed repair (HDR) and non-homologous end joining (NHEJ), as described in Cox et al., "Therapeutic genome editing: prospects and challenges," Nature Medicine, 2015, 21(2), 121-31. These two main DNA repair processes consist of a series of alternative pathways. NHEJ directly connects the DNA ends produced by double-strand breaks, sometimes losing or adding nucleotide sequences, which can disrupt or enhance gene expression. HDR uses homologous sequences or donor sequences as templates to insert a determined DNA sequence at the breakpoint. The homologous sequence can be in the endogenous genome (such as sister chromatids). Alternatively, the donor sequence can be an exogenous polynucleotide, such as a plasmid, a single-stranded oligonucleotide, a double-stranded oligonucleotide, a duplex oligonucleotide, or a virus, which has regions of high homology to the locus cleaved by the nuclease (e.g., left and right homology arms), but can also contain additional sequences or sequence changes (including deletions that can be incorporated into the cleaved target locus). A third repair mechanism can be microhomology-mediated end joining (MMEJ), also known as "alternative NHEJ," which has genetic consequences similar to NHEJ in that small deletions and insertions can occur at the cleavage site. MMEJ can utilize homologous sequences of several base pairs flanking the DNA break site to drive a more favorable DNA end-joining repair outcome, and recent reports have further elucidated the molecular mechanism of this process; see, for example, Cho and Greenberg, Nature, 2015, 518, 174-76; Kent et al., Nature Structural and Molecular Biology, 2015, 22(3): 230-7; Mateos-Gomez et al., Nature, 2015, 518, 254-57; Ceccaldi et al., Nature, 2015, 528, 258-62. In some cases, the likely repair outcome can be predicted based on analysis of potential microhomologies at the DNA break site.

[0119] Each of these genome editing mechanisms can be used to produce the desired genetic modification. A step in the genome editing process can be to produce one or two DNA breaks in the target locus near the expected mutation site, the latter being a double-strand break or two single-strand breaks. As described and shown herein, this can be achieved using endonucleases.

[0120] CRISPR endonuclease system

[0121] The CRISPR-endonuclease system is a naturally occurring defense mechanism in prokaryotes that has been reused as a DNA targeting platform for RNA guidance for gene editing. CRISPR systems include type I, II, III, IV, V, and VI systems. In some aspects, the CRISPR system is a type II CRISPR / Cas9 system. In other aspects, the CRISPR system is a type V CRISPR / Cprf system. The CRISPR system relies on a DNA endonuclease (e.g., Cas9) and two non-coding RNAs (crisprRNA (crRNA) and trans-activating RNA (tracrRNA)) to target DNA for cleavage.

[0122] CrRNA drives the sequence recognition and specificity of CRISPR-endonuclease complex by Watson-Crick base pairing with about 20 nucleotide (nt) sequences in target DNA.Changing the sequence of 5'20nt in crRNA allows CRISPR-endonuclease complex to be targeted to a specific locus.If the target sequence is followed by a specific short DNA motif (sequence is NGG) (called protospacer adjacent motif (PAM)), the CRISPR-endonuclease complex only binds to the DNA sequence containing the first 20nt sequence matching with a single guide RNA (sgRNA).

[0123] The tracrRNA hybridizes to the 3' end of the crRNA to form an RNA duplex structure, which binds to the endonuclease to form a catalytically active CRISPR-endonuclease complex that can then cleave the target DNA.

[0124] Once the CRISPR-endonuclease complex binds to the DNA at the target site, two independent nuclease domains within the endonuclease each cleave one of the DNA strands three bases upstream of the PAM site, leaving a double-strand break (DSB) where both strands of the DNA terminate with base pairs (blunt ends).

[0125] In some embodiments, the endonuclease is Cas9 (CRISPR-associated protein 9). In some embodiments, the Cas9 endonuclease is from Streptococcus pyogenes, but other Cas9 homologs can be used, such as Staphylococcus aureus (S.aureus) Cas9, Neisseria meningitidis (N.meningitidis) Cas9, Streptococcus thermophilus (S.thermophilus) CRISPR 1Cas9, Streptococcus thermophilus CRISPR 3Cas9 or Treponema denticola (T.denticola) Cas9. In other cases, the CRISPR endonuclease is Cpf1, such as L.bacterium ND2006 Cpf1 or Acidaminococcus sp. BV3L6 Cpf1. In some embodiments, the endonuclease is Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, or Cpf1 endonuclease. In some embodiments, wild-type variants can be used. In some embodiments, modified forms of the foregoing endonucleases may be used (e.g., homologs thereof, recombinants of naturally occurring molecules thereof, codon-optimized thereof, or modified forms thereof).

[0126] The CRISPR nuclease may be linked to at least one nuclear localization signal (NLS). The at least one NLS may be located at or within 50 amino acids of the amino terminus of the CRISPR nuclease, and / or the at least one NLS may be located at or within 50 amino acids of the carboxyl terminus of the CRISPR nuclease.

[0127] Exemplary CRISPR / Cas polypeptides include those disclosed in Fonfara et al., “Phylogeny of Cas9 determines functional exchangeability of dual-RNA and Cas9 among orthologous type II CRISPR-Cas systems,” Nucleic Acids Research, 2014, 42:2577-2590. Since the discovery of Cas genes, the CRISPR / Cas gene nomenclature has been extensively rewritten. Fonfara et al. also provide PAM sequences of Cas9 polypeptides from various species.

[0128] Zinc finger nucleases

[0129] Zinc finger nucleases (ZFNs) are modular proteins composed of an engineered zinc finger DNA binding domain connected to the catalytic domain of the type II endonuclease FokI. Since FokI only functions as a dimer, a pair of ZFNs must be engineered to bind to the homologous target "half-site" sequences on opposite DNA strands, and the precise spacing between them enables the formation of catalytically active FokI dimers. Following dimerization of the FokI domains, which themselves have no sequence specificity, a DNA double-strand break is generated between the ZFN half-sites, serving as the initial step in genome editing.

[0130] The DNA binding domain of each ZFN is typically composed of 3-6 zinc fingers with a rich Cys2-His2 architecture, each finger primarily recognizing nucleotide triplets on one strand of the target DNA sequence, although cross-strand interactions with the fourth nucleotide may also be important. Changes in the amino acids of the fingers in the positions that make key contacts with DNA will change the sequence specificity of a given finger. Therefore, a four-finger zinc finger protein will selectively recognize a 12bp target sequence, where the target sequence is a composite of the triplet preferences contributed by each finger, but the triplet preferences may be affected to varying degrees by adjacent fingers. An important aspect of ZFNs is that ZFNs can be easily retargeted to almost any genomic address by simply modifying a single finger. In most applications of ZFNs, proteins with 4-6 fingers are used, each recognizing 12-18bp. Therefore, a pair of ZFNs will typically recognize a combined target sequence of 24-36bp (excluding the typical 5-7bp spacer between half sites). The binding sites can be further separated by larger spacers (including 15-17bp). Assuming that repetitive sequences or gene homologs are excluded during the design process, a target sequence of this length may be unique in the human genome. However, ZFN protein-DNA interactions are not absolute in their specificity, so off-target binding and cleavage events do occur, either as heterodimers between two ZFNs or as homodimers of one or the other of the ZFNs. By engineering the dimerization interface of the FokI domain to produce "positive" and "negative" variants (also known as obligate heterodimer variants, which can only dimerize with each other but not with themselves), the latter possibility is effectively eliminated. Promoting obligate heterodimers prevents the formation of homodimers. This greatly improves the specificity of ZFNs and any other nucleases that employ these FokI variants.

[0131] A variety of ZFN-based systems have been described in the art, modifications of which are regularly reported, and a large reference literature describes the rules and parameters used to guide ZFN design; see, for example, Segal et al., Proc Natl Acad Sci, 199996(6):2758-63; Dreier B et al., J Mol Biol., 2000, 303(4):489-502; Liu Q et al., J Biol Chem., 2002, 277(6):3850-6; Dreier et al., J Biol Chem., 2005, 280(42):35588-97; and Dreier et al., J Biol Chem. 2001, 276(31):29466-78.

[0132] Transcription activator-like effector nucleases (TALENs)

[0133] TALENs represent another form of modular nucleases, in which, like ZFNs, an engineered DNA binding domain is linked to the FokI nuclease domain, and a pair of TALENs act in tandem to achieve targeted DNA cleavage. The main difference from ZFNs is the nature of the DNA binding domain and the associated target DNA sequence recognition properties. The TALEN DNA binding domain is derived from TALE proteins, which were originally described in the plant bacterial pathogen Xanthomonas sp. TALEs consist of a tandem array of 33-35 amino acid repeats, each of which recognizes a single base pair in the target DNA sequence, which is typically up to 20 bp long, bringing the total target sequence length to 40 bp. The nucleotide specificity of each repeat is determined by a repeat variable diresidue (RVD), which includes two amino acids only at positions 12 and 13. Guanine, adenine, cytosine, and thymine bases are primarily recognized by four RVDs: Asn-Asn, Asn-Ile, His-Asp, and Asn-Gly, respectively. This constitutes a much simpler recognition code than zinc fingers, thus offering advantages over zinc fingers in nuclease design. However, like ZFNs, the protein-DNA interactions of TALENs are not absolute in their specificity, and TALENs also benefit from the use of obligate heterodimer variants of the FokI domain to reduce off-target activity.

[0134] Additional variants of the FokI domain have been generated that are inactivated in their catalytic function. If half of the TALEN or ZFN pair contains an inactivated FokI domain, only single-stranded DNA cleavage (nicking) will occur at the target site, and no DSB will occur. The results are comparable to using CRISPR / Cas9 or CRISPR / Cpf1 "nickase" mutants (in which one of the Cas9 cleavage domains has been inactivated). DNA nicking can be used to drive genome editing by HDR, but is less efficient than DSBs. The main benefit is that off-target nicks are repaired quickly and accurately, unlike DSBs, which are susceptible to NHEJ-mediated error repair.

[0135] A variety of TALEN-based systems have been described in the art, and modifications thereof are regularly reported; see, e.g., Boch, Science, 2009 326(5959):1509-12; Mak et al., Science, 2012, 335(6069):716-9; and Moscou et al., Science, 2009, 326(5959):1501. Several groups have described the use of TALENs based on the "Golden Gate" platform or cloning protocol; see, for example, Cermak et al., Nucleic Acids Res., 2011, 39(12):e82; Li et al., Nucleic Acids Res., 2011, 39(14):6315-25; Weber et al., PLoS One., 2011, 6(2):e16765; Wang et al., J Genet Genomics, 2014, 41(6):339-47.; and Cermak T et al., Methods Mol Biol., 20151239:133-59.

[0136] Homing endonucleases

[0137] Homing endonucleases (HEs) are sequence-specific endonucleases that have long recognition sequences (14-44 base pairs) and typically cleave DNA at a unique site in the genome with high specificity. There are at least six known HE families classified by their structure, including GIY-YIG, His-Cis box, HNH, PD-(D / E)xK, and Vsr-like, which are derived from a variety of hosts, including eukaryotes, protists, bacteria, archaea, cyanobacteria, and bacteriophages. Like ZFNs and TALENs, HEs can be used to produce DSBs at the target locus as the starting step for genome editing. In addition, some natural and engineered HEs only cut single strands of DNA, thereby acting as site-specific nickases. The larger target sequences of HEs and the specificity provided by HEs make them attractive candidates for producing site-specific DSBs.

[0138] A variety of HE-based systems have been described in the art, and modifications are regularly reported; see, for example, the reviews in Steentoft et al., Glycobiology, 2014, 24(8):663-80; Belfort and Bonocora, Methods Mol Biol., 2014, 1123:1-26; and Hafez and Hausner, Genome, 2012, 55(8):553-69.

[0139] MegaTAL / Tev-mTALEN / MegaTev

[0140] As additional examples of hybrid nucleases, the MegaTAL platform and the Tev-mTALEN platform utilize the fusion of a TALE DNA binding domain and a catalytically active HE, taking advantage of both the tunable DNA binding and specificity of the TALE and the cleavage sequence specificity of the HE; see, e.g., Boissel et al., Nucleic Acids Res., 2014, 42:2591-2601; Kleinstiver et al., G3, 2014, 4:1155-65; and Boissel and Scharenberg, Methods Mol. Biol., 2015, 1239:171-96.

[0141] In another variation, the MegaTev architecture is a fusion of a meganuclease (Mega) with a nuclease domain derived from the GIY-YIG homing endonuclease I-TevI ​​(Tev). The two active sites are approximately 30 bp apart on the DNA substrate and generate two DSBs with incompatible sticky ends; see, for example, Wolfs et al., Nucleic Acids Res., 2014, 42, 8816-29. It is anticipated that other combinations of existing nuclease-based methods will be developed and can be used to achieve targeted genome modification as described herein.

[0142] dCas9-FokI or dCpf1-Fok1 and other nucleases

[0143] Combining the structural and functional properties of the above-mentioned nuclease platform provides an alternative method for genome editing that may overcome some inherent defects. For example, the CRISPR genome editing system typically uses a single Cas9 endonuclease to generate DSBs. The specificity of the target is driven by a sequence of 20 or 24 nucleotides in the guide RNA that undergoes Watson-Crick base pairing with the target DNA (plus an additional 2 bases in the adjacent NAG or NGG PAM sequence in the case of Cas9 from Streptococcus pyogenes). This sequence is long enough to be unique in the human genome, however, the specificity of the RNA / DNA interaction is not absolute and can sometimes tolerate significant promiscuity, especially at the 5' half of the target sequence, which effectively reduces the number of bases that drive specificity. One solution to this is to completely inactivate the catalytic function of Cas9 or Cpf1 (retaining only the RNA-guided DNA binding function) and fuse the FokI domain to the inactivated Cas9; see, for example, Tsai et al., Nature Biotech., 2014, 32:569-76; and Guilinger et al., Nature Biotech., 2014, 32:577-82. Because FokI must dimerize to become catalytically active, two guide RNAs are required to tether the two FokI fusions in close proximity to form a dimer and cleave DNA. This essentially doubles the number of bases in the combined target site, thereby increasing the stringency of targeting by CRISPR-based systems.

[0144] As another example, the fusion of a TALE DNA binding domain with a catalytically active HE (such as I-TevI) simultaneously utilizes both the tunable DNA binding and specificity of TALE and the cleavage sequence specificity of I-TevI, which is expected to further reduce off-target cleavage.

[0145] RNA-guided endonucleases

[0146] The RNA-guided endonuclease system as used herein can comprise an amino acid sequence having at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% amino acid sequence identity to a wild-type exemplary endonuclease (e.g., Cas9 from Streptococcus pyogenes, US2014 / 0068797 Sequence ID No. 8 or Sapranauskas et al., Nucleic Acids Res, 39(21):9275-9282 (2011)). The endonuclease may comprise at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or 100% identity to a wild-type endonuclease (e.g., Cas9 from Streptococcus pyogenes, supra) over 10 consecutive amino acids. The endonuclease may comprise at most: at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or 100% identity to a wild-type endonuclease (e.g., Cas9 from Streptococcus pyogenes, supra) over 10 consecutive amino acids. The endonuclease may comprise at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% identity to a wild-type endonuclease (e.g., Cas9 from Streptococcus pyogenes, supra) over 10 consecutive amino acids in the HNH nuclease domain of the endonuclease. The endonuclease may comprise at most 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% identity to a wild-type endonuclease (e.g., Cas9 from Streptococcus pyogenes, supra) over 10 consecutive amino acids in the HNH nuclease domain of the endonuclease. The endonuclease may comprise at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or 100% identity to a wild-type endonuclease (e.g., Cas9 from Streptococcus pyogenes, supra) over 10 consecutive amino acids in the RuvC nuclease domain of the endonuclease. The endonuclease may comprise at most 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or 100% identity to a wild-type endonuclease (e.g., Cas9 from Streptococcus pyogenes, supra) over 10 consecutive amino acids in the RuvC nuclease domain of the endonuclease.

[0147] Endonucleases can include modified forms of wild-type exemplary endonucleases.The modified forms of wild-type exemplary endonucleases can include mutations that reduce the nucleic acid cleavage activity of endonucleases.The modified forms of wild-type exemplary endonucleases can have less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5% or less than 1% of the nucleic acid cleavage activity of wild-type exemplary endonucleases (e.g., Cas9 from Streptococcus pyogenes, ibid).The modified form of endonucleases may not have significant nucleic acid cleavage activity.When an endonuclease is a modified form without significant nucleic acid cleavage activity, it is referred to as "enzymatically inactivated" in this article.

[0148] The mutation envisioned can include substitution, addition and deletion or any combination thereof. Mutation converts the mutated amino acid into alanine. Mutation converts the mutated amino acid into another amino acid (e.g., glycine, serine, threonine, cysteine, valine, leucine, isoleucine, methionine, proline, phenylalanine, tyrosine, tryptophan, aspartic acid, glutamic acid, asparagine, glutamine, histidine, lysine or arginine). Mutation converts the mutated amino acid into a non-natural amino acid (e.g., selenomethionine). Mutation converts the mutated amino acid into an amino acid mimic (e.g., phosphate mimics). Mutation can be a conservative mutation. For example, mutation converts the mutated amino acid into an amino acid (e.g., cysteine / serine mutation, lysine / asparagine mutation, histidine / phenylalanine mutation) that is similar to the size, shape, charge, polarity, conformation and / or rotamer of the mutated amino acid. Mutation can cause the shift of the reading frame and / or the generation of premature termination codons. Mutation can cause the change of the regulatory region of the gene or locus that affects one or more gene expressions.

[0149] guide RNA

[0150] The present disclosure provides guide RNA (gRNA), which can guide the activity of related endonucleases to specific target sites within polynucleotides. The guide RNA can include at least one spacer sequence and CRISPR repeats that hybridize with the target nucleic acid sequence of interest. In the II type CRISPR system, the gRNA also includes a second RNA called a tracrRNA sequence. In the II type CRISPR guide RNA (gRNA), the CRISPR repeats and tracrRNA sequences hybridize with each other to form a duplex. In the V type CRISPR system, the gRNA includes the crRNA that forms a duplex. In certain embodiments, the gRNA can bind to the endonuclease so that the gRNA and the endonuclease form a complex. The gRNA can provide target specificity for the complex due to its association with the endonuclease. Therefore, the nucleic acid of the targeted genome can guide the activity of the endonuclease.

[0151] Exemplary guide RNAs include spacer sequences comprising 15-200 nucleotides, wherein the gRNA targets a genomic location based on the GRCh38 human genome assembly. As will be appreciated by those of ordinary skill in the art, each gRNA can be designed to include a spacer sequence complementary to its genomic target site or region. See Jinek et al., Science, 2012, 337, 816-821 and Deltcheva et al., Nature, 2011, 471, 602-607.

[0152] The gRNA may be a double-molecule guide RNA. The gRNA may be a single-molecule guide RNA.

[0153] The bi-molecule guide RNA can comprise two RNA chains. The first chain comprises an optional spacer extension sequence, a spacer sequence, and a minimal CRISPR repeat sequence in the 5' to 3' direction. The second chain can comprise a minimal tracrRNA sequence (complementary to the minimal CRISPR repeat sequence), a 3' tracrRNA sequence, and an optional tracrRNA extension sequence.

[0154] Single molecule guide RNA (sgRNA) can include optional spacer extension sequence, spacer sequence, minimum CRISPR repeat sequence, single molecule guide joint, minimum tracrRNA sequence, 3' tracrRNA sequence and optional tracrRNA extension sequence in 5' to 3' direction.Optional tracrRNA extension sequence can include elements that contribute other functions (e.g., stability) to guide RNA.Single molecule guide joint can connect minimum CRISPR repeat sequence and minimum tracrRNA sequence to form a hairpin structure.Optional tracrRNA extension can include one or more hairpins.

[0155] In some embodiments, the sgRNA comprises a spacer sequence of 20 nucleotides at the 5' end of the sgRNA sequence. In some embodiments, the sgRNA comprises a spacer sequence of less than 20 nucleotides at the 5' end of the sgRNA sequence. In some embodiments, the sgRNA comprises a spacer sequence of more than 20 nucleotides at the 5' end of the sgRNA sequence. In some embodiments, the sgRNA comprises a spacer sequence of variable length of 17-30 nucleotides at the 5' end of the sgRNA sequence. In some embodiments, the sgRNA comprises a spacer extension sequence of more than 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, or 200 nucleotides in length. In some embodiments, the sgRNA comprises a spacer extension sequence that is less than 3, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100 nucleotides in length.

[0156] In some embodiments, the sgRNA comprises a spacer extension sequence containing another portion (e.g., a stability control sequence, an endoribonuclease binding sequence, or a ribozyme). This portion can reduce or increase the stability of the nucleic acid targeting the nucleic acid. This portion can be a transcription terminator segment (i.e., a transcription termination sequence). This portion can work in eukaryotic cells. This portion can work in prokaryotic cells. This portion can work in both eukaryotic and prokaryotic cells. Non-limiting examples of suitable moieties include: a 5' cap (e.g., a 7-methylguanylate cap (m7G)), a riboswitch sequence (e.g., allowing proteins and protein complexes to regulate stability and / or regulate accessibility), a sequence that forms a dsRNA duplex (i.e., a hairpin), a sequence that targets the RNA to a subcellular location (e.g., the nucleus, mitochondria, chloroplasts, etc.), a modification or sequence that provides tracking (e.g., direct conjugation to a fluorescent molecule, conjugation to a moiety that facilitates fluorescent detection, a sequence that allows for fluorescent detection, etc.), and / or a modification or sequence that provides a binding site for a protein (e.g., a protein that acts on DNA, including transcriptional activators, transcriptional repressors, DNA methyltransferases, DNA demethylases, histone acetyltransferases, histone deacetylases, etc.).

[0157] In some embodiments, the sgRNA comprises a spacer sequence that hybridizes with a sequence in a target polynucleotide. The spacer of the gRNA can interact with the target polynucleotide in a sequence-specific manner via hybridization (i.e., base pairing). The nucleotide sequence of the spacer can vary depending on the sequence of the target nucleic acid of interest.

[0158] In the CRISPR-endonuclease system, a spacer sequence can be designed to hybridize to a target polynucleotide located 5' of the PAM of the endonuclease used in the system. The spacer can be a perfect match to the target sequence or there can be mismatches. Each endonuclease (e.g., Cas9 nuclease) has a specific PAM sequence that allows the endonuclease to recognize the target DNA. For example, Streptococcus pyogenes Cas9 recognizes a PAM comprising the sequence 5'-NRG-3', where R comprises A or G, where N is any nucleotide and where N is immediately 3' of the target nucleic acid sequence targeted by the spacer sequence.

[0159] The target polynucleotide sequence may comprise 20 nucleotides. The target polynucleotide may comprise less than 20 nucleotides. The target polynucleotide may comprise more than 20 nucleotides. The target polynucleotide may comprise at least: 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. The target polynucleotide may comprise at most: 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. The target polynucleotide sequence may comprise 20 bases immediately 5' of the first nucleotide adjacent to the PAM.

[0160] The spacer sequence that hybridizes to the target polynucleotide can have a length of at least about 6 nucleotides (nt).The spacer sequence can be at least about 6nt, at least about 10nt, at least about 15nt, at least about 18nt, at least about 19nt, at least about 20nt, at least about 25nt, at least about 30nt, at least about 35nt or at least about 40nt, from about 6nt to about 80nt, from about 6nt to about 50nt, from about 6nt to about 45nt, from about 6nt to about 40nt, from about 6nt to about 35nt, from about 6nt to about 30nt, from about 6nt to about 25nt, from about 6nt to about 20nt, from about 6nt to about 19nt, from about 10nt to about 50nt, from about 10nt to about 45nt, from about 10nt to about 40nt, from about 10nt to about 50nt In some instances, the spacer sequence can include 20 nucleotides. In some instances, the spacer can include 19 nucleotides. In some instances, the spacer can include 18 nucleotides. In some instances, the spacer can include 22 nucleotides.

[0161] In some instances, the percent complementarity between the spacer sequence and the target nucleic acid is at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or 100%. In some instances, the percent complementarity between the spacer sequence and the target nucleic acid is at most about 30%, at most about 40%, at most about 50%, at most about 60%, at most about 65%, at most about 70%, at most about 75%, at most about 80%, at most about 85%, at most about 90%, at most about 95%, at most about 97%, at most about 98%, at most about 99%, or 100%. In some examples, the percent complementarity between the spacer sequence and the target nucleic acid is 100% over the six consecutive 5' nucleotides of the target sequence of the complementary strand of the target nucleic acid. The percent complementarity between the spacer sequence and the target nucleic acid can be at least 60% over approximately 20 consecutive nucleotides. The length of the spacer sequence and the target nucleic acid can differ by 1 to 6 nucleotides, which can be considered as one or more protrusions.

[0162] The tracrRNA sequence may comprise nucleotides that hybridize to a minimal CRISPR repeat sequence in a cell. The minimal tracrRNA sequence and the minimal CRISPR repeat sequence may form a duplex, i.e., a double-stranded structure of base pairing. The minimal tracrRNA sequence and the minimal CRISPR repeat sequence may together bind to an RNA-guided endonuclease. At least a portion of the minimal tracrRNA sequence may hybridize to the minimal CRISPR repeat sequence. The minimal tracrRNA sequence may have at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% complementarity to the minimal CRISPR repeat sequence.

[0163] The minimum tracrRNA sequence can have a length from about 7 nucleotides to about 100 nucleotides.For example, the length of the minimum tracrRNA sequence can be from about 7 nucleotides (nt) to about 50nt, from about 7nt to about 40nt, from about 7nt to about 30nt, from about 7nt to about 25nt, from about 7nt to about 20nt, from about 7nt to about 15nt, from about 8nt to about 40nt, from about 8nt to about 30nt, from about 8nt to about 25nt, from about 8nt to about 20nt, from about 8nt to about 15nt, from about 15nt to about 100nt, from about 15nt to about 80nt, from about 15nt to about 50nt, from about 15nt to about 40nt, from about 15nt to about 30nt or from about 15nt to about 25nt. The length of the minimum tracrRNA sequence can be about 9 nucleotides. The minimum tracrRNA sequence can be about 12 nucleotides. The minimal tracrRNA may consist of tracrRNA nt 23-48 described in Jinek et al. (supra).

[0164] The minimal tracrRNA sequence can have at least about 60% identity with a reference minimal tracrRNA (e.g., wild-type tracrRNA from Streptococcus pyogenes) sequence over a stretch of at least 6, 7, or 8 consecutive nucleotides. For example, the minimal tracrRNA sequence can have at least about 65% identity, about 70% identity, about 75% identity, about 80% identity, about 85% identity, about 90% identity, about 95% identity, about 98% identity, about 99% identity, or 100% identity with a reference minimal tracrRNA sequence over a stretch of at least 6, 7, or 8 consecutive nucleotides.

[0165] The duplex between the minimal CRISPR RNA and the minimal tracrRNA comprises a double helix. The duplex between the minimal CRISPR RNA and the minimal tracrRNA may comprise at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotides. The duplex between the minimal CRISPR RNA and the minimal tracrRNA may comprise at most about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotides.

[0166] A duplex may contain mismatches (i.e., the two strands of the duplex are not 100% complementary). A duplex may contain at least about 1, 2, 3, 4, or 5 mismatches. A duplex may contain up to about 1, 2, 3, 4, or 5 mismatches. A duplex may contain no more than 2 mismatches.

[0167] In some embodiments, the tracrRNA can be a 3' tracrRNA. In some embodiments, the 3' tracrRNA sequence can comprise a sequence having at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or 100% sequence identity to a reference tracrRNA sequence (e.g., a tracrRNA from Streptococcus pyogenes).

[0168] In some embodiments, the gRNA may comprise a tracrRNA extension sequence. The tracrRNA extension sequence may have a length of from about 1 nucleotide to about 400 nucleotides. The tracrRNA extension sequence may have a length of more than 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, or 200 nucleotides. The tracrRNA extension sequence may have a length of from about 20 to about 5000 or more nucleotides. The tracrRNA extension sequence may have a length of less than 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100 nucleotides. The length of the tracrRNA extension sequence may comprise less than 10 nucleotides. The length of the tracrRNA extension sequence may be 10-30 nucleotides. The length of the tracrRNA extension sequence may be 30-70 nucleotides.

[0169] The tracrRNA extension sequence can include a functional portion (e.g., a stability control sequence, a ribozyme, an endoribonuclease binding sequence). The functional portion can include a transcription terminator segment (i.e., a transcription termination sequence). The functional portion can have a total length of from about 10 nucleotides (nt) to about 100 nucleotides, from about 10nt to about 20nt, from about 20nt to about 30nt, from about 30nt to about 40nt, from about 40nt to about 50nt, from about 50nt to about 60nt, from about 60nt to about 70nt, from about 70nt to about 80nt, from about 80nt to about 90nt, or from about 90nt to about 100nt, from about 15nt to about 80nt, from about 15nt to about 50nt, from about 15nt to about 40nt, from about 15nt to about 30nt, or from about 15nt to about 25nt.

[0170] In some embodiments, the sgRNA may include a linker sequence having a length of from about 3 nucleotides to about 100 nucleotides. In Jinek et al. (supra), for example, a simple "tetracycle" of 4 nucleotides (-GAAA-) is used (Jinek et al., Science [Science], 2012, 337 (6096): 816-821). Illustrative linkers have a length of from about 3 nucleotides (nt) to about 90nt, from about 3nt to about 80nt, from about 3nt to about 70nt, from about 3nt to about 60nt, from about 3nt to about 50nt, from about 3nt to about 40nt, from about 3nt to about 30nt, from about 3nt to about 20nt, from about 3nt to about 10nt. For example, the linker can have a length of from about 3 nt to about 5 nt, from about 5 nt to about 10 nt, from about 10 nt to about 15 nt, from about 15 nt to about 20 nt, from about 20 nt to about 25 nt, from about 25 nt to about 30 nt, from about 30 nt to about 35 nt, from about 35 nt to about 40 nt, from about 40 nt to about 50 nt, from about 50 nt to about 60 nt, from about 60 nt to about 70 nt, from about 70 nt to about 80 nt, from about 80 nt to about 90 nt, or from about 90 nt to about 100 nt. The linker of the single-molecule guide nucleic acid can be between 4 and 40 nucleotides. The linker can be at least about 100, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, or 7000 or more nucleotides. The linker can be up to about 100, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, or 7000 nucleotides or more.

[0171] The linker can comprise any of a variety of sequences, although in some instances the linker will not comprise a sequence with extensive regions of homology to other portions of the guide RNA, which may result in intramolecular binding that may interfere with other functional regions of the guide. In Jinek et al. (supra), a simple 4-nucleotide sequence -GAAA- was used (Jinek et al., Science, 2012, 337(6096):816-821), but many other sequences, including longer sequences, can also be used.

[0172] The linker sequence can comprise a functional portion. For example, the linker sequence can comprise one or more features, including an aptamer, a ribozyme, a protein interaction hairpin, a protein binding site, a CRISPR array, an intron, or an exon. The linker sequence can comprise at least about 1, 2, 3, 4, or 5 or more functional portions. In some instances, the linker sequence can comprise at most about 1, 2, 3, 4, or 5 or more functional portions.

[0173] In some embodiments, the sgRNA does not comprise uracil, for example, at the 3' end of the sgRNA sequence. In some embodiments, the sgRNA comprises one or more uracils, for example, at the 3' end of the sgRNA sequence. In some embodiments, the sgRNA comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 uracils (U) at the 3' end of the sgRNA sequence.

[0174] The sgRNA can be chemically modified. In some embodiments, the chemically modified gRNA is a gRNA comprising at least one nucleotide having a chemical modification (e.g., a 2'-O-methyl sugar modification). In some embodiments, the chemically modified gRNA comprises a modified nucleic acid backbone. In some embodiments, the chemically modified gRNA comprises 2'-O-methyl-phosphorothioate residues. In some embodiments, the chemical modification enhances stability, reduces the likelihood or extent of an innate immune response, and / or enhances other properties, as described in the art.

[0175] In some embodiments, the modified gRNA can comprise a modified backbone, such as phosphorothioate, phosphotriester, morpholino, methylphosphonate, short chain alkyl or cycloalkyl intersugar linkages, or short chain heteroatom or heterocyclic intersugar linkages.

[0176] Morpholino-based compounds are described in the following literature: Braasch and David Corey, Biochemistry, 2002, 41(14):4503-4510; Genesis, 2001, Vol. 30, No. 3; Heasman, Dev. Biol., 2002, 243:209-214; Nasevicius et al., Nat. Genet., 2000, 26:216-220; Lacerra et al., Proc. Natl. Acad. Sci., 2000, 97:9591-9596.; and U.S. Patent No. 5,034,506, issued July 23, 1991.

[0177] Cyclohexenyl nucleic acid oligonucleotide mimetics are described in Wang et al., J. Am. Chem. Soc., 2000, 122: 8595-8602.

[0178] In some embodiments, the modified gRNA may comprise one or more substituted sugar moieties at the 2' position, such as one of the following: OH, SH, SCH3, F, OCN, OCH3, OCH3 O(CH2)n CH3, O(CH2)n NH2, or O(CH2)n CH3, wherein n is from 1 to about 10; C1 to C10 lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl, or aralkyl; Cl; Br; CN; CF3; OCF3; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; SOCH3; SO2 CH3; ONO2; NO2; N3; NH2; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted silyl; RNA cleavage group; reporter group; intercalator; 2'-O-(2-methoxyethyl); 2'-methoxy(2'-O-CH3); 2'-propoxy(2'-OCH2 CH2CH3); and 2'-fluoro (2'-F). Similar modifications can also be made at other positions of the gRNA, particularly the 3' position of the sugar on the 3' terminal nucleotide and the 5' position of the 5' terminal nucleotide. In some examples, both the sugar and the internucleoside bond (i.e., the backbone) of the nucleotide unit can be replaced by novel groups.

[0179] The guide RNA may also additionally or alternatively include modifications or substitutions of nucleobases (often referred to in the art as "bases"). As used herein, "unmodified" or "natural" nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C), and uracil (U). Modified nucleobases include those found only rarely or transiently in natural nucleic acids, such as hypoxanthine, 6-methyladenine, 5-methylpyrimidines, particularly 5-methylcytosine (also known as 5-methyl-2'deoxycytosine and commonly referred to in the art as 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC, and gentiobiosyl HMC, as well as synthetic nucleobases such as 2-aminoadenine, 2-(methylamino)adenine, 2-(imidazolylalkyl)adenine, 2-(aminoalkylamino)adenine or other heterosubstituted alkyladenines, 2-thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6(6-aminohexyl)adenine, and 2,6-diaminopurine. Kornberg, A., DNA Replication, WH Freeman & Co., San Francisco, pp. 75-77, 1980; Gebeyehu et al., Nucl. Acids Res., 1997, 15:4513. Also included are "universal" bases known in the art, such as inosine. 5-Me-C substitutions have been shown to increase nucleic acid duplex stability by 0.6°C to 1.2°C. (Sanghvi, YS, Crooke, ST, and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) as an aspect of base substitution.

[0180] Modified nucleobases may include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine ... Pyrimidine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenine and guanine, 5-halo, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracil and cytosine, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, and 3-deazaguanine and 3-deazaadenine. Complex of nucleic acid and endonuclease targeting the genome

[0181] The gRNA interacts with an endonuclease (e.g., an RNA-guided nuclease such as Cas9) to form a complex. The gRNA guides the endonuclease to the target polynucleotide.

[0182] Endonuclease and gRNA can be applied to cells or subjects separately. In certain embodiments, endonuclease can be pre-compounded with one or more guide RNAs or one or more crRNAs and tracrRNAs. Pre-composite materials can then be applied to cells or subjects. Such pre-composite materials are called ribonucleoprotein particles (RNPs). The endonuclease in RNP can be, for example, Cas9 endonuclease or Cpf1 endonuclease. Endonuclease can be flanked by one or more nuclear localization signals (NLS) at the N-terminus, C-terminus, or both the N-terminus and the C-terminus. For example, Cas9 endonuclease can be flanked by two NLSs, one NLS at the N-terminus and the second NLS at the C-terminus. NLS can be any NLS known in the art, such as SV40 NLS. The weight ratio of the nucleic acid targeting the genome to the endonuclease in RNP can be 1:1. For example, the weight ratio of sgRNA to Cas9 endonuclease in RNP can be 1:1.

[0183] Nucleic acids encoding system components

[0184] The present disclosure provides nucleic acids comprising nucleotide sequences encoding the genome-targeting nucleic acids of the present disclosure, the endonucleases of the present disclosure, and / or any nucleic acid or protein molecule necessary to perform various aspects of the methods of the present disclosure. The encoding nucleic acid can be RNA, DNA, or a combination thereof.

[0185] Nucleic acids encoding the genome-targeting nucleic acids of the disclosure, the endonucleases of the disclosure, and / or any nucleic acid or protein molecule necessary to perform aspects of the methods of the disclosure can constitute a vector (eg, a recombinant expression vector).

[0186] The term "vector" refers to a nucleic acid molecule that can transport another nucleic acid that it is connected. One type of vector is a "plasmid", which refers to a circular double-stranded DNA loop that can connect other nucleic acid segments. Another type of vector is a viral vector, in which other nucleic acid segments can be connected to the viral genome. Some vectors can replicate autonomously (for example, with bacterial vectors and additional mammalian vectors of bacterial replication origin) in the host cell they introduce. Other vectors (for example, non-additional mammalian vectors) are integrated into the genome of the host cell after being introduced into the host cell, thereby replicating along with the host genome.

[0187] In some examples, vectors can be capable of directing the expression of nucleic acids to which they are operatively linked. Such vectors are referred to herein as "recombinant expression vectors," or more simply "expression vectors," which have equivalent functions.

[0188] The term "operably linked" means that the nucleotide sequence of interest is connected to one or more regulatory sequences in a manner that allows the expression of the nucleotide sequence. The term "regulatory sequence" is intended to include, for example, promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are well known in the art and are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology, 1990, 185, Academic Press, San Diego, CA. Regulatory sequences include those that direct constitutive expression of nucleotide sequences in many types of host cells and those that direct expression of nucleotide sequences only in certain host cells (e.g., tissue-specific regulatory sequences). Those skilled in the art will recognize that the design of expression vectors can depend on factors such as the selection of target cells, the desired expression level, etc.

[0189] Contemplated expression vectors include, but are not limited to, viral vectors based on vaccinia virus, poliovirus, adenovirus, adeno-associated virus, SV40, herpes simplex virus, human immunodeficiency virus, retroviruses (e.g., murine leukemia virus, spleen necrosis virus, and vectors derived from retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukemia virus, lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus) and other recombinant vectors. Other contemplated vectors for eukaryotic target cells include, but are not limited to, vectors pXT1, pSG5, pSVK3, pBPV, pMSG, and pSVLSV40 (Pharmacia). Other vectors may be used as long as they are compatible with the host cell.

[0190] In some examples, the vector may contain one or more transcriptional and / or translational control elements. Depending on the host / vector system utilized, any of a number of suitable transcriptional and translational control elements may be used in the expression vector, including constitutive and inducible promoters, transcriptional enhancer elements, transcriptional terminators, and the like. The vector may be a self-inactivating vector that inactivates components of viral sequences or CRISPR machinery or other elements.

[0191] Non-limiting examples of suitable eukaryotic promoters (i.e., promoters that are functional in eukaryotic cells) include those from cytomegalovirus (CMV) immediate early, herpes simplex virus (HSV) thymidine kinase, early and late SV40, long terminal repeats (LTRs) from retroviruses, human elongation factor-1 promoter (EF1), chicken β-actin promoter (CBA), ubiquitin C promoter (UBC), hybrid constructs comprising the cytomegalovirus enhancer fused to the chicken β-actin promoter (CAG), hybrid constructs comprising the cytomegalovirus enhancer fused to the promoter (CAG or CAGGS), the first exon, and the first intron of the chicken β-actin gene, the murine stem cell virus promoter (MSCV), the phosphoglycerate kinase-1 locus promoter (PGK), and the mouse metallothionein-I promoter.

[0192] The promoter can be an inducible promoter (e.g., a heat shock promoter, a tetracycline-regulated promoter, a steroid-regulated promoter, a metal-regulated promoter, an estrogen receptor-regulated promoter, etc.). The promoter can be a constitutive promoter (e.g., a CMV promoter, a UBC promoter, a CAG promoter). In some cases, the promoter can be a spatially restricted and / or temporally restricted promoter (e.g., a tissue-specific promoter, a cell type-specific promoter, etc.).

[0193] Introduction of the complexes, polypeptides, and nucleic acids of the present disclosure into cells can occur by viral or bacteriophage infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, nucleofection, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran-mediated transfection, liposome-mediated transfection, gene gun technology, calcium phosphate precipitation, direct microinjection, nanoparticle-mediated nucleic acid delivery, and the like.

[0194] III. Strategies for escaping the immune response and increasing survival

[0195] Strategies for enabling genetically modified cells (i.e., universal donor cells) to escape an immune response and / or increase their survival or viability after implantation into a subject are described herein. In some embodiments, these strategies enable universal donor cells to escape an immune response and / or survive with a higher success rate than unmodified cells. In some embodiments, the genetically modified cells include the introduction of at least one genetic modification that reduces the expression of one or more MHC-I and MHC-II human leukocyte antigens relative to unmodified cells within or near at least one gene; at least one genetic modification that increases the expression of at least one polynucleotide encoding a tolerogenic factor relative to unmodified cells; and / or at least one genetic modification that alters the expression of at least one gene encoding a survival factor relative to unmodified cells. In some embodiments, the genetically modified cells include the introduction of at least one genetic modification that reduces the expression of one or more MHC-I and MHC-II human leukocyte antigens relative to unmodified cells within or near at least one gene; at least one genetic modification that increases the expression of at least one polynucleotide encoding a tolerogenic factor relative to unmodified cells; and at least one genetic modification that alters the expression of at least one gene encoding a survival factor relative to unmodified cells. In other embodiments, the genetically modified cells comprise at least one deletion or insertion-deletion mutation within or near at least one gene that alters the expression of one or more MHC-I and MHC-II human leukocyte antigens relative to unmodified cells; and at least one insertion of a polynucleotide encoding at least one tolerogenic factor at a site that partially overlaps, completely overlaps, or is contained within the site of the gene deletion that alters the expression of one or more MHC-I and MHC-II HLAs. In yet other embodiments, the genetically modified cells comprise at least one genetic modification that alters the expression of at least one gene encoding a survival factor relative to unmodified cells.

[0196] The genes encoding the major histocompatibility complex (MHC) are located on human chromosome 6p21. The resulting proteins encoded by MHC genes are a series of surface proteins that are crucial for donor compatibility during cell transplantation. MHC genes are divided into MHC class I (MHC-I) and MHC class II (MHC-II). MHC-I genes (HLA-A, HLA-B, and HLA-C) are expressed on nearly all tissue cell types and present peptides processed by "non-self" antigens to CD8+ T cells, promoting their activation into cytolytic CD8+ T cells. Transplanted or implanted cells expressing "non-self" MHC-I molecules will elicit a robust cellular immune response against these cells, ultimately leading to their death through activated cytolytic CD8+ T cells. MHC-I proteins are closely associated with β-2-microglobulin (B2M) in the endoplasmic reticulum, which is essential for the formation of functional MHC-I molecules on the cell surface. In addition, there are three atypical MHC-Ib molecules (HLA-E, HLA-F, and HLA-G) that have immunomodulatory functions. MHC-II biomolecules include HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, and HLA-DR. Due to their primary function in immune responses, MHC-I and MHC-II biomolecules contribute to immune rejection following cell implantation of non-host cells (e.g., cell implantation for regenerative medicine purposes).

[0197] MHC-I cell surface molecules are composed of the MHC-encoded heavy chain (HLA-A, HLA-B, or HLA-C) and the invariant subunit beta-2-microglobulin (B2M). Therefore, reducing the intracellular concentration of B2M is an effective method for reducing the cell surface expression of MHC-I cell surface molecules.

[0198] In some embodiments, the cell comprises genomic modifications of one or more MHC-I or MHC-II genes. In some embodiments, the cell comprises genomic modifications of one or more polynucleotide sequences that regulate the expression of MHC-I and / or MHC-II. In some embodiments, the genetic modification of the present disclosure is carried out using any gene editing method (including but not limited to those described herein).

[0199] In some embodiments, the expression of one or more MHC-I and MHC-II human leukocyte antigens is reduced relative to unmodified cells by directly targeting, for example, genetic deletion and / or insertion of at least one base pair in the MHC-I and / or MHC-II genes. In some embodiments, the expression of one or more MHC-I and MHC-II human leukocyte antigens is reduced relative to unmodified cells by targeting, for example, the CIITA gene for genetic deletion. In some embodiments, the expression of one or more MHC-I and MHC-II human leukocyte antigens is reduced relative to unmodified cells by targeting, for example, at least one transcriptional regulatory factor of MHC-I or MHC-II for genetic deletion. In some embodiments, the transcriptional regulatory factor of MHC-I or MHC-II is NLRC5 or CIITA gene. In some embodiments, the transcriptional regulatory factor of MHC-I or MHC-II is RFX5, RFXAP, RFXANK, NFY-A, NFY-B, NFY-C, IRF-1 and / or TAP1 gene.

[0200] In some embodiments, the genome of the cell has been modified to delete all or a portion of an HLA-A, HLA-B, and / or HLA-C gene. In some embodiments, the genome of the cell has been modified to delete all or a portion of a promoter region of an HLA-A, HLA-B, and / or HLA-C gene. In some embodiments, the genome of the cell has been modified to delete all or a portion of a gene encoding a transcriptional regulator of MHC-I or MHC-II. In some embodiments, the genome of the cell has been modified to delete all or a portion of a promoter region of a gene encoding a transcriptional regulator of MHC-I or MHC-II.

[0201] In certain embodiments, the genome of the cell has been modified to reduce the expression of beta-2-microglobulin (B2M). B2M is a non-polymorphic gene encoding the common protein subunit required for the surface expression of all polymorphic MHC class I heavy chains. The HLA-I protein is closely related to the B2M in the endoplasmic reticulum, and the B2M is crucial for forming the HLA-I molecules expressed on the surface of functional cells. In certain embodiments, the site comprising 5'GCTACT CTCTCTTTCTGGCC 3' sequence (SEQ ID NO: 1) in the gRNA targeting B2M gene. In certain embodiments, the site comprising 5'GGCCGAGATGTCTCGCTC CG 3' sequence (SEQ ID NO: 2) in the gRNA targeting B2M gene. In certain embodiments, the site comprising 5'CGCGAGCACAGCTAAGGCCA 3' sequence (SEQ ID NO: 3) in the gRNA targeting B2M gene. In alternative embodiments, the gRNA targets a site within the B2M gene comprising any one of the following sequences: 5'-TATAAGTGGAGGCGTCGCGC-3' (SEQ ID NO: 35), 5'-GAGTAGCGCGAGCACAGCTA-3' (SEQ ID NO: 36), 5'-ACTGGACGCGTCGCGCTGGC-3' (SEQ ID NO: 37), 5'-AAGTGGAGGCGTCGCGCTGG-3' (SEQ ID NO: 38), 5-GGCCACGGAGCGAGACATCT-3' (SEQ ID NO: 39), 5'-GCCCGA ATGCTGTCAGCTTC-3' (SEQ ID NO: 40), 5'-CTCGCGCTACTCT CTCTTTC-3' (SEQ ID NO: 41), 5'-TCCTGAAGCTGACAGCATTC-3' (SEQ ID NO: 42), 5'-TTCCTGAAGCTGACAGCATT-3' (SEQ ID NO: NO:43) or 5'-ACTCTCTCTTTCTGGCCTGG-3' (SEQ ID NO:44). In some embodiments, the gRNA comprises a polynucleotide sequence of any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, or SEQ ID NO: 44.The gRNA / CRISPR nuclease complex targets and cleaves the target site in the B2M locus. Repair of double-strand breaks by NHEJ may result in the deletion of at least one nucleotide and / or the insertion of at least one nucleotide, thereby disrupting or eliminating the expression of B2M. Alternatively, the B2M locus can be targeted by at least two CRISPR systems, each containing different gRNAs, such that cleavage at two sites in the B2M locus results in the deletion of the sequence between the two cuts, thereby eliminating the expression of B2M.

[0202] In some embodiments, the genome of the cell has been modified to reduce expression of the class II transactivator (CIITA). CIITA is a member of the LR or nucleotide binding domain (NBD) leucine-rich repeat (LRR) protein family and regulates the transcription of MHC-II by associating with the MHC enhancer. CIITA expression is induced in B cells and dendritic cells depending on the developmental stage and can be induced by IFN-γ in most cell types.

[0203] In some embodiments, the genome of the cells has been modified to reduce expression of NLR family CARD domain-containing 5 (NLRC5). NLRC5 is a key regulator of MHC-I-mediated immune responses and, similar to CIITA, is highly inducible by IFN-γ and can translocate into the cell nucleus. NLRC5 activates the promoter of MHC-I genes and induces transcription of MHC-I and related genes involved in MHC-I antigen presentation.

[0204] In some embodiments, tolerogenic factors can be inserted or reinserted into genetically modified cells to produce universal donor cells for immune pardon. In some embodiments, universal donor cells disclosed herein have been further modified to express one or more tolerogenic factors. Exemplary tolerogenic factors include but are not limited to one or more of HLA-C, HLA-E, HLA-F, HLA-G, PD-L1, CTLA-4-Ig, CD47, CI inhibitors and IL-35. In some embodiments, the genetic modification (e.g., insertion) of at least one polynucleotide encoding at least one tolerogenic factor enables universal donor cells to suppress or escape immune rejection after implantation at a ratio of at least 1.05 times, at least 1.1 times, at least 1.25 times, at least 1.5 times, at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 10 times, at least 20 times or at least 50 times higher than unmodified cells. In some embodiments, insertion of polynucleotides encoding HLA-E, HLA-G, CTLA-4, CD47, and / or PD-L1 enables the universal donor cells to suppress or evade immune rejection following transplantation or implantation into a host subject.

[0205] The polynucleotide encoding the tolerogenic factor generally comprises a left homology arm and a right homology arm of the sequence of the tolerogenic factor encoding the tolerogenic factor at the side joint. The homology arm has significant sequence homology with the genomic DNA at or near the targeted insertion site. For example, the left homology arm can be a nucleotide sequence homologous to the left side or upstream of the target site or the cleavage site, and the right homology arm can be a nucleotide sequence homologous to the right side or downstream of the target site or the cleavage site. The proximal end of each homology arm can be homologous to the genomic DNA sequence adjacent to the cleavage site. Alternatively, the proximal end of each homology arm can be homologous to the genomic DNA sequence positioned away from the cleavage site up to about 10, 20, 30, 40, 50, 60 or 70 core bases. Like this, the polynucleotide encoding the tolerogenic factor can be inserted into the targeted locus within about 10, 20, 30, 40, 50, 60 or 70 base pairs of the cleavage site, and the other genomic DNA adjacent to the cleavage site (and not having homology with the homology arm) can be missing. The length range of homology arms can be from about 50 nucleotides to several thousand nucleotides. In certain embodiments, the length range of homology arms can be from about 500 nucleotides to about 1000 nucleotides. The significant sequence homology between homology arms and the genomic DNA can be at least about 80%, at least about 85%, at least about 90%, at least about 95% or at least about 99%.

[0206] In some embodiments, the homology arm is used together with a B2M guide (e.g., a gRNA comprising a nucleotide sequence of SEQ ID NO: 1-3 or 35-44). In some embodiments, the homology arm is designed to be used together with any B2M guide that will eliminate the start site of the B2M gene. In some embodiments, the B2M homology arm may include a polynucleotide sequence of SEQ ID NO: 13 or 19 or a polynucleotide sequence with a polynucleotide sequence of SEQ ID NO: 13 or 19 having at least 85%, 90%, 95% or 99% sequence identity, or consisting essentially of it. In some embodiments, the left B2M homology arm may include SEQ ID NO: 13 or a polynucleotide sequence with a polynucleotide sequence of SEQ ID NO: 13 having at least 85%, 90%, 95% or 99% sequence identity, or consisting essentially of it. In some embodiments, the right B2M homology arm can comprise, or consist essentially of, SEQ ID NO: 19, or a polynucleotide sequence having at least 85%, 90%, 95%, or 99% sequence identity to the polynucleotide sequence of SEQ ID NO: 19.

[0207] The at least one polynucleotide encoding at least one tolerogenic factor can be operably linked to an exogenous promoter. The exogenous promoter can be a constitutive promoter, an inducible promoter, a time-specific promoter, a tissue-specific promoter, or a cell type-specific promoter. In some embodiments, the exogenous promoter is a CMV, EF1a, PGK, CAG, or UBC promoter.

[0208] In some embodiments, the at least one polynucleotide encoding at least one tolerogenic factor is inserted into a safe harbor locus (e.g., the AAVS1 locus). In some embodiments, the at least one polynucleotide encoding at least one tolerogenic factor is inserted into a site or region of genomic DNA that partially overlaps, completely overlaps, or is contained within (i.e., within or near) an MHC-I gene, an MHC-II gene, or a transcriptional regulator of MHC-I or MHC-II.

[0209] In some embodiments, a polynucleotide encoding PD-L1 is inserted at a site within or near the B2M locus. In some embodiments, a polynucleotide encoding PD-L1 is inserted at a site within or near the B2M locus simultaneously with or subsequent to deletion of all or a portion of the B2M gene or promoter. The polynucleotide encoding PD-L1 is operably linked to an exogenous promoter. The exogenous promoter can be a CMV promoter.

[0210] In some embodiments, a polynucleotide encoding HLA-E is inserted at a site within or near the B2M locus. In some embodiments, a polynucleotide encoding HLA-E is inserted at a site within or near the B2M locus simultaneously with or subsequent to deletion of all or a portion of the B2M gene or promoter. The polynucleotide encoding HLA-E is operably linked to an exogenous promoter. The exogenous promoter can be a CMV promoter.

[0211] In some embodiments, a polynucleotide encoding HLA-G is inserted at a site within or near the HLA-A, HLA-B, or HLA-C locus. In some embodiments, a polynucleotide encoding HLA-G is inserted at a site within or near the HLA-A, HLA-B, or HLA-C locus simultaneously with or following deletion of the HLA-A, HLA-B, or HLA-C gene or promoter.

[0212] In some embodiments, a polynucleotide encoding CD47 is inserted at a site within or near the CIITA locus. In some embodiments, a polynucleotide encoding CD47 is inserted at a site within or near the CIITA locus simultaneously with or following deletion of the CIITA gene or promoter.

[0213] In some embodiments, a polynucleotide encoding HLA-G is inserted at a site within or near the HLA-A, HLA-B, or HLA-C locus simultaneously with the insertion of a polynucleotide encoding CD47 at a site within or near the CIITA locus.

[0214] In some embodiments, cells include expression of an increase or decrease in one or more survival factors. In some embodiments, cells include insertions of one or more polynucleotide sequences encoding survival factors. In some embodiments, cells include deletions of one or more survival factors. In some embodiments, the genetic modification of the present disclosure is performed using any gene editing method (including but not limited to those described herein). In some embodiments, relative to unmodified cells, cells include expression of an increase or decrease in at least one survival factor. In some embodiments, survival factors are members or key pathways involved in cell survival, such as hypoxia, reactive oxygen species, nutritional deprivation, and / or oxidative stress. In some embodiments, the genetic modification of at least one survival factor enables universal donor cells to survive a longer period of time than unmodified cells after implantation, for example, a period of at least 1.05 times, at least 1.1 times, at least 1.25 times, at least 1.5 times, at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 10 times, at least 20 times, or at least 50 times. In some embodiments, the survival factor is ZNF143, TXNIP, FOXO1, JNK, or MANF.

[0215] In some embodiments, the cells comprise an insertion of a polynucleotide encoding MANF that enables universal donor cells to survive at a higher rate than unmodified cells after transplantation or implantation into a host subject. In some embodiments, the polynucleotide encoding MANF is inserted into a safe harbor locus. In some embodiments, the polynucleotide encoding MANF is inserted into a gene that is a transcriptional regulator of MHC-I, MHC-II, or MHC-I or MHC-II.

[0216] In some embodiments, the genome of the cell has been modified to delete all or a portion of the ZNF143, TXNIP, FOXO1, and / or JNK genes. In some embodiments, the genome of the cell has been modified to delete all or a portion of the promoter region of the ZNF143, TXNIP, FOXO1, and / or JNK genes.

[0217] In some embodiments, more than one survival factor is genetically modified within a cell.

[0218] In certain embodiments, cells without MHC-II expression and with moderate MHC-I expression are genetically modified to lack surface expression of MHC-I or MHC-II. In another embodiment, cells without surface expression of MHC-I / II are further edited to express PD-L1, for example, by insertion of a polynucleotide encoding PD-L1. In yet another embodiment, cells without surface expression of MHC-I / II are further edited to express PD-L1, for example, by insertion of a polynucleotide encoding PD-L1, and are also genetically modified to increase or decrease expression of at least one gene encoding a survival factor relative to unmodified cells.

[0219] In some embodiments, these cells further comprise an increase or decrease in expression (e.g., by genetic modification) of one or more additional genes that are not necessarily implicated in post-implantation immune escape or cell survival. In some embodiments, relative to unmodified cells, these cells further comprise an increase in expression of one or more safety switch proteins. In some embodiments, these cells comprise an increase in expression of one or more additional genes encoding safety switch proteins. In some embodiments, the safety switch is also a suicide gene. In some embodiments, the safety switch is herpes simplex virus-1 thymidine kinase (HSV-tk) or inducible caspase-9. In some embodiments, a polynucleotide encoding at least one safety switch is inserted into the genome, for example, into a safe harbor locus. In some other embodiments, the one or more additional genes encoded by the genetic modification are integrated with one or more of the following constructs: safety switch proteins; targeting patterns; receptors; signaling molecules; transcription factors; pharmaceutically active proteins or peptides; drug target candidates; and proteins that promote their implantation, transport, homing, vitality, self-renewal, persistence, and / or survival.

[0220] One aspect of the present invention provides a method for producing genome-engineered universal donor cells, wherein the universal donor cells comprise at least one targeted genomic modification at one or more selected sites in the genome, the method comprising genetically engineering a cell type as described herein by: introducing one or more constructs into the cells to achieve targeted modification at the selected sites; introducing one or more double-strand breaks at these selected sites into the cells using one or more endonucleases that can recognize the selected sites; and culturing the edited cells to allow endogenous DNA repair to produce targeted insertions or deletions at these selected sites; thereby obtaining genome-modified universal donor cells. The universal donor cells produced by this method will comprise at least one functional targeted genomic modification, and the genome-modified cells, if they are stem cells, will then be able to differentiate into progenitor cells or fully differentiated cells.

[0221] In some other embodiments, the genomically engineered universal donor cells comprise introduced or increased expression of at least one of HLA-E, HLA-G, CD47, or PD-L1. In some embodiments, the genomically engineered universal donor cells are HLA class I and / or class II deficient. In some embodiments, the genomically engineered universal donor cells comprise null or low B2M. In some embodiments, the genomically engineered universal donor cells comprise integrated or non-integrated exogenous polynucleotides encoding one or more of HLA-E, HLA-G, and PD-L1 proteins. In some embodiments, the introduced expression is increased expression from a non-expressed or underexpressed gene contained in the cells. In some embodiments, the non-integrated exogenous polynucleotides are introduced using Sendai virus, AAV, episomes, or plasmids. In some embodiments, the universal donor cells are null for B2M and have introduced expression of one or more of HLA-E, HLA-G, PD-L1, and increased or decreased expression of at least one safety switch protein. In another embodiment, the universal donor cells are null for HLA-A, HLA-B, and HLA-C and have introduced expression of one or more of HLA-E, HLA-G, PD-L1, and at least one safety switch protein. In some embodiments, the universal donor cells are null for B2M and have introduced expression of one or more of HLA-E, HLA-G, PD-L1, and increased or decreased expression of at least one survival factor (e.g., MANF). It is contemplated that methods of producing any of the genetically modified cells described herein are performed using at least any of the gene editing methods described herein.

[0222] IV. Cell Types

[0223] As described herein, cells (e.g., universal donor cells) (and corresponding unmodified cells) can belong to any possible type of cell type. In some embodiments, cells (e.g., universal donor cells) (and corresponding unmodified cells) can be mammalian cells. In some embodiments, cells (e.g., universal donor cells) (and corresponding unmodified cells) can be human cells. In some embodiments, cells (e.g., universal donor cells) (and corresponding unmodified cells) can be stem cells. In some embodiments, cells (e.g., universal donor cells) (and corresponding unmodified cells) can be pluripotent stem cells (PSCs). In some embodiments, cells (e.g., universal donor cells) (and corresponding unmodified cells) can be embryonic stem cells (ESCs), adult stem cells (ASCs), induced pluripotent stem cells (iPSCs), or hematopoietic stem or progenitor cells (HSPCs). In some embodiments, cells (e.g., universal donor cells) (and corresponding unmodified cells) can be differentiated cells. In some embodiments, cells (e.g., universal donor cells) (and corresponding unmodified cells) can be somatic cells, such as immune system cells or contractile cells (e.g., skeletal muscle cells).

[0224] Cells described herein (e.g., universal donor stem cells) can be differentiated into relevant cell types to assess HLA expression, as well as to evaluate the immunogenicity of universal stem cell lines. Typically, differentiation includes maintaining the cells of interest under conditions and time periods sufficient to allow the cells to differentiate into differentiated cells of interest. For example, universal stem cells disclosed herein can be differentiated into mesenchymal progenitor cells (MPCs), low immunogenic cardiomyocytes, muscle progenitor cells, mother cells, endothelial cells (ECs), macrophages, hepatocytes, β cells (e.g., pancreatic β cells), pancreatic endoderm progenitor cells, pancreatic endocrine progenitor cells, or neural progenitor cells (NPCs).

[0225] Stem cells can both proliferate and produce more progenitor cells, which in turn have the ability to produce a large number of mother cells, which in turn can produce differentiated or differentiable daughter cells. The daughter cells themselves can be induced to proliferate and produce offspring, which subsequently differentiate into one or more mature cell types while also retaining one or more cells with the parental developmental potential. Therefore, the term "stem cell" refers to a cell that has the ability or potential to differentiate into a more specialized or more differentiated phenotype under certain circumstances, and in some cases still maintains the ability to proliferate in the absence of substantial differentiation. In one aspect, the term progenitor cell or stem cell refers to a broadly defined mother cell, the daughter (offspring) of which usually specializes in different directions through differentiation (e.g., by acquiring completely independent characteristics) as occurs in the gradual diversification of embryonic cells and tissues. Cell differentiation is a complex process that usually occurs through many cell divisions. Differentiated cells can be derived from pluripotent cells, which themselves are also derived from pluripotent cells, etc. Although each of these pluripotent cells can be considered a stem cell, the range of cell types that each pluripotent cell can produce may vary greatly. Some differentiated cells also have the ability to generate cells with greater developmental potential. This ability can be natural or artificially induced after treatment with various factors. In many biological examples, stem cells can also be "multipotent" because they can produce offspring of more than one different cell type, but this is not required for "stemness."

[0226] A "differentiated cell" is a cell that is further along a developmental pathway than the cell to which it is being compared. Thus, a stem cell can differentiate into a lineage-restricted precursor cell (e.g., a myocyte progenitor cell), which in turn can differentiate into other types of precursor cells further along the pathway (e.g., a myocyte precursor), and then into a terminally differentiated cell (e.g., a myocyte) that plays a specialized role in certain tissue types and may or may not retain the ability to proliferate further.

[0227] Embryonic stem cells

[0228] The cells described herein can be embryonic stem cells (ESCs). ESCs are derived from the embryonic cells of mammalian embryos and are capable of differentiating into any cell type and rapidly proliferating. It is believed that ESCs also have a normal karyotype, maintain high telomerase activity, and exhibit significant long-term proliferation potential, making these cells excellent candidates for use as universal donor cells.

[0229] Adult stem cells

[0230] Cells described herein can be adult stem cells (ASCs). ASCs are undifferentiated cells that can be found in mammals (e.g., humans). ASCs are defined by their ability to self-renew (e.g., by passages of several rounds of cell replication while maintaining their undifferentiated state) and their ability to differentiate into several different cell types (e.g., glial cells). Adult stem cells are a broad class of stem cells that may include hematopoietic stem cells, mammary stem cells, intestinal stem cells, mesenchymal stem cells, endothelial stem cells, neural stem cells, olfactory adult stem cells, neural crest stem cells, and testicular cells.

[0231] Induced Pluripotent Stem Cells

[0232] Cell as described herein can be induced pluripotent stem cells (iPSC). By introducing the gene (for example, Oct4, Sox2, cMyc and Klf4) encoding the key transcription factors involved in pluripotency, iPSC can be produced directly from adult human cells. iPSC can be derived from the same subject of subsequent progenitor cells to be administered. That is, somatic cells can be obtained from the subject, reprogrammed into induced pluripotent stem cells, and then differentiated into progenitor cells (for example, autologous cells) to be administered to the subject. However, in the case of autologous cells, there is still the risk of post-implantation immune response and poor vitality.

[0233] Human hematopoietic stem and progenitor cells

[0234] Cell as described herein can be human hematopoietic stem and progenitor cells (hHSPC).This stem cell lineage produces all blood cell types, including erythroid cells (erythrocytes or erythrocytes (RBC)), myeloid cells (monocytes and macrophages, neutrophils, basophils, eosinophils, megakaryocytes / platelets and dendritic cells) and lymphoid cells (T cells, B cells, NK cells).Hemocytes are produced by the proliferation and differentiation of very small multipotent hematopoietic stem cell (HSC) groups, and these multipotent hematopoietic stem cells also have the ability to supplement themselves by self-renewal. In the differentiation process, the offspring of HSC experience various intermediate maturation stages before reaching maturity, produce multipotent progenitor cells and lineage-directed progenitor cells.Bone marrow (BM) is the main site of hematopoiesis in the human body, and under normal conditions, only a small amount of hematopoietic stem and progenitor cells (HSPC) are found in peripheral blood (PB). Treatment with cytokines, some myelosuppressive drugs used in cancer therapy, and compounds that disrupt the interaction between hematopoietic cells and BM stromal cells can rapidly mobilize large numbers of stem and progenitor cells into the circulation.

[0235] Differentiation of cells into other cell types

[0236] Another step of the method disclosed herein can include differentiating cells into differentiated cells. Differentiation steps can be performed according to any method known in the art. For example, various treatments including activin and B27 supplements (Life Technologies) are used to differentiate human iPSCs into definitive endoderm. Definitive endoderm is further differentiated into hepatocytes, with treatments including: FGF4, HGF, BMP2, BMP4, oncostatin M, dexamethasone, etc. (Duan et al., Stem Cells [stem cells], 2010; 28: 674-686; Ma et al., Stem Cells Translational Medicine [stem cell translational medicine], 2013; 2: 409-419). In another embodiment, differentiation steps can be performed according to Sawitza et al., SciRep. [scientific and technological reports] 2015; 5: 13320. Differentiated cells can be any somatic cell of a mammal (e.g., human). In some embodiments, the somatic cell can be an endocrine epithelial cell (e.g., a thyroid hormone-secreting cell, an adrenal cortex cell), an exocrine epithelial cell (e.g., a salivary gland mucous cell, a prostate cell), a hormone-secreting cell (e.g., anterior pituitary cell, pancreatic islet cell), a cornified epithelial cell (e.g., an epidermal keratinocyte), a wet stratified barrier epithelial cell, a sensory transduction cell (e.g., a photoreceptor), an autonomic neuronal cell, a sensory organ and peripheral neuronal support cell (e.g., a Schwann cell), a central nervous system neuron, a glial cell (e.g., astrocyte, oligodendrocyte), a lens cell, an adipocyte, a renal cell, a barrier function cell (e.g., a ductal cell), an extracellular matrix cell, a contractile cell (e.g., a skeletal muscle cell, a cardiomyocyte, a smooth muscle cell), a blood cell (e.g., an erythrocyte), an immune system cell (e.g., a megakaryocyte, a microglia cell, a neutrophil, a mast cell, a T cell, a B cell, a natural killer cell), a germ cell (e.g., a sperm cell), a trophic cell, or a stromal cell.

[0237] V. Preparation and Administration

[0238] Formulation and delivery for gene editing

[0239] The guide RNAs, polynucleotides (e.g., polynucleotides encoding tolerogenic factors or polynucleotides encoding endonucleases), and endonucleases as described herein can be formulated and delivered to cells in any manner known in the art.

[0240] Depending on the specific mode of administration and dosage form, the guide RNA and / or polynucleotide is formulated with a pharmaceutically acceptable excipient (e.g., a carrier, solvent, stabilizer, adjuvant, diluent, etc.). The guide RNA and / or polynucleotide composition can be formulated to achieve a physiologically compatible pH, and depending on the formulation and route of administration, it ranges from a pH of about 3 to a pH of about 11, about pH 3 to about pH 7. In some cases, the pH can be adjusted to a range from about pH 5.0 to about pH 8. In some cases, the composition can comprise a therapeutically effective amount of at least one compound as described herein and one or more pharmaceutically acceptable excipients. Optionally, the composition can comprise a combination of compounds as described herein, or can include a second active ingredient useful for treating or preventing bacterial growth (e.g., but not limited to, an antibacterial or antimicrobial agent), or can include a combination of agents of the present disclosure.

[0241] Suitable excipients include, for example, carrier molecules including large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polyamino acids, amino acid copolymers, and inactivated viral particles. Other exemplary excipients may include antioxidants such as, but not limited to, ascorbic acid, chelating agents such as, but not limited to, EDTA, carbohydrates such as, but not limited to, dextrins, hydroxyalkyl celluloses, and hydroxyalkyl methyl celluloses, stearic acid, liquids such as, but not limited to, oils, water, saline, glycerol, and ethanol, wetting agents or emulsifiers, pH buffering substances, and the like.

[0242] Guidance RNA polynucleotides (RNA or DNA) and / or one or more endonuclease polynucleotides (RNA or DNA) can be delivered by viral or non-viral delivery vehicles known in the art. Alternatively, one or more endonuclease polypeptides can be delivered by viral or non-viral delivery vehicles known in the art (such as electroporation or lipid nanoparticles). In other alternatives, DNA endonucleases can be delivered as one or more polypeptides individually or in pre-compound with one or more guide RNAs or one or more crRNAs and tracrRNA.

[0243] Polynucleotides can be delivered by non-viral delivery vehicles, which include but are not limited to nanoparticles, liposomes, ribonucleoproteins, positively charged peptides, small molecule RNA-conjugates, aptamer-RNA chimeras, and RNA-fusion protein complexes. Some exemplary non-viral delivery vehicles are described in Peer and Lieberman, Gene Therapy, 2011, 18: 1127-1133 (which focuses on the fact that non-viral delivery vehicles for siRNA can also be used to deliver other polynucleotides).

[0244] For the polynucleotides of the present disclosure, the formulation can be selected from any of those taught, for example, in International Application PCT / US2012 / 069610.

[0245] Polynucleotides such as guide RNA, sgRNA, and mRNA encoding endonucleases can be delivered to cells or subjects via lipid nanoparticles (LNPs).

[0246] LNP refers to any particle with a diameter less than 1000nm, 500nm, 250nm, 200nm, 150nm, 100nm, 75nm, 50nm or 25nm. Alternatively, the size range of nanoparticles can be from 1-1000nm, 1-500nm, 1-250nm, 25-200nm, 25-100nm, 35-75nm or 25-60nm.

[0247] LNPs can be made of cationic, anionic, or neutral lipids. Neutral lipids (such as the fusogenic phospholipid DOPE or the membrane component cholesterol) can be included in LNPs as "helper lipids" to enhance transfection activity and nanoparticle stability. Limitations of cationic lipids include poor efficacy due to poor stability and rapid clearance, as well as the generation of inflammatory or anti-inflammatory responses.

[0248] LNPs can also be composed of hydrophobic lipids, hydrophilic lipids, or both hydrophobic and hydrophilic lipids.

[0249] In some embodiments, the present invention provides the lipid of LNP.Any lipid known in the art or lipid combination all can be used for producing LNP.The example of the lipid for producing LNP is: DOTMA, DOSPA, DOTAP, DMRIE, DC-cholesterol, DOTAP-cholesterol, GAP-DMORIE-DPyPE and GL67A-DOPE-DMPE-polyethylene glycol (PEG).The example of cationic lipid is: 98N12-5, C12-200, DLin-KC2-DMA (KC2), DLin-MC3-DMA (MC3), XTC, MD1 and 7C1.The example of neutral lipid is: DPSC, DPPC, POPC, DOPE and SM.The example of the lipid that PEG modifies is: PEG-DMG, PEG-CerC14 and PEG-CerC20.

[0250] Lipids can be combined in any number of molar ratios to produce LNPs. Additionally, the one or more polynucleotides can be combined in a wide range of molar ratios with one or more lipids to produce LNPs.

[0251] Recombinant adeno-associated virus (AAV) vectors can be used for delivery. The technology for producing rAAV particles, wherein the AAV genome to be packaged (which includes the polynucleotide to be delivered, rep and cap genes and helper virus functions) is provided to the cells, is standard in the art. The production of rAAV generally requires the presence of the following components in a single cell (referred to herein as a packaging cell): the rAAV genome, the AAV rep and cap genes separated from the rAAV genome (i.e., not therein), and helper virus functions. The AAV rep and cap genes can be from any AAV serotype (from which recombinant viruses can be derived), and can be from different AAV serotypes rather than the rAAV genome ITRs, including but not limited to the AAV serotypes described herein. The production of pseudotyped rAAV is disclosed in, for example, International Patent Application Publication No. WO 01 / 83692.

[0252] Preparation and administration of cells (eg, universal donor cells)

[0253] Genetically modified cells as described herein (eg, universal donor cells) can be formulated and administered to a subject by any means known in the art.

[0254] The terms "administering," "introducing," "implanting," "engrafting," and "transplanting" are used interchangeably in the context of placing (by a method or approach that results in at least partial localization of the introduced cells at a desired site) cells (e.g., progenitor cells) into a subject. The cells (e.g., progenitor cells) or their differentiated progeny can be administered by any suitable approach that results in delivery to a desired location in a subject where at least a portion of the implanted cells or cellular components remain viable. Following administration to a subject, the period of viability of the cells can be as short as a few hours (e.g., twenty-four hours), a few days, or as long as several years, or even the lifespan of the subject (i.e., long-term implantation).

[0255] Genetically modified cells as described herein (eg, universal donor cells) can be viable for longer periods of time after administration to a subject than unmodified cells.

[0256] In some embodiments, the composition comprising cells as described herein can be administered by a suitable route, which can include intravenous administration, for example as a bolus or by continuous infusion over a period of time. In some embodiments, intravenous administration can be performed by intramuscular, intraperitoneal, intracerebrospinal, subcutaneous, intraarticular, intrasynovial or intrathecal routes. In some embodiments, the composition can be in solid form, aqueous form or liquid form. In some embodiments, the aqueous or liquid form can be atomized or lyophilized. In some embodiments, the atomized or lyophilized form can be reconstituted with an aqueous or liquid solution.

[0257] The cell compositions may also be emulsified or presented as liposomal compositions, provided that the emulsification process does not adversely affect cell viability. The cells and any other active ingredients may be mixed with excipients that are pharmaceutically acceptable and compatible with the active ingredients and in amounts suitable for use in the methods of treatment described herein.

[0258] Additional agents included in the cell composition may include pharmaceutically acceptable salts of the components thereof. Pharmaceutically acceptable salts include acid addition salts formed with inorganic acids (such as, for example, hydrochloric acid or phosphoric acid) or organic acids (such as acetic acid, tartaric acid, mandelic acid, etc.) (formed with the free amino groups of the polypeptide). Salts formed with free carboxyl groups can also be derived from inorganic bases (such as, for example, sodium hydroxide, potassium hydroxide, ammonium hydroxide, calcium hydroxide, or ferric hydroxide) and organic bases (such as isopropylamine, trimethylamine, 2-ethylaminoethanol, histidine, procaine, etc.).

[0259] Physiologically tolerable carriers are well known in the art. Exemplary liquid carriers are sterile aqueous solutions that do not contain any material except active ingredient and water, or contain buffers (such as sodium phosphate, saline or both at physiological pH, such as phosphate buffered saline). Further, aqueous carriers can contain more than one buffer salt, as well as salts (such as sodium chloride and potassium chloride), dextrose, polyethylene glycol and other solutes. In addition to and excluding water, liquid compositions can also contain a liquid phase. Examples of such other liquid phases are glycerol, vegetable oils (such as cottonseed oil) and water-oil emulsions. The amount of the active compound used in the cell composition for the effective treatment of a particular disorder or illness can depend on the nature of the disorder or illness, and can be determined by standard clinical techniques.

[0260] In certain embodiments, the composition comprising the cell can be administered to a subject (e.g., a human subject) suffering from a disease, suspected of having a disease, or having a risk of disease. In certain embodiments, the composition can be administered to a subject not suffering from a disease, not suspected of having a disease, or having a risk of disease. In certain embodiments, the subject is a healthy person. In certain embodiments, the subject (e.g., a human subject) suffers from a heritable disease, suspects of having a heritable disease, or has a heritable disease risk. In certain embodiments, the subject is suffering from or is at risk of developing symptoms indicating a disease. VI. Specific Compositions and Methods of the Disclosure

[0261] Accordingly, the present disclosure is particularly directed to the following non-limiting compositions and methods.

[0262] In a first composition, Composition 1, the present disclosure provides a composition comprising cells comprising (i) at least one genetic modification within or near at least one gene encoding one or more MHC-I and MHC-II human leukocyte antigens or other components of the MHC-I or MHC-II complex or transcriptional regulatory factors; (ii) at least one genetic modification that increases expression of at least one polynucleotide encoding a tolerogenic factor relative to unmodified cells; and (iii) at least one genetic modification that increases or decreases expression of at least one gene encoding a survival factor relative to unmodified cells.

[0263] In another composition, composition 2, the present disclosure provides a composition comprising cells comprising (i) at least one deletion and / or insertion of at least one base pair within or near at least one gene encoding one or more MHC-I and MHC-II human leukocyte antigens or other components of the MHC-I or MHC-II complex or transcriptional regulatory factors; and (ii) at least one insertion of a polynucleotide encoding at least one tolerogenic factor at a site that partially overlaps with, completely overlaps with, or is contained within the genetic deletion site of (i).

[0264] In another composition, Composition 3, the present disclosure provides a composition comprising cells comprising at least one genetic modification that increases or decreases expression of at least one gene encoding a survival factor relative to unmodified cells.

[0265] In another composition, composition 4, the present disclosure provides a composition as provided in composition 1, wherein the genetic modification of (i) is a deletion.

[0266] In another composition, composition 5, the present disclosure provides a composition as provided in composition 1, wherein the genetic modification of (ii) is the insertion of a polynucleotide encoding a tolerogenic factor at a safe harbor locus or at a site that partially overlaps with, completely overlaps with, or is contained within the genetic modification site of (i).

[0267] In another composition, composition 6, the disclosure provides a composition as provided in composition 1, wherein the genetic modification of (i) is a deletion of a gene encoding one or more MHC-I and MHC-II human leukocyte antigens, or other components of the MHC-I or MHC-II complexes, or transcriptional regulatory factors; and the genetic modification of (ii) is an insertion of a polynucleotide encoding at least one tolerogenic factor at a site that partially overlaps with, completely overlaps with, or is contained within the genetic modification site of (i).

[0268] In another composition, composition 7, the present disclosure provides a composition as provided in any one of compositions 1, 2, or 4 to 6, wherein the at least one gene encoding one or more MHC-I and MHC-II human leukocyte antigens, or other components of the MHC-I or MHC-II complex, or transcriptional regulators is one or more of the following: MHC-I genes (e.g., HLA-A, HLA-B, and HLA-C), MHC-II genes (e.g., HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, and HLA-DR), or genes encoding transcriptional regulators of MHC-I or MHC-II, or other components of the MHC-I complex (e.g., B2M, NLRC5, and CIITA).

[0269] In another composition, composition 8, the present disclosure provides a composition as provided in any one of compositions 1, 2, or 4 to 6, wherein the at least one gene encoding one or more MHC-I and MHC-II human leukocyte antigens or other components of the MHC-I or MHC-II complex or transcriptional regulatory factors is one or more of HLA-A, HLA-B, HLA-C, B2M or CIITA.

[0270] In another composition, composition 9, the disclosure provides a composition as provided in composition 1 or 2, wherein (i) is a deletion within or near one or more of HLA-A, HLA-B, HLA-C, B2M, or CIITA.

[0271] In another composition, composition 10, the present disclosure provides a composition as provided in composition 9, wherein (i) is a deletion within or near HLA-A, a deletion within or near HLA-B, a deletion within or near HLA-C, or a deletion within or near B2M.

[0272] In another composition, composition 11, the present disclosure provides a composition as provided in composition 9, wherein (i) is a deletion within or near HLA-A, a deletion within or near HLA-B, a deletion within or near HLA-C, or a deletion within or near CIITA.

[0273] In another composition, composition 12, the present disclosure provides a composition as provided in any one of compositions 1, 2, or 4 to 11, wherein the at least one polynucleotide encoding a tolerogenic factor is one or more polynucleotides encoding one or more of HLA-E, HLA-G, CTLA-4, CD47, or PD-L1.

[0274] In another composition, composition 13, the present disclosure provides a composition as provided in composition 12, wherein (i) is a deletion within or near B2M, and (ii) is an insertion of a polynucleotide encoding PD-L1 at a site that partially overlaps with, completely overlaps with, or is contained within the deletion in (i).

[0275] In another composition, composition 14, the present disclosure provides a composition as provided in composition 12, wherein (i) is a deletion within or near HLA-A, a deletion within or near HLA-B, or a deletion within or near HLA-C, and (ii) is an insertion of a polynucleotide encoding HLA-G at a site that partially overlaps with, completely overlaps with, or is contained within the deletion in (i) (e.g., an HLA-A deletion).

[0276] In another composition, composition 15, the disclosure provides a composition as provided in composition 12, wherein (i) is a deletion within or near HLA-A, a deletion within or near HLA-B, a deletion within or near HLA-C, or a deletion within or near CIITA; and (ii) is an insertion of a polynucleotide encoding HLA-G at a site that partially overlaps with, completely overlaps with, or is contained within the deletion within or near HLA-A, and an insertion of a polynucleotide encoding CD47 at a site that partially overlaps with, completely overlaps with, or is contained within the deletion within or near CIITA.

[0277] In another composition, composition 16, the present disclosure provides a composition as provided in any one of compositions 1 or 3 to 15, wherein the at least one gene encoding a survival factor is one or more genes encoding one or more of ZNF143, TXNIP, FOXO1, JNK, or MANF.

[0278] In another composition, composition 17, the present disclosure provides a composition as provided in any one of compositions 1 or 3 to 16, wherein the genetic modification that increases or decreases expression of a gene encoding a survival factor relative to unmodified cells is, for example, insertion of a polynucleotide encoding MANF at a safe harbor locus.

[0279] In another composition, composition 18, the disclosure provides a composition as provided in any one of compositions 1 or 3 to 16, wherein the genetic modification that increases or decreases expression of a gene encoding a survival factor relative to unmodified cells is a deletion within or near the ZNF143, TXNIP, FOXO1 or JNK gene that reduces or eliminates expression of the ZNF143, TXNIP, FOXO1 or JNK gene relative to unmodified cells.

[0280] In another composition, composition 19, the present disclosure provides a composition as provided in any one of compositions 1 to 18, wherein the cells further comprise an exogenous polynucleotide that is not integrated into the genomic DNA of the cells.

[0281] In another composition, composition 20, the present disclosure provides a composition as provided in composition 19, wherein the exogenous polynucleotide encodes HLA-E, HLA-G, CTLA-4, CD47, MANF and / or PD-L1.

[0282] In another composition, composition 21, the present disclosure provides a composition as provided in any one of compositions 1 to 20, wherein the cells further comprise increased expression of one or more safety switches relative to unmodified cells.

[0283] In another composition, composition 22, the present disclosure provides a composition as provided in composition 21, wherein the safety switch is herpes simplex virus-1 thymidine kinase (HSV-tk) or inducible caspase-9.

[0284] In another composition, composition 23, the present disclosure provides a composition as provided in composition 21 or 22, wherein the increased expression of one or more safety switches is caused by genetic insertion of a polynucleotide encoding a safety switch protein, e.g., into a safe harbor locus.

[0285] In another composition, composition 24, the present disclosure provides a composition as provided in any of compositions 5, 17 or 23, wherein the safe harbor locus is selected from the group consisting of: AAVS1 (PPP1 R12C), ALB, Angptl3, ApoC3, ASGR2, CCR5, FIX(F9), G6PC, Gys2, HGD, Lp(a), Pcsk9, Serpina1, TF and TTR.

[0286] In another composition, composition 25, the present disclosure provides a composition as provided in any one of compositions 1 to 24, wherein the cells further comprise an additional genetic modification that reduces the expression of any additional gene.

[0287] In another composition, composition 26, the present disclosure provides a composition as provided in any one of compositions 1 to 25, wherein the genetic modification, genetic deletion or genetic insertion is produced by delivering an endonuclease and a guide RNA (gRNA) to the cells.

[0288] In another composition, composition 27, the disclosure provides a composition as provided in composition 26, wherein the endonuclease is Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Cs endonucleases; homologs thereof, recombinants of naturally occurring molecules thereof, codon-optimized or modified versions thereof, and combinations thereof.

[0289] In another composition, composition 28, the present disclosure provides a composition as provided in composition 27, wherein the endonuclease is Cas9, optionally Streptococcus pyogenes Cas9, or a variant thereof comprising an N-terminal SV40 NLS and a C-terminal SV40 NLS.

[0290] In another composition, composition 29, the present disclosure provides a composition as provided in composition 26, wherein the weight ratio of the gRNA to the endonuclease is 1:1.

[0291] In another composition, composition 30, the present disclosure provides a composition as provided in any one of compositions 2, 5, 6, 12 to 15, 17, 19, 20, or 23, wherein the polynucleotide comprises an exogenous promoter.

[0292] In another composition, composition 31, the present disclosure provides a composition as provided in composition 30, wherein the exogenous promoter is CMV, EF1a, PGK, CAG, UBC or other constitutive promoter, inducible promoter, time-specific promoter, tissue-specific promoter or cell type-specific promoter.

[0293] In another composition, composition 32, the present disclosure provides a composition as provided in composition 31, wherein the exogenous promoter is a CAG promoter.

[0294] In another composition, composition 33, the present disclosure provides a composition as provided in any one of compositions 1 to 32, wherein the cells are stem cells (eg, human stem cells).

[0295] In another composition, composition 34, the present disclosure provides a composition as provided in any one of compositions 1 to 33, wherein the cells are embryonic stem cells (ESCs), adult stem cells (ASCs), induced pluripotent stem cells (iPSCs), or hematopoietic stem and progenitor cells (HSPCs).

[0296] In another composition, composition 35, the present disclosure provides a composition as provided in any one of compositions 1 to 32, wherein the cells are differentiated cells.

[0297] In another composition, composition 36, the present disclosure provides a composition as provided in any one of compositions 1 to 32 or 35, wherein the cells are somatic cells.

[0298] In a first approach, Method 1, the present disclosure provides a method of producing modified cells, comprising: (i) introducing at least one genetic modification within or near at least one gene encoding one or more MHC-I and MHC-II human leukocyte antigens, or other components of the MHC-I or MHC-II complexes, or transcriptional regulators; (ii) introducing in the cells at least one genetic modification that increases expression of at least one polynucleotide encoding a tolerogenic factor; and (iii) introducing in the universal donor cells at least one genetic modification that increases or decreases expression of at least one gene encoding a survival factor.

[0299] In another method, Method 2, the present disclosure provides a method for producing universal donor cells, comprising: (i) introducing at least one deletion of at least one region of genomic DNA within or near at least one gene encoding one or more MHC-I and MHC-II human leukocyte antigens or other components of the MHC-I or MHC-II complex or transcriptional regulatory factors; and (ii) introducing at least one insertion of at least one polynucleotide encoding a tolerogenic factor at the following site that partially overlaps, completely overlaps, or is contained within the site of the deletion of (i).

[0300] In another approach, Method 3, the present disclosure provides a method of generating universal donor cells comprising introducing at least one genetic modification that increases or decreases expression of at least one gene encoding a survival factor.

[0301] In another method, method 4, the disclosure provides a method as provided in method 1, wherein the genetic modification of (i) is a deletion.

[0302] In another method, namely method 5, the present disclosure provides a method as provided in method 1, wherein the genetic modification of (ii) is the insertion of a polynucleotide encoding a tolerogenic factor at a safe harbor locus or at a site that partially overlaps, completely overlaps, or is contained within the genetic modification site of (i).

[0303] In another method, method 6, the disclosure provides a method as provided in method 1, wherein the genetic modification of (i) is a deletion of a gene encoding one or more MHC-I and MHC-II human leukocyte antigens, or other components of the MHC-I or MHC-II complexes, or transcriptional regulatory factors; and the genetic modification of (ii) is an insertion of a polynucleotide encoding at least one tolerogenic factor at a site that partially overlaps with, completely overlaps with, or is contained within the genetic modification site of (i).

[0304] In another method, method 7, the present disclosure provides a method as provided in any one of methods 1, 2, or 4 to 6, wherein the at least one gene encoding one or more MHC-I and MHC-II human leukocyte antigens or other components of the MHC-I or MHC-II complex or transcriptional regulatory factors is one or more of the following: MHC-I genes (e.g., HLA-A, HLA-B, and HLA-C), MHC-II genes (e.g., HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, and HLA-DR), or genes encoding transcriptional regulatory factors of MHC-I or MHC-II (e.g., B2M, NLRC5, and CIITA).

[0305] In another method, method 8, the disclosure provides a method as provided in any one of methods 1, 2, or 4 to 6, wherein the at least one gene encoding one or more MHC-I and MHC-II human leukocyte antigens or other components of the MHC-I or MHC-II complex or transcriptional regulatory factors is one or more of HLA-A, HLA-B, HLA-C, B2M or CIITA.

[0306] In another method, method 9, the disclosure provides a method as provided in method 1 or 2, wherein (i) is a deletion within or near one or more of HLA-A, HLA-B, HLA-C, B2M, or CIITA.

[0307] In another method, method 10, the disclosure provides a method as provided in method 9, wherein (i) is a deletion within or near HLA-A, a deletion within or near HLA-B, a deletion within or near HLA-C, and a deletion within or near B2M.

[0308] In another method, method 11, the disclosure provides a method as provided in method 9, wherein (i) is a deletion within or near HLA-A, a deletion within or near HLA-B, a deletion within or near HLA-C, and a deletion within or near CIITA.

[0309] In another method, method 12, the disclosure provides a method as provided in any one of methods 1, 2, or 4 to 11, wherein the at least one polynucleotide encoding a tolerogenic factor is one or more polynucleotides encoding one or more of HLA-E, HLA-G, CTLA-4, CD47, or PD-L1.

[0310] In another method, method 13, the present disclosure provides a method as provided in method 12, wherein (i) is a deletion within or near B2M, and (ii) is an insertion of a polynucleotide encoding PD-L1 at a site that partially overlaps with, completely overlaps with, or is contained within the deletion in (i).

[0311] In another method, method 14, the present disclosure provides a method as provided in method 12, wherein (i) is a deletion within or near HLA-A, a deletion within or near HLA-B, and a deletion within or near HLA-C, and (ii) is an insertion of a polynucleotide encoding HLA-G at a site that partially overlaps with, completely overlaps with, or is contained within the deletion in (i) (e.g., an HLA-A deletion).

[0312] In another method, method 15, the disclosure provides a method as provided in method 12, wherein (i) is a deletion within or near HLA-A, a deletion within or near HLA-B, a deletion within or near HLA-C, and a deletion within or near CIITA; and (ii) is an insertion of a polynucleotide encoding HLA-G at a site that partially overlaps with, completely overlaps with, or is contained within the deletion within or near HLA-A, and an insertion of a polynucleotide encoding CD47 at a site that partially overlaps with, completely overlaps with, or is contained within the deletion within or near CIITA.

[0313] In another method, method 16, the present disclosure provides a method as provided in any one of methods 1 or 3 to 15, wherein the at least one gene encoding a survival factor is one or more genes encoding one or more of ZNF143, TXNIP, FOXO1, JNK, or MANF.

[0314] In another method, method 17, the disclosure provides a method as provided in any one of methods 1 or 3 to 16, wherein the genetic modification to increase or decrease expression of a gene encoding a survival factor is insertion of a polynucleotide encoding MANF, e.g., at a safe harbor locus.

[0315] In another method, method 18, the disclosure provides a method as provided in any one of methods 1 or 3 to 16, wherein the genetic modification that increases or decreases expression of a gene encoding a survival factor is a deletion within or near the ZNF143, TXNIP, FOXO1 or JNK gene that reduces or eliminates expression of the ZNF143, TXNIP, FOXO1 or JNK gene relative to unmodified cells.

[0316] In another method, method 19, the present disclosure provides a method as provided in any one of methods 1 to 18, wherein the cells are stem cells (eg, human stem cells).

[0317] In another method, method 20, the present disclosure provides a method as provided in any one of methods 1 to 19, wherein the cells are embryonic stem cells (ESCs), adult stem cells (ASCs), induced pluripotent stem cells (iPSCs), or hematopoietic stem and progenitor cells (HSPCs).

[0318] In another method, method 21, the present disclosure provides a method as provided in any one of methods 1 to 18, wherein the cells are differentiated cells.

[0319] In another method, method 22, the present disclosure provides a method as provided in any one of methods 1 to 18 or 21, wherein the cells are somatic cells.

[0320] In another method, method 23, the present disclosure provides a method as provided in any one of methods 1 to 22, wherein the method further comprises introducing an exogenous polynucleotide into the cells, the exogenous polynucleotide does not become integrated into the genomic DNA of the cells.

[0321] In another method, method 24, the present disclosure provides a method as provided in method 23, wherein the exogenous polynucleotide encodes HLA-E, HLA-G, CTLA-4, CD47, MANF and / or PD-L1.

[0322] In another method, method 25, the present disclosure provides a method as provided in any one of methods 1 to 24, wherein the method further comprises increasing expression of one or more safety switches relative to an unmodified cell.

[0323] In another method, method 26, the present disclosure provides a method as provided in method 25, wherein the safety switch is herpes simplex virus-1 thymidine kinase (HSV-tk) or inducible caspase-9.

[0324] In another method, method 27, the present disclosure provides a method as provided in method 25 or 26, wherein increasing expression of one or more safety switches is caused by genetic insertion of a polynucleotide encoding the safety switch, e.g., into a safe harbor locus.

[0325] In another method, method 28, the present disclosure provides a method as provided in any of methods 5, 17 or 27, wherein the safe harbor locus is selected from the group consisting of: AAVS1 (PPP1 R12C), ALB, Angptl3, ApoC3, ASGR2, CCR5, FIX (F9), G6PC, Gys2, HGD, Lp (a), Pcsk9, Serpina1, TF and TTR.

[0326] In another method, method 29, the present disclosure provides a method as provided in any one of methods 1 to 28, wherein the method further comprises introducing an additional genetic modification that reduces expression of any additional gene.

[0327] In another method, method 30, the present disclosure provides a method as provided in any one of methods 1 to 29, wherein the genetic modification, deletion or insertion is produced by delivering an endonuclease and at least one guide RNA (gRNA) to the cells.

[0328] In another method, method 31, the disclosure provides a method as provided in method 30, wherein the endonuclease is Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3 , Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4 or Cpf1 endonuclease; homologs thereof, recombinants of naturally occurring molecules thereof, codon-optimized or modified versions thereof, and combinations thereof.

[0329] In another method, method 32, the disclosure provides a method as provided in method 31, wherein the endonuclease is Cas9, optionally Streptococcus pyogenes Cas9, or a variant thereof comprising an N-terminal SV40 NLS and a C-terminal SV40 NLS.

[0330] In another method, method 33, the present disclosure provides a method as provided in method 30, wherein the weight ratio of the one or more gRNAs to the endonuclease is 1:1.

[0331] In another method, method 34, the disclosure provides a method as provided in any one of methods 2, 5, 6, 12 to 15, 17, 23, 25, or 27, wherein the polynucleotide comprises an exogenous promoter.

[0332] In another method, method 35, the present disclosure provides a method as provided in method 34, wherein the exogenous promoter is CMV, EF1a, PGK, CAG, UBC or other constitutive promoter, inducible promoter, time-specific promoter, tissue-specific promoter or cell type-specific promoter.

[0333] In another method, method 36, the present disclosure provides a method as provided in method 35, wherein the exogenous promoter is a CAG promoter.

[0334] In another method, method 37, the disclosure provides a method comprising administering to a subject a cell composition as provided in any one of compositions 1 to 36, or a composition comprising a plurality of cells produced by any one of methods 1 to 36.

[0335] In another method, method 38, the present disclosure provides a method comprising (i) obtaining a cell composition as provided in any one of compositions 1 to 34; (ii) differentiating the cells into lineage-restricted cells or fully differentiated cells; and (iii) administering the lineage-restricted cells or fully differentiated cells to a subject in need thereof.

[0336] In another method, method 39, the disclosure provides a method as provided in method 37 or 38, wherein the subject is a human having, suspected of having, or at risk for a disease.

[0337] In another method, method 40, the present disclosure provides a method as provided in method 39, wherein the disease is a genetically heritable disease.

[0338] In another method, method 41, the disclosure provides methods as provided in method 39 or 40, wherein the cells further comprise a genetic modification that reduces expression of a gene or protein associated with the disease.

[0339] In another method, method 42, the present disclosure provides a method as provided in any one of methods 39 to 41, wherein the genetic modification is capable of treating the disease or a symptom of the disease.

[0340] In another method, method 43, the disclosure provides a method as provided in any one of methods 37 to 42, wherein the cells are obtained from a source different from the subject.

[0341] In another method, method 44, the present disclosure provides a method for producing a universal donor cell, comprising genetically modifying a cell by: (i) introducing a deletion and / or insertion of at least one base pair at a site within or near at least one gene in the genome of the cell, the at least one gene encoding one or more of an MHC-I or MHC-II human leukocyte antigen or a component of the MHC-I or MHC-II complex or a transcriptional regulatory factor; and (ii) introducing an insertion of at least one polynucleotide encoding a tolerogenic factor at a site in the genome of the cell that partially overlaps with, completely overlaps with, or is contained within the site of (i), thereby producing the universal donor cell.

[0342] In another method, method 45, the present disclosure provides a method for producing a universal donor cell, comprising genetically modifying a cell by: (i) introducing a deletion and / or insertion of at least one base pair at a site within or near at least one gene in the genome of the cell, the at least one gene encoding one or more of an MHC-I or MHC-II human leukocyte antigen or a component of the MHC-I or MHC-II complex or a transcriptional regulatory factor; and (ii) introducing an insertion of at least one polynucleotide encoding a tolerogenic factor into a safe harbor locus in the genome of the cell, thereby producing the universal donor cell.

[0343] In another method, method 46, the present disclosure provides a method as provided in method 44 or 45, wherein the universal donor cells have increased immune evasion and / or cell survival compared to unmodified cells.

[0344] In another method, method 47, the present disclosure provides a method as provided in any one of methods 44 to 46, wherein the at least one gene encoding one or more MHC-I or MHC-II human leukocyte antigens, or components of the MHC-I or MHC-II complex, or transcriptional regulatory factors is an MHC-I gene selected from HLA-A, HLA-B, or HLA-C, an MHC-II gene selected from HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, or HLA-DR, or a gene selected from B2M, NLRC5, CIITA, RFX5, RFXAP, or RFXANK.

[0345] In another method, method 48, the present disclosure provides a method as provided in any one of methods 44 to 47, wherein the at least one polynucleotide encoding a tolerogenic factor is one or more polynucleotides encoding one or more of PD-L1, HLA-E, HLA-G, CTLA-4, or CD47.

[0346] In another method, method 49, the present disclosure provides a method as provided in any one of methods 44 to 48, wherein the at least one polynucleotide encoding the tolerogenic factor is operably linked to an exogenous promoter.

[0347] In another method, method 50, the present disclosure provides a method as provided in method 49, wherein the exogenous promoter is a constitutive promoter, an inducible promoter, a time-specific promoter, a tissue-specific promoter or a cell type-specific promoter, and the constitutive promoter is CMV, EF1a, PGK, CAG or UBC promoter.

[0348] In another method, method 51, the present disclosure provides a method as provided in any one of methods 44 to 50, wherein the deletion and / or insertion of (i) is within or near B2M, and the insertion of (ii) is an insertion of a polynucleotide encoding PD-L1 or HLA-E.

[0349] In another method, method 52, the present disclosure provides a method as provided in any one of methods 44 to 51, wherein the method further comprises introducing at least one genetic modification that increases or decreases expression of at least one survival factor relative to unmodified cells.

[0350] In another method, method 53, the disclosure provides a method as provided in method 52, wherein the at least one genetic modification that increases or decreases expression of at least one survival factor is an insertion of a polynucleotide encoding MANF, which insertion increases expression of MANF relative to the unmodified cell; or a deletion and / or insertion of at least one base pair within or near a gene encoding ZNF143, TXNIP, FOXO1, or JNK, which deletion and / or insertion reduces or eliminates expression of ZNF143, TXNIP, FOXO1, or JNK relative to the unmodified cell.

[0351] In another method, method 54, the present disclosure provides a method as provided in method 53, wherein the polynucleotide encoding MANF is inserted into a safe harbor locus or into a gene belonging to MHC-I, MHC-II, or a transcriptional regulator of MHC-I or MHC-II.

[0352] In another method, method 55, the present disclosure provides a method as provided in any one of methods 44 to 54, wherein the genetic modification comprises delivering at least one RNA-guided endonuclease system to the cell.

[0353] In another method, method 56, the present disclosure provides a method as provided in method 55, wherein the at least one RNA-guided endonuclease system is a CRISPR system comprising a CRISPR nuclease and a guide RNA.

[0354] In another method, method 57, the present disclosure provides a method as provided in method 56, wherein the CRISPR nuclease is Cas9, Cpf1, a homolog thereof, a modified form thereof, a codon-optimized form thereof, or any combination thereof.

[0355] In another method, method 58, the disclosure provides a method as provided in method 56 or 57, wherein the CRISPR nuclease is Streptococcus pyogenes Cas9.

[0356] In another method, method 59, the present disclosure provides a method as provided in any one of methods 56 to 58, wherein the CRISPR nuclease comprises an N-terminal nuclear localization signal (NLS) and / or a C-terminal NLS.

[0357] In another method, method 60, the present disclosure provides a method as provided in any one of methods 56 to 59, wherein the CRISPR nuclease and the guide RNA are present in a 1:1 weight ratio.

[0358] In another method, method 61, the present disclosure provides a method as provided in any one of methods 44 or 46 to 60, wherein the deletion and / or insertion of (i) is within or near the B2M locus, and the insertion of (ii) is an insertion of a polynucleotide encoding PD-L1.

[0359] In another method, method 62, the present disclosure provides a method as provided in method 61, wherein the guide RNA used for (i) and (ii) comprises a nucleotide sequence comprising at least one of SEQ ID NOs: 1-3 or 35-44.

[0360] In another method, method 63, the disclosure provides a method as provided in method 61 or 62, wherein the polynucleotide encoding PD-L1 is flanked by (a) a nucleotide sequence having sequence homology to a region to the left of the site in (i) and (b) a nucleotide sequence having sequence homology to a region to the right of the site in (i).

[0361] In another method, method 64, the disclosure provides a method as provided in method 63, wherein the polynucleotide encoding PD-L1 is inserted into the B2M locus within 50 base pairs of the site in (i).

[0362] In another method, method 65, the disclosure provides a method as provided in method 63 or 64, wherein (a) consists essentially of the nucleotide sequence of SEQ ID NO: 13, and (b) consists essentially of the nucleotide sequence of SEQ ID NO: 19.

[0363] In another method, method 66, the disclosure provides a method as provided in any one of methods 61 to 65, wherein the polynucleotide encoding PD-L1 is operably linked to an exogenous promoter, optionally wherein the exogenous promoter is a CAG promoter.

[0364] In another method, method 67, the disclosure provides a method as provided in any one of methods 44 to 66, wherein the cell is a mammalian cell, optionally wherein the cell is a human cell.

[0365] In another method, method 68, the present disclosure provides a method as provided in any one of methods 44 to 67, wherein the cell is a stem cell.

[0366] In another method, method 69, the present disclosure provides a method as provided in any one of methods 44 to 68, wherein the cell is a pluripotent stem cell (PSC), an embryonic stem cell (ESC), an adult stem cell (ASC), an induced pluripotent stem cell (iPSC), or a hematopoietic stem and progenitor cell (HSPC).

[0367] In another method, method 70, the present disclosure provides a method as provided in any one of methods 44 to 69, wherein the cell is a differentiated cell or a somatic cell.

[0368] In another method, method 71, the present disclosure provides a method as provided in any one of methods 44 to 69, wherein the universal donor cell is capable of differentiating into a lineage-restricted progenitor cell or a fully differentiated somatic cell.

[0369] In another method, method 72, the present disclosure provides a method as provided in method 71, wherein the lineage-restricted progenitor cells are pancreatic endoderm progenitor cells, pancreatic endocrine progenitor cells, mesenchymal progenitor cells, muscle progenitor cells, blast cells, or neural progenitor cells.

[0370] In another method, method 73, the present disclosure provides a method as provided in method 71, wherein the fully differentiated somatic cells are endocrine cells such as pancreatic beta cells, epithelial cells, endoderm cells, macrophages, hepatocytes, adipocytes, kidney cells, blood cells or immune system cells.

[0371] In another composition, composition 37, the present disclosure provides a composition comprising a plurality of universal donor cells produced by a method as provided in any one of methods 44 to 73.

[0372] In another composition, composition 38, the present disclosure provides a composition as provided in composition 37, wherein the plurality of universal donor cells can be maintained for a time and under conditions sufficient to allow the cells to undergo differentiation.

[0373] In another composition, composition 39, the present disclosure provides a composition comprising cells comprising (i) at least one deletion within or near at least one gene encoding one or more MHC-I and MHC-II human leukocyte antigens, or components of the MHC-I or MHC-II complex, or transcriptional regulatory factors; and (ii) at least one insertion of a polynucleotide encoding at least one tolerogenic factor at a site that partially overlaps with, completely overlaps with, or is contained within the genetic deletion site of (i).

[0374] In another method, method 74, the present disclosure provides a method comprising administering a plurality of universal donor cells as described in composition 37 or 38 to a subject.

[0375] In another method, method 75, the present disclosure provides a method for treating a subject in need thereof, comprising (i) obtaining or having obtained a plurality of universal donor cells as described in composition 37 or 38 after differentiation into lineage-restricted progenitor cells or fully differentiated somatic cells; and (ii) administering these lineage-restricted progenitor cells or fully differentiated somatic cells to the subject.

[0376] In another method, method 76, the present disclosure provides a method of obtaining cells for administration to a subject in need thereof, comprising (i) obtaining or having obtained universal donor cells as described in composition 37 or 38; and (ii) maintaining the universal donor cells for a time and under conditions sufficient to allow the cells to differentiate into lineage-restricted progenitor cells or fully differentiated somatic cells.

[0377] In another method, method 77, the disclosure provides a method as provided in method 75 or 76, wherein the lineage-restricted progenitor cells are pancreatic endoderm progenitor cells, pancreatic endocrine progenitor cells, mesenchymal progenitor cells, muscle progenitor cells, blast cells, or neural progenitor cells.

[0378] In another method, method 78, the disclosure provides a method as provided in method 75 or 76, wherein the fully differentiated somatic cells are endocrine cells such as pancreatic beta cells, epithelial cells, endoderm cells, macrophages, hepatocytes, adipocytes, kidney cells, blood cells or immune system cells.

[0379] In another method, method 79, the present disclosure provides a method as provided in any one of methods 74 to 78, wherein the subject is a human having, suspected of having, or at risk for a disease.

[0380] In another method, method 80, the present disclosure provides a method as provided in method 79, wherein the disease is a genetically heritable disease.

[0381] In another method, method 81, the present disclosure provides a method for generating universal donor cells, the method comprising delivering to a pluripotent stem cell (PSC) (a) an RNA-guided nuclease; (b) a guide RNA (gRNA) that targets a target site in a beta-2-microglobulin (B2M) locus; and (c) a vector comprising a nucleic acid comprising (i) a nucleotide sequence homologous to a region located to the left of the target site in the B2M locus, (ii) a nucleotide sequence encoding a tolerogenic factor, and (iii) a nucleotide sequence homologous to a region located to the right of the target site in the B2M locus, wherein the B2M locus is cleaved at the target site and the nucleic acid is inserted into the B2M locus within 50 base pairs of the target site, thereby generating universal donor cells, wherein the universal donor cells have increased immune evasion and / or cell survival compared to a PSC that does not comprise the nucleic acid inserted into the B2M locus.

[0382] In another method, method 82, the present disclosure provides a method as provided in method 81, wherein the gRNA comprises a nucleotide sequence selected from SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.

[0383] In another method, method 83, the disclosure provides a method as provided in method 81 or 82, wherein (i) consists essentially of the nucleotide sequence of SEQ ID NO: 13, and (iii) consists essentially of the nucleotide sequence of SEQ ID NO: 19.

[0384] In another method, method 84, the present disclosure provides a method as provided in any one of methods 81 to 83, wherein the tolerogenic factor is programmed death ligand 1 (PD-L1) or human leukocyte antigen E (HLA-E).

[0385] In another method, method 85, the disclosure provides a method as provided in any one of methods 81 to 84, wherein the nucleotide sequence encoding the tolerogenic factor is operably linked to an exogenous promoter.

[0386] In another method, method 86, the disclosure provides a method as provided in method 85, wherein the exogenous promoter is constitutive, cell type specific, tissue type specific, or temporally regulated.

[0387] In another method, method 87, the disclosure provides a method as provided in method 85 or 86, wherein the exogenous promoter is a CAG promoter.

[0388] In another method, method 88, the present disclosure provides a method as provided in any one of methods 81 to 87, wherein the vector is a plasmid vector.

[0389] In another method, method 89, the present disclosure provides a method as provided in method 88, wherein the plasmid vector comprises the nucleotide sequence of SEQ ID NO: 33 or SEQ ID NO: 34.

[0390] In another method, method 90, the present disclosure provides a method as provided in any one of methods 81 to 89, wherein the RNA-guided nuclease is a Cas9 nuclease.

[0391] In another method, method 91, the present disclosure provides a method as provided in method 90, wherein the Cas9 nuclease is linked to at least one nuclear localization signal (NLS).

[0392] In another method, method 92, the present disclosure provides a method as provided in method 90 or 91, wherein the Cas9 nuclease is Streptococcus pyogenes Cas9.

[0393] In another method, method 93, the present disclosure provides a method as provided in any one of methods 81 to 92, wherein the PSC is an embryonic stem cell (ESC), an adult stem cell (ASC), an induced pluripotent stem cell (iPSC), or a hematopoietic stem and progenitor cell (HSPC).

[0394] In another method, method 94, the present disclosure provides a method as provided in any one of methods 81 to 93, wherein the PSC is a human PSC.

[0395] In another method, method 95, the present disclosure provides a method for generating universal donor cells, the method comprising delivering to a pluripotent stem cell (PSC) (a) an RNA-guided nuclease; (b) a guide RNA (gRNA) that targets a target site in a beta-2-microglobulin (B2M) locus, wherein the gRNA comprises a nucleotide sequence of SEQ ID NO: 2; and (c) a vector comprising a nucleic acid comprising (i) a nucleotide sequence homologous to a region located to the left of the target site in the B2M locus, the nucleotide sequence consisting essentially of SEQ ID NO: 13, (ii) a nucleotide sequence encoding a tolerogenic factor, and (iii) a nucleotide sequence homologous to a region located to the right of the target site in the B2M locus, the nucleotide sequence consisting essentially of SEQ ID NO: NO:19, wherein the B2M locus is cleaved at the target site and the nucleic acid is inserted into the B2M locus within 50 base pairs of the target site, thereby generating the universal donor cell, wherein the universal donor cell has increased immune evasion and / or cell survival compared to a PSC that does not contain the nucleic acid inserted into the B2M locus.

[0396] In another method, method 96, the disclosure provides a method as provided in method 95, wherein the tolerogenic factor is programmed death ligand 1 (PD-L1) or human leukocyte antigen E (HLA-E).

[0397] In another method, method 97, the disclosure provides a method as provided in method 95 or 96, wherein the nucleotide sequence encoding the tolerogenic factor is operably linked to an exogenous promoter.

[0398] In another method, method 98, the disclosure provides a method as provided in method 97, wherein the exogenous promoter is constitutive, cell type specific, tissue type specific, or temporally regulated.

[0399] In another method, method 99, the disclosure provides a method as provided in method 97 or 98, wherein the exogenous promoter is a CAG promoter.

[0400] In another method, method 100, the present disclosure provides a method as provided in any one of methods 95 to 99, wherein the vector is a plasmid vector.

[0401] In another method, method 101 , the present disclosure provides a method as provided in method 100 , wherein the plasmid vector comprises the nucleotide sequence of SEQ ID NO: 33 or SEQ ID NO: 34.

[0402] In another method, method 102, the present disclosure provides a method as provided in any one of methods 95 to 101, wherein the RNA-guided nuclease is a Cas9 nuclease.

[0403] In another method, method 103, the present disclosure provides a method as provided in method 102, wherein the Cas9 nuclease is linked to at least one nuclear localization signal (NLS).

[0404] In another method, method 104, the present disclosure provides a method as provided in method 102 or 103, wherein the Cas9 nuclease is Streptococcus pyogenes Cas9.

[0405] In another method, method 105, the present disclosure provides a method as provided in any one of methods 95 to 104, wherein the PSC is an embryonic stem cell (ESC), an adult stem cell (ASC), an induced pluripotent stem cell (iPSC), or a hematopoietic stem and progenitor cell (HSPC).

[0406] In another method, method 106, the present disclosure provides a method as provided in any one of methods 95 to 105, wherein the PSC is a human PSC.

[0407] VII. Examples

[0408] The following examples describe the generation and characterization of universal donor cells according to the present disclosure. Table 1 lists tolerogenic factors that can be genetically modified in the cells, and Table 2 lists survival factors that can be genetically modified in the cells. Figures 1A-1C Describes various gene editing strategies that can be used for immune evasion.

[0409] Table 1. Tolerogenic factors that can be genetically modified

[0410] factor Knockout (KO) Knock-in (KI) HLA-E + HLA-G + CTLA-4 + CD47 + PD-L1 + B2M - HLA-ABC - CIITA -

[0411] Table 2. Survival factors that can be genetically modified

[0412] factor Knockout (KO) Knock-in (KI) ZNF143 - TXNIP - FOXO - JNK - MANF +

[0413] Example 1: Generation of B2M knockout IPSCs

[0414] Guide RNA (gRNA) selection for B2M. In order to identify a wide range of gRNAs capable of editing the B2M DNA target region, in vitro transcription (IVT) gRNA screening was performed. The gRNA targeting B2M was designed to target exon 1 of the B2M gene. The B2M genomic sequence was submitted for analysis using gRNA design software. Based on the uniqueness of the sequence (only gRNAs without perfect matches elsewhere in the genome were screened) and minimal expected off-targets, the resulting gRNA list was narrowed to a list of approximately 200 gRNAs. This group of gRNAs was transcribed in vitro and transfected into HEK293T cells constitutively expressing Cas9 using MessengerMax. Cells were harvested 48 hours after transfection, genomic DNA was isolated, and TIDE analysis was used to evaluate cutting efficiency. Guide RNAs with high insertion / deletion and low predicted off-target effects were selected for further analysis. Table 3 presents the target sequences of the selected B2M gRNAs.

[0415] Table 3. Selected B2M gRNA target sequences

[0416]

[0417]

[0418] Screening of B2M gRNA in iPSCs. Three gRNAs (B2M-1, B2M-2, and B2M-3) were used to edit iPSCs. The location of the target sequence of each of these gRNAs is shown in Figure 2. Figure 2 As shown. IPSC (TC-1133 cell line, RUDCR, New Jersey) cells were nuclear transfected with a mixture of RNPs (final concentration of 125 pmol Cas9 and 375 pmol gRNA) with a molar ratio of 3:1 (gRNA:Cas9) of Cas9 (Aldevron, catalog number 9212-5MG) and gRNA (Synthego) using the Lonza 4D nuclear transfection and P3 primary cell kit (Lonza, catalog number V4XP-3024). Cells were dissociated using Accutase (Stempro, catalog number A1110501) and then resuspended in DMEM / F12 medium (Gibco, catalog number 11320033), counted using a Cellometer (Nexcellon) and centrifuged. Cells were counted at 2 x 10 3 Resuspend in P3 buffer with supplement 1 (4.5:1 ratio) at a concentration of 10 cells / μL. 5The cells were combined with the RNP complex, transferred to a nuclear transfection cuvette (Lonza Group kit) and nuclear transfection was performed using program CA-137. For each cuvette, 250 μL of StemFlex culture medium (Gibco, catalog number A3349401) with CloneR (Stem Cell Technologies, catalog number 05888) (1: 10 ratio) was used to resuspend the nuclear transfected cells. The cell suspension was divided into two wells of a 24-well plate coated with vitronectin (Gibco, catalog number A14700), which had an additional 250 μL of StemFlex with CloneR. The cells were recovered in a hypoxic incubator (37°C, 4% O2, 8% CO2) for 48 hours. After 48 hours, genomic DNA was harvested from one well of each technical replicate using a gDNA isolation kit (Qiagen, catalog number 69506).

[0419] The isolated gDNA was subjected to PCR to determine the indel frequency. PCR of the relevant regions was performed using Platinum Taq Supermix (Invitrogen, catalog number 125320176 and catalog number 11495017) with B2M primers. The primer sequences are provided in Table 4, and the positions of the B2M primers relative to the gRNA target site are as shown in Table 4. Figure 2 The cycling conditions are provided in Table 5.

[0420] Table 4. B2M TIDE primers

[0421] name type Sequence (5'-3') SEQ ID NO: B2MF2 Forward CAGACAGCAAACTCACCCAG 4 B2MR2 Reverse AAACTTTGTCCCGACCCTCC 5

[0422] Table 5. B2M PCR cycling parameters

[0423]

[0424] The resulting amplicons were submitted for PCR cleanup and Sanger sequencing. The Sanger sequencing results were input into Tsunami along with the guide sequence. The indel percentage and identity were calculated by the software ( Figure 3A The indel frequencies of B2M-1, B2M-2, and B2M-3 gRNAs were 2.5%±1.1%, 87.6%±14.1%, and 63.9%±0.9%, respectively (n=2). Figure 3B and 3C Presented a B2M-2 ( Figure 3B ) and B2M-3gRNA( Figure 3C ) distribution of insertion / deletion results.

[0425] Cells in duplicate wells were maintained until confluent and then serially passaged into larger vessels.Mixed populations were switched to Advanced 20 / 10 / 10 medium (see Table 6) and laminin-521 (Stem Cell Technologies, Cat. No. 77004) for maintenance.

[0426] Table 6. Advanced 20 / 10 / 10 Medium Formulation

[0427]

[0428] Generation and characterization of B2M KO IPS clones. Figure 4A ) were single-cell sorted into vitronectin-coated 96-well plates using FACS-ARIA (BD Bioscience) and recovered in StemFlex with CloneR. Briefly, cells were dissociated from maintenance flasks using Accutase and resuspended in StemFlex with CloneR. Cells were then counted using a Cellometer and diluted to 1 x 10 5 2mL of this dilution was filtered into a FACS tube by a cell strainer (Falcon, #352235), provided to the operator, and single cells were sorted into separate wells. The single cells plated were grown in a hypoxic incubator (37°C, 8% CO2, 4% O2), and the culture medium was changed every other day until the colony was large enough to be re-inoculated as a single cell. When converging, the sample was separated for maintenance and gDNA extraction (see above). Clone identity was confirmed via PCR and Sanger sequencing (for details, see below). Table 7 presents the sequences around the cleavage site of the selected clones (the sequences of deletion and / or insertion are shown in bold).

[0429] Table 7. Sequence analysis of B2M KO clones

[0430]

[0431] The cloned sequences were aligned in Snapgene software to determine the identity of the indels and homozygosity or heterozygosity. Figure 4B As shown, 8 clones were homozygous for B2M KO and 7 clones were heterozygous for B2M KO. Homozygous clones with the desired edits were expanded and further verified by sequencing and flow cytometry. Clones were initially maintained in StemFlex medium on vitronectin-coated plates and then eventually switched to Advanced 20 / 10 / 10 medium and laminin-521-coated containers.

[0432] The cells were further maintained in laminin-521 coated flasks with Advanced 20 / 10 / 10. The indel identity of the edited clones was verified by PCR and Sanger sequencing of the B2M region. Knockout was verified by flow cytometry for B2M and HLA-A (see Tables 8 and 9 for a list of antibodies utilized) and Taqman qPCR analysis of B2M expression using a standard Taqman protocol (Taqman FastAdvanced Mastermix, ThermoFisher, catalog number 4444556). The B2M expression levels of the three B2M KO clones and wild-type (unmodified) cells were shown in Figure 5. Figure 5 All three KO clones tested showed reduced mRNA expression of B2M relative to wild-type cells.

[0433] Table 8. Antibodies used for pluripotency flow cytometry

[0434]

[0435] Table 9. Antibodies against B2M and HLA-ABC

[0436]

[0437] RNA extraction was performed using a Qiagen RNeasy kit (Qiagen, catalog number 74104 and 79254) with RNase-free DNase according to the manufacturer's instructions. cDNA synthesis was performed using the Advanced iScript cDNA Synthesis Kit for RT-qPCR (BioRad, catalog number 1725037) according to the manufacturer's instructions. The karyotype status of clones was evaluated by Karyostat service (Thermo Fisher Scientific) and by tracking of known karyotype abnormalities BCL2L1 using ddPCR using the manufacturer's instructions and a ddPCR supermix (without dUTP) for the probe (BioRad, catalog number 1863024; primers in Table 10), using an annealing temperature of 59°C and RPP30 as a reference assay.

[0438] Table 10. ddPCR primer probe sets

[0439]

[0440] The resulting amplicons were gel checked on a precast 2% agarose gel (Thermo Fisher Scientific, catalog number G501802) and submitted for PCR cleanup and Sanger sequencing. The resulting sequencing files were input into Tsunami software along with the gRNA sequence and control sequence files to determine indel identity and percentage.

[0441] These clones were also confirmed by flow cytometry to be negative for the expression of B2M and MHC class I antigens (HLA-A, B, C) with or without interferon-γ treatment (25 ng / mL, R&D Systems, 285-IF). Figures 6A-6D .

[0442] Retention of pluripotency in clones was confirmed by flow cytometry targeting pluripotency cell surface markers ( Figures 7A-7D Additional confirmation of pluripotency included Taqman Scorecard (Thermo Fisher Scientific, Cat. No. A15872), ThermoPluritest service, and Trilineage differentiation (see below for full protocol).

[0443] Cells were dissociated and counted as above, then centrifuged and resuspended in Advanced 20 / 10 / 10 medium with 2 μM Y-27632 (Tocris, cat. no. 1245) to a maximum of 1 x 10 6 The resuspended cells were then filtered through a 40 μM filter (Fisherbrand, catalog number 22363547) and 5 mL of the suspension was plated in a single well of an ultra-low attachment 6-well culture dish (Corning, catalog number 3471). The cells were then placed on an orbital shaker at 98 RPM overnight to allow aggregates to form. After 16 hours, the spent medium was removed from each well by carefully rotating the plate to collect aggregates. 4 mL of fresh Advanced 20 / 10 / 10 was added.

[0444] After another 24 hours, the cells were allowed to differentiate. Aggregates were first collected into 50 mL conical tubes and centrifuged at 1000 RPM for 1 min to precipitate the aggregates. The culture medium was aspirated and the aggregates were washed with DMEM / F12. Aggregates were again collected by centrifugation and resuspended in 4 mL of the corresponding differentiation medium before being returned to the culture dish and shaker. The following basal medium was used for all differentiations: 480 mL IMDM + Glutamax (Gibco, catalog number 31980030), 480 mL F12 + Glutamax (Gibco, catalog number 31765035), 10 mL non-essential amino acids (Gibco, catalog number 11140076), 5 mL 20% BSA (Sigma, catalog number A7638-5G), 2 mL chemically defined lipids (Gibco, catalog number 11905031), 1 mL 200 mM ascorbic acid (Sigma, catalog number A4403-100MG), 1 mL 10 mg / mL iron-saturated transferrin (Sigma, catalog number T0665), and 100 μL 140 μg / ml sodium selenite (Sigma, catalog number S5261). To differentiate the cells into ectoderm cells, a final concentration of 4 mg / mL insulin (Gibco, catalog number 12585014), 2 μM A83-01, 2 μM Dorsomorphin (Paptech, catalog number 8666430) and 2 μM PNU-74654 were used for two days. To differentiate the cells into mesoderm cells, a final concentration of 1 μg / mL insulin, 0.1 μM PIK-90, 3 μM CHIR99021 (Paptech, catalog number 2520691) and 0.5 μM LDN193189 (Paptech, catalog number 1062443) were used for two days. For the first day of endoderm differentiation, a final concentration of 0.2 μg / mL insulin, 0.1 μM PIK-90, 100 ng / mL activin-A (Peptech, catalog number 120-00), 2 μM CHIR99021, and 20 ng / mL basic FGF (Peptech, catalog number 101-18b) was used. Endoderm differentiation was performed for another two days using the following substances: 0.2 μg / mL insulin, 0.1 μM PIK-90, 100 ng / mL activin-A, and 0.25 μM LDN193189. For all differentiations, the culture medium was changed every day. All were collected on day 3 for RNA analysis using Taqman Scorecard.

[0445] Example 2: Cell maintenance and expansion.

[0446] Maintenance of hESC / hiPSC. Human embryonic stem cell (hESC) line CyT49 cells were maintained, cultured, passaged, proliferated, and plated as described in Schulz et al. (2012) PLoS ONE 7(5):e37004. CyT49 cells were used (Stem Cell Technologies, Inc. 07920 or equivalent) dissociation.

[0447] Human induced pluripotent stem cells (hiPSCs) such as the TC1133 cell line (Lonza Group) were maintained in StemFlex Complete (Life Technologies, A3349401) on tissue culture plates coated with BIOLAMININ 521CTG (BioLamina, catalog number CT521). Plates were pre-coated for 2 hours at 37°C with a 1:10 or 1:20 dilution of BIOLAMININ in DPBS, calcium, and magnesium (Life Technologies, 14040133). The cells were fed daily with StemFlex medium. To passage the cells, cells were plated at the same density as CyT49. To plate the cells as single cells, the cells were plated with 1% RevitaCell in StemFlex. TM Supplement (100X) (Thermo Fisher Scientific, catalog number A2644501) was plated on BIOLAMININ-coated plates.

[0448] Single cell cloning of hPSCs. Feed hPSCs (hESCs or hiPSCs) with StemFlex Complete with Revitacell (final concentration 1X Revitacell) 3-4 hours before dissociation. After dissociation, sort the cells into single cells in each well of a 96-well tissue culture plate coated with BIOLAMININ. Use a WOLF FACS sorter (Nanocellect) to sort the single cells into the wells. Pre-fill the plate with 100-200 μL of StemFlex Complete with Revitacell. Three days after cell seeding, feed the cells with fresh StemFlex and continue to feed the cells with 100-200 μL of culture medium every other day. After 10 days of growth, feed the cells with StemFlex every day until day 12-14. At this time, fill the plate with Dissociate and split the collected cell suspension 1:2, half into a new 96-well plate for maintenance and half into DNA extraction solution QuickExtract TMDNA was extracted in a DNA extraction solution (Lucigen). After DNA extraction, PCR was performed to assess the presence or absence of the desired gene editing at the targeted DNA locus. Sanger sequencing was used to verify the desired editing.

[0449] Expansion of single-cell-derived hPSC clones. For CyT49, successfully targeted clones were passaged onto 24-well plates containing pure 10% XF KSR A10H10 medium, rather than onto BIOLAMININ-coated plates. After the 24-well stage, CyT49 clones were passaged as described in Schulz et al. (2012) PLoS ONE 7(5):e37004.

[0450] For hiPSCs (TC1133), cells were maintained in StemFlex Complete throughout cloning and periodically maintained on BIOLAMININ coated plates with Revitacell during the passaging stage.

[0451] Example 3: Generation of B2M knockout human pluripotent stem cells (hPSCs)

[0452] Selection of guide RNA (gRNA) for B2M in hPSC. The three gRNAs targeting B2M described above in Example 1 were used to target the B2M gene in hPSC. To evaluate their cutting efficiency in hPSC, CyT49 cells were electroporated with a mixture of ribonucleoproteins (RNPs) (absolute values ​​of 125 pmol Cas9 and 375 pmol gRNA) with a molar ratio of 3:1 (gRNA:Cas9) of Cas9 protein (Biomay) and guide RNA (Synthego) using a Neon electroporator (Neon Transfection Kit, Thermo Fisher Scientific, catalog number MPK5000). In order to form an RNP complex, gRNA and Cas9 were combined with R-buffer (Neon Transfection Kit) in a container to a total volume of 25 μL and incubated at room temperature for 15 min. Use The cells were dissociated and then resuspended in DMEM / F12 medium (Gibco, catalog number 11320033), counted using NC-200 (Chemometec) and centrifuged. A total of 1 x 10 6Cells were added and R-buffer was added to a total volume of 125 μL. The mixture was then electroporated for 30 ms at 1100 V with 2 pulses. After electroporation, the cells were pipetted out into an Eppendorf tube filled with the StemFlex culture medium with RevitaCell. The cell suspension was then plated onto a tissue culture dish pre-coated with BIOLAMININ 521CTG at a 1:20 dilution. The cells were cultured in a normoxic incubator (37° C., 8% CO 2 ) for 48 hours. After 48 hours, genomic DNA was harvested from the cells using QuickExtract (Lucigen, Middleton, Wisconsin; Catalog Number (Cat. No.) QE09050).

[0453] PCR for the target B2M sequence was performed, and the cutting efficiency of the amplified resulting DNA was evaluated by TIDE analysis. PCR of the relevant region was performed using Platinum Taq Supermix (Invitrogen, catalog number 125320176 and catalog number 11495017). The sequences of the PCR primers are presented in Table 4; and the cycling conditions are provided in Table 5. The resulting amplicon was submitted for PCR cleanup and Sanger sequencing. The Sanger sequencing results were input into Tsunami software together with the guide sequence. The insertion and deletion percentages and identities were calculated by the software. Specific gRNAs were then selected based on their insertion and deletion frequencies in hPSCs. Figure 8 The cleavage efficiency of three B2M gRNAs is shown.

[0454] Off-target effects of the selected gRNAs were assessed in stem cell-derived DNA using hybridization capture analysis of sequence similarity predicted sites. The B2M-2 and B2M-3 guides showed no detectable off-target effects. The B2M-2 gRNA was selected for further clonal generation due to its high on-target activity and undetectable off-target activity.

[0455] B2M KO hPSC clones were generated and characterized. Using B2M-2gRNA, CyT49hESC was electroporated and single cells were sorted into 96-well plates coated with BIOLAMININ 521CTG using a WOLF FACS sorter (Nanocell) 3 days after electroporation. The plated single cells were grown in a normoxic incubator (37 ° C, 8% CO 2 ), and the culture medium was replaced every other day until the colonies were large enough to be re-seeded as single cells. When confluent, the samples were separated for maintenance and genomic DNA extraction.

[0456] The B2M KO status of the clones was confirmed via PCR and Sanger sequencing. The resulting DNA sequences in the target B2M region were aligned in Snapgene software to determine the indel identity and homozygosity or heterozygosity. The clones with the desired editing were amplified and further verified by flow cytometry evaluation for B2M expression (for a list of antibodies utilized, see Table 11). The clones were evaluated with or without interferon-γ treatment (25 ng / mL, R&D Systems, 285-IF). Figure 9A B2M expression in wild-type cells is shown, and Figure 9B B2M expression in KO cells is presented. The karyotypic status of clones was evaluated by CellLine Genetics Services (Madison, WI) and normal karyotypes were reported.

[0457] Table 11. Antibodies used for pluripotency flow cytometry

[0458]

[0459]

[0460] Retention of pluripotency was confirmed by intracellular flow cytometry for the pluripotency markers OCT4 and SOX2. Confirmed pluripotent clones were differentiated into pancreatic endocrine progenitor cells using previously established methods (Schulz et al. (2012) PLoS ONE 7(5):e37004).

[0461] Example 4: Generation of B2M knockout PD-L1 knock-in human pluripotent stem cells (hPSCs)

[0462] Design of a B2M-KO PD-L1-KI strategy. Plasmid design for insertion of PD-L1 (CD274) into the B2M locus was performed such that the start codon of B2M was removed after undergoing homology-directed repair (HDR) to insert PD-L1, thereby negating any chance of partial B2M expression. Figure 10 A schematic diagram of the plasmid is presented, and the elements and their positions are identified in Table 12. The donor plasmid contains a CAGGS promoter-driven PD-L1 cDNA flanked by 800 base pair homology arms that share sequence identity with the B2M locus surrounding exon 1. The complete sequence of the plasmid is presented as SEQ ID NO: 33.

[0463] Table 12. Elements of the B2M-CAGGS-PD-L1 donor plasmid

[0464] element Position (size in bp) SEQ ID NO: Left ITR 1-130(130) 12 LHA-B2M 145-944(800) 13 CMV enhancer 973-1352(380) 14 Chicken β-actin promoter 1355-1630(276) 15 chimeric intron 1631-2639(1009) 16 PD-L1 2684-3556(873) 17 bGH poly(A) signal 3574-3798(225) 18 RHA-B2M 3805-4604(800) 19 Right ITR 4646-4786(141) 20

[0465] B2M-2gRNA is used to promote the insertion of the PD-L1 transgene at the targeted B2M locus. The PD-L1 donor plasmid and the RNP complex consisting of gRNA targeting B2M and Cas9 protein are introduced together. For every 1 million CyT49 cells, 4 μg of plasmid DNA is delivered together with RNP. Electroporation is performed as described in Example 3. Seven days after electroporation, cells are sorted for PD-L1 surface expression using a WOLF FACS sorter (Nanocellex) into 96-well plates coated with BIOLAMININ 521CTG of StemFlex and Revitacell. For FACS sorting, unedited cells serve as negative controls. PD-L1 positive cells are selected for sorting and single-cell cloning.

[0466] To detect PD-L1 surface expression, an anti-PD-L1 fluorescent antibody was used (see Table 11). The plated single cells were grown in a normoxic incubator (37°C, 8% CO2), with the culture medium replaced every other day until the colonies were large enough to be re-plated as single cells. Upon confluence, the samples were split for maintenance and genomic DNA extraction.

[0467] Correctly targeted clones were identified via PCR for PD-L1 knock-in (KI) insertion using the following primers, which amplify the region from the outside of the plasmid homology arms to the PD-L1 cDNA insertion, enabling amplification of only KI-integrated DNA. The zygosity of the target insertion was tested by PCR to assess whether the KI occurred in a heterozygous or homozygous manner. If a heterozygous clone was identified, the KI-negative allele was sent for Sanger sequencing to verify that it contained an indel that destroyed B2M. Correct KI clones with complete B2M destruction (via KI insertion or indel formation) were amplified in increasing tissue culture formats until a population size of 30 million cells was reached. Approximately 10 clones were amplified in this way and confirmed to be pluripotent by testing for OCT4 and SOX2 by intracellular flow cytometry ( Figure 11 ). The clones that passed the above test were then further tested for karyotyping (Cell Line Genetics), as described below. Additionally, the clones were then tested for their ability to differentiate into pancreatic endoderm precursors (PECs) via an established protocol (Schulz et al. (2012) PLoS ONE [Public Library of Science Comprehensive] 7(5): e37004), as described below. The loss of B2M was further confirmed by the absence of B2M expression with or without interferon-γ treatment (25 ng / mL, R&D Systems, 285-IF) by flow cytometry. Figure 12A and 12BPD-L1 expression in wild-type and B2M KO / PD-L1 KI cells is shown, respectively.

[0468] Example 5: Generation of B2M Knockout and HLA-E Knockin Human Pluripotent Stem Cells (hPSCs)

[0469] Design of the B2M-KO HLA-E-KI strategy. Plasmid design for insertion of the HLA-E trimer into the B2M locus was performed such that the start codon of B2M was removed after undergoing homology-directed repair (HDR) to insert the HLA-E trimer, thereby negating any chance of partial B2M expression. Figure 13 A schematic diagram of the plasmid is presented, and Table 13 identifies the elements and their positions. The HLA-E trimer cDNA consists of a B2M signal peptide fused to an HLA-G presenting peptide, which is fused to a B2M membrane protein, which is fused to an HLA-E protein without its signal peptide. The trimer design has been previously published (Gornalusse et al. (2017) Nat. Biotechnol. [Natural Biotechnology] 35 (8): 765-772). The donor plasmid for HLA-E delivery contains a CAGGS promoter that drives HLA-E trimer expression, flanked by 800 base pairs of homology arms that have the same sequence as the B2M locus around exon 1. The complete sequence of the plasmid is presented as SEQ ID NO: 34.

[0470] Table 13. Elements of the B2M-CAGGS-HLA-E donor plasmid

[0471] element Position (size in bp) SEQ ID NO: Left ITR 1-130(130) 12 LHA-B2M 145-944(800) 13 CMV enhancer 973-1352(380) 14 Chicken β-actin promoter 1355-1630(276) 15 chimeric intron 1631-2639(1009) 16 B2M signal sequence 2684-2743(60) 21 HLA-G peptide 2744-2770(27) 22 GS connector 2771-2815(45) 23 B2M membrane protein 2816-3112(297) 24 GS connector 3113-3172(60) 25 HLA-E 3173-4183(1011) 26 bGH poly(A) signal 4204-4428(225) 18 RHA-B2M 4435-5234(800) 19 Right ITR 5276-5416(141) 20

[0472] B2M-2gRNA is used to promote the insertion of HLA-E transgene at the targeted B2M locus. HLA-E donor plasmid and the RNP complex consisting of gRNA and Cas9 protein targeting B2M are introduced together. For every 1 million CyT49 cells, 4 μg of plasmid DNA is delivered together with RNP. Electroporation is performed as described in Example 3. Seven days after electroporation, cells are sorted for HLA-E surface expression using a WOLF FACS sorter (Nanocellex) into 96-well plates coated with BIOLAMININ 521CTG of StemFlex and Revitacell. In order to perform FACS sorting, unedited cells serve as negative controls. HLA-E positive cells are selected for sorting and single-cell cloning.

[0473] To detect HLA-E surface expression, anti-HLA-E fluorescent antibodies were used (Table 11). Plated single cells were grown in a normoxic incubator (37°C, 8% CO2), with medium replacement every other day until colonies were large enough to be re-plated as single cells. Upon confluence, samples were split for maintenance and genomic DNA extraction.

[0474] The clones of correct targeting were identified by PCR identification of insertions for HLA-E knock-in (KI) using the following primers, which amplify the region inserted from the outside of the plasmid homology arms to the HLA-E cDNA, thereby enabling only the DNA integrated by KI to be amplified. The zygosity of the target insertion was tested by PCR to assess whether KI occurs in a heterozygous or homozygous manner. If a heterozygous clone is identified, the KI negative allele is sent for Sanger sequencing to verify that it contains an indel that destroys B2M. The correct KI clone with complete B2M destruction (via KI insertion or indel formation) was amplified in an increased tissue culture format until a population size of 30 million cells was reached. Approximately 10 clones were amplified in this way and confirmed to be pluripotent by testing for OCT4 and SOX2 via intracellular flow cytometry ( Figure 14 ). Clones that passed the above tests were then further tested for karyotyping (Cell Line Genetics Center). In addition, the clones were tested for their ability to differentiate into pancreatic endoderm precursors (PECs) via an established protocol (Schulz et al. (2012) PLoS ONE [Public Library of Science · One] 7(5): e37004). Loss of B2M was further confirmed by the absence of HLA-A, B, and C expression with or without interferon-γ treatment (50 ng / mL, R&D Systems, 285-IF) by flow cytometry ( Figure 15 ). Figure 16 HLA-E expression is shown.

[0475] Example 6: Karyotyping of edited clones

[0476] G-banded karyotyping of edited embryonic stem (ES) cells. One million edited ES cells were passaged into a T-25 culture flask with culture medium (DMEM / F12+10% Xeno-free KSR with 10 ng / mL activin and 10 ng / mL heregulin). After overnight culture, three T25 culture flasks were shipped to the Cytogenetics Laboratory (Cell Line Genetics, Inc.) for karyotyping; FISH analysis for chromosomes 1, 12, 17, and 20; and array comparative genomic hybridization (aCGH) analysis using a standard 8x60K array. The G-banding results of selected cells electroporated with non-cleaving guide ("NCG"), B2M KO clone, B2M HO / PD-L1 HI clone ("V1-A"), and B2M KO / HLA-E KI clone ("V2-A") are shown in Table 14.

[0477] Table 14. G-banding karyotyping results

[0478]

[0479] Example 7: Differentiation of edited human embryonic stem cells into pancreatic endoderm cells (PECs) Maintenance of edited human embryonic stem cells (ES). Edited human embryonic stem cells at different passages (P38-42) were cultured at 33,000 cells / cm for 4 days. 2 Seed, or for 3-day passaging at 50,000 cells / cm 2 For inoculation, the passage was performed with hESM medium (DMEM / F12 + 10% KSR + 10 ng / mL activin A and 10 ng / mL heregulin) and finally 10% human AB serum.

[0480] Aggregation of edited human embryonic stem cells for PEC differentiation. Edited ES cells were dissociated into single cells, centrifuged and resuspended at 1 million cells / ml in 2% StemPro (Cat. No. A1000701, Invitrogen, CA) in DMEM / F12 medium, and a total of 350-400 million cells were centrifuged at 8 RPM ± 0.5 RPM on an 850 cm 2 The cells were seeded in roller bottles (Cat. No. 431198, Corning, NY) for 18-20 hours before differentiation. ES aggregates derived from edited human embryonic stem cells were differentiated into the pancreatic lineage using roller bottles as described in Schulz et al. (2012) PLoS ONE 7(5):e37004. Example 8: Characterization of Differentiated Pancreatic Endoderm Cells (PECs)

[0481] Flow cytometry for FOXA2 and SOX17 at stage 1 (DE) and CHGA, PDX1, and NKX6.1 at the PEC stage. hESC-derived stage 1 aggregates or hESC-derived pancreatic aggregates were washed with PBS and then assayed using ACCUMAX TM (Cat. No. A7089, Sigma, MO) were enzymatically dissociated into a single-cell suspension at 37° C. MACS separation buffer (Cat. No. 130-091-221, Miltenyi Biotec, North Rhine-Westphalia, Germany) was added, and the suspension was passed through a 40 μm filter and pelleted. For intracellular marker staining, cells were fixed in 4% (wt / v) paraformaldehyde for 30 min, washed in FACS buffer (PBS, 0.1% (wt / v) BSA, 0.1% (wt / v) NaN3), then permeabilized on ice for 30 min with Perm buffer (PBS, 0.2% (v / v) Triton X-100 (Cat. No. A16046, Alfa Aesar, Massachusetts), 5% (v / v) normal donkey serum, 0.1% (wt / v) NaN3), then washed with wash buffer (PBS, 1% (wt / v) BSA, 0.1% (wt / v) NaN3). Cells were incubated overnight at 4°C with primary antibodies (Table 15) diluted in blocking buffer (PBS, 0.1% (v / v) Triton X-100, 5% (v / v) normal donkey serum, 0.1% (wt / v) NaN3). The cells were washed in IC buffer and then incubated with appropriate secondary antibodies for 60 min at 4 ° C. The cells were washed in IC buffer and then washed in FACS buffer. Flow cytometry data were obtained using a NovoCyte flow cytometer (ACEA Biosciences, Brussels). Data were analyzed using FlowJo software (Tree Star, Inc.). Intact cells were identified based on forward (low angle) and lateral (orthogonal, 90 °) light scattering. Background was estimated using antibody controls and undifferentiated cells. In the figure, a representative flow cytometry graph for one of the subpopulations is shown. The numbers reported in the figure represent the percentages of total cells from the intact cell gate.

[0482] Table 15. Antibodies used for flow cytometry characterization of differentiated PECs

[0483]

[0484] At the DE stage, the population of FOXA2 and SOX17 double-positive cells exceeded 90% of the total cells from CyT49 wild-type differentiated cells. PD-L1 KI / B2M KO, HLA-E KI / B2M KO, and B2M KO cells showed comparable DE percentages compared to wild-type cells ( Figure 17 and Figure 18 ).

[0485] At the PEC stage, flow cytometry was performed targeting chromogranin (CHGA), PDX1, and NKX6.1. The heterogeneous population at the PEC stage includes pancreatic progenitor cells, early endocrine ( Figure 19 ). According to the pie chart of heterogeneous groups ( Figure 20 ), the distribution of cell populations from differentiated edited cells (PD-L1 KI / B2M KO or B2M KO) was very similar to that of wild-type cells.

[0486] Targeted RNAseq. Targeted RNAseq for gene expression analysis was performed using Illumina TruSeq and a custom panel of oligonucleotides targeting 111 genes. The panel primarily contains genes that serve as markers for developmental stages during pancreatic differentiation. At the end of each differentiation stage, 10 μL APV (aggregated pellet volume) was collected and extracted using a Qiagen RNeasy or RNeasy 96 spin column protocol (including on-column DNase treatment). Quantification and quality control were performed using a TapeStation in conjunction with Qubit or by using a Qiagen QIAxcel. 50-200 ng of RNA was processed according to the Illumina TruSeq library preparation protocol, which consists of cDNA synthesis, hybridization of a custom oligonucleotide pool, washing, extension, ligation of bound oligonucleotides, PCR amplification of the library, and library cleanup; the resulting dsDNA library was then quantified and quality controlled using a TapeStation in conjunction with Qubit or by using a Qiagen QIAxcel. The library was then diluted to a concentration of 4nM and merged, then denatured, incorporated into the PhiX control and further diluted to 10-12pM, then loaded onto the Illumina MiSeq sequencer. After sequencing was run, initial data analysis was automatically performed by BaseSpace to generate raw read counts for each custom probe. For each gene, these read counts for all probes corresponding to the gene were summed, and 1 read count was added (to prevent the downstream portion from reaching 0). Normalization was performed for gene SF3B2, and readings were typically visualized as fold changes compared to stage 0. When processing data for principal component analysis, normalization was performed using the DEseq method. The expression of the selected genes is shown in Figure 21. The kinetic expression patterns of FOXA2, CHGA, PDX1, and NKX6.1 from PD-L1KI / B2M KO or B2M KO cells were similar to those of wild-type cells.

[0487] Confirmation of B2M and PD-L1 expression at the PEC stage. At the PEC stage, differentiated aggregates were stimulated with or without interferon-γ (50 ng / ml) for 48 h. Aggregates were washed with PBS and then cultured using ACCUMAX TM(Cat. No. A7089, Sigma, MO) were enzymatically dissociated into a single cell suspension at 37°C. MACS separation buffer (Cat. No. 130-091-221, Miltenyi Biotec, North Rhine-Westphalia, Germany) was added and the suspension was passed through a 40 μm filter and pelleted. For surface marker staining, the dissociated cells were incubated with fluorescent conjugated antibodies diluted in MACS separation buffer for 20 min and then washed in MACS separation buffer. The cells were resuspended in FACS buffer for flow acquisition. Flow cytometry data were acquired using a NovoCyte flow cytometer. Figures 22A-22F As shown, B2M expression was below the limit of detection in differentiated PECs from PD-L1 KI / B2M KO or B2M KO, and PDL1 was expressed in differentiated PECs from PD-L1 KI / B2M KO cells.

[0488] Immunophenotype of PEC cells. At the PEC stage, differentiated aggregates were stimulated with or without interferon-γ (50 ng / ml) for 48 h. Aggregates were harvested for MHC class I and class II staining. There was no MHC class II expression from wild-type or edited cells (PD-L1 KI / B2M KO and B2M KO cells) at the PEC stage ( Figures 23D-23F ). The expression of HLA-ABC (MHC class I) was low (1.3% from wild-type cells), and it was highly regulated after IFN-γ stimulation. However, HLA-ABC was not expressed in edited cells (PD-L1 KI / B2M KO and B2M KO cells) even under IFN-γ stimulation ( Figures 23A-23C ).

[0489] Example 9: T cell activation / proliferation assay

[0490] The ability of PEC differentiated cells to trigger an immune response was tested via an in vitro human T cell activation / proliferation assay. Fresh donor PBMCs were purchased from Hemacare and CD3+ T cells were purified using a human pan T cell isolation kit (Miltenyi, catalog number 130-096-535). The isolated T cells were isolated using CellTrace TM The cells were labeled with the CFSE cell proliferation kit (Thermo Fisher Scientific, catalog number C34554) and incubated with differentiated PECs for 5 days. TMHuman T activator CD3 / CD28 (Thermo Fisher Scientific, catalog number 11161D) was used as a positive control to activate T cells. Individual T cells were labeled with CFSE and used as a negative control. The percentage of CD3+CFSE+ cells was measured to assess the percentage of T cell proliferation ( Figures 24A-24D WT PECs triggered T cell proliferation above that of T cell-only controls. B2M KO and B2M KO / PD-L1 KI CyT49-derived PECs did not trigger T cell proliferation above that of T cell-only controls, demonstrating the low immunogenicity of the edited cells.

Claims

1. A genetically modified cell comprising: (i) deletions within the beta-2-microglobulin (B2M) locus; and (ii) insertion of a polynucleotide encoding a tolerogenic factor at the site of (i), The tolerogenic factor is PD-L1, HLA-E, HLA-G, CTLA-4 or CD47.

2. The genetically modified cell of claim 1 , wherein the genetic modification is generated by delivering an endonuclease and a guide RNA (gRNA) to the cell, optionally wherein the endonuclease is Cas9, optionally Streptococcus pyogenes Cas9.

3. The genetically modified cell of claim 1, wherein the tolerogenic factor is PD-L1 or HLA-E.

4. The genetically modified cell of claim 3, wherein the tolerogenic factor is PD-L1, and optionally, the nucleotide sequence encoding PD-L1 comprises SEQ ID NO:

17.

5. The genetically modified cell of claim 3, wherein the tolerogenic factor is HLA-E; optionally, the HLA-E sequence comprises an HLA-E trimer sequence, the trimer sequence comprising a B2M signal peptide fused to an HLA-G presenting peptide, the HLA-G presenting peptide fused to a B2M membrane protein, the B2M membrane protein fused to an HLA-E protein without its signal peptide; and further optionally, the nucleotide sequence encoding the HLA-E trimer comprises SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, and SEQ ID NO:

26.

6. The genetically modified cell of claim 2, wherein the tolerogenic factor is PD-L1 or HLA-E.

7. The genetically modified cell of claim 5, wherein the tolerogenic factor is PD-L1, and optionally, the nucleotide sequence encoding PD-L1 comprises SEQ ID NO:

17.

8. The genetically modified cell of claim 5, wherein the tolerogenic factor is HLA-E; optionally, the HLA-E sequence comprises an HLA-E trimer sequence, the HLA-E trimer sequence comprising a B2M signal peptide fused to an HLA-G presenting peptide, the HLA-G presenting peptide fused to a B2M membrane protein, the B2M membrane protein fused to an HLA-E protein without its signal peptide; and further optionally, the nucleotide sequence encoding the HLA-E trimer comprises SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, and SEQ ID NO:

26.

9. The genetically modified cell of any one of claims 1 to 8, wherein the polynucleotide encoding the tolerance-causing agent is flanked by (a) a nucleotide sequence having sequence homology to a region to the left of the site in (i) and (b) a nucleotide sequence having sequence homology to a region to the right of the site in (i).

10. The genetically modified cell of claim 9, wherein (a) comprises the sequence of SEQ ID NO: 13, and (b) comprises the sequence of SEQ ID NO:

19.

11. The genetically modified cell of any one of claims 1-8, further comprising an insertion of a polynucleotide encoding midbrain astrocyte-derived neurotrophic factor (MANF) into the genome of the cell.

12. The genetically modified cell of claim 11, wherein the polynucleotide encoding MANF is inserted into a safe harbor locus.

13. The genetically modified cell of claim 12, wherein the safe harbor locus is selected from the group consisting of AAVS1 (PPPIR12C), ALB, Angptl3, ApoC3, ASGR2, CCR5, FIX(F9), G6PC, Gys2, HGD, Lp(a), Pcsk9, Serpinal, TF, and TTR.

14. The genetically modified cell of any one of claims 1-8, wherein the cell comprises increased expression of one or more safety switch proteins relative to an unmodified cell.

15. The genetically modified cell of claim 14, wherein the one or more safety switch proteins comprise herpes simplex virus-1 thymidine kinase (HSV-tk), inducible caspase-9, or both.

16. The genetically modified cell of any one of claims 1-8, wherein the polynucleotide encoding the tolerogenic factor comprises an exogenous promoter.

17. The genetically modified cell of claim 16, wherein the exogenous promoter is a CMV, EF1a, PGK, CAG, UBC promoter, or a constitutive promoter, an inducible promoter, a time-specific promoter, a tissue-specific promoter, or a cell type-specific promoter.

18. The genetically modified cell of any one of claims 1-8, wherein the genetically modified cell is a differentiated cell or a somatic cell.

19. The genetically modified cell of any one of claims 1-8, wherein the genetically modified cell is a stem cell.

20. The genetically modified cell of any one of claims 1-8, wherein the genetically modified cell is an embryonic stem cell (ESC), an adult stem cell (ASC), a pluripotent stem cell, an induced pluripotent stem cell (iPSC), or a hematopoietic stem and progenitor cell (HSPC).

21. The genetically modified cell of any one of claims 1-8, wherein the genetically modified cell is capable of differentiating into a lineage-restricted progenitor cell or a fully differentiated somatic cell.

22. The genetically modified cell of claim 21, wherein the lineage-restricted progenitor cell is a pancreatic endoderm progenitor cell, a pancreatic endocrine progenitor cell, a mesenchymal progenitor cell, a muscle progenitor cell, a mother cell, or a neural progenitor cell, or wherein the fully differentiated somatic cell is an endocrine cell, an epithelial cell, an endodermal cell, a macrophage, a hepatocyte, an adipocyte, a kidney cell, a blood cell, or an immune system cell.

23. A composition comprising a plurality of the genetically modified cells of any one of claims 1-22.

24. The composition of claim 23, further comprising at least one pharmaceutically acceptable excipient.

Images