OsSULTR2;2 protein and application of its coding gene in regulating rice salt tolerance

By knocking out the OsSULTR2;2 gene in rice using a CRISPR/Cas9 vector, the problem of regulating rice salt tolerance was solved, improving the rice's salt stress tolerance and enhancing its growth and yield.

CN120624540BActive Publication Date: 2026-02-17NATIONAL TECHNOLOGY INNOVATION CENTER FOR SALT-ALKALI TOLERANT RICE AT SANYA +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511129857.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-13
Publication Date
2026-02-17
Estimated Expiration
2045-08-13

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively regulate the salt tolerance of rice, thus affecting its growth and yield.

Method used

By reducing the content and/or activity of OsSULTR2;2 protein in rice, gene knockout technology using CRISPR/Cas9 vectors was employed to inhibit the expression of the OsSULTR2;2 gene, thereby improving the salt tolerance of rice.

Benefits of technology

It significantly improved the salt tolerance of rice, reduced damage under salt stress, and enhanced its growth and yield.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120624540B_ABST
    Figure CN120624540B_ABST
Patent Text Reader

Abstract

The present application relates to the field of rice genetic engineering, and specifically provides application of OsSULTR2;2 protein and its coding gene in regulating salt tolerance of rice, wherein the protein satisfies the following conditions: B1) the amino acid sequence is the protein of SEQ ID NO. 1; B2) a fusion protein with the same function obtained by connecting a tag to the N terminal and / or C terminal of B1). The present application is suitable for OsSULTR2;2 Transgenic rice after gene knockout is subjected to salt stress phenotype identification in seedling stage, and the results show that when the gene fragment is deleted, the salt stress tolerance of rice is improved, thereby confirming the function and application approach of the gene. Therefore, the OsSULTR2;2 protein and its coding gene of the present application can regulate the salt tolerance of rice, and have important significance for cultivating salt-tolerant transgenic rice.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of rice genetic engineering, specifically involving the application of the OsSULTR2;2 protein and its encoding gene in regulating rice salt tolerance. Background Technology

[0002] Plants are affected by many abiotic stresses during their growth, among which soil salinization not only limits the growth range of rice but also reduces its yield and quality. In my country, 65% of the population relies on rice as a staple food, and the country has approximately 99 million hectares of saline-alkali land. However, only 20% of this saline-alkali land is suitable for cultivation, indicating a vast potential for improvement. Therefore, identifying salt-tolerant genes, studying rice salt-tolerance mechanisms, and breeding new salt-tolerant rice varieties are crucial for increasing rice yields in saline-alkali land.

[0003] Soil salinization's most direct harm to rice manifests as inhibition of its growth and development, primarily affecting seed germination, seedling stage, and reproductive growth. Under salt stress, rice seed germination is hindered, mainly because osmosis and ion toxicity limit physiological water absorption by the seed, damaging membrane structure and thus inhibiting germination. Rice seedlings are sensitive to salt stress, exhibiting significantly inhibited root growth, death of older leaves, and chlorosis. Salt stress during the tillering stage causes the most severe damage to leaves, resulting in reduced chloroplast number, smaller leaf area, and inhibited photosynthesis. During panicle differentiation, salt stress significantly reduces panicle length, number of primary branches, number of spikelets, and grain size, impacting rice yield and quality. Furthermore, salt stress severely shortens stems and panicles during the booting stage, significantly affecting the number of effective panicles and thousand-grain weight. During the grain-filling stage, salt stress can lead to insufficient photosynthetic products, hinder panicle differentiation, reduce the grain filling rate, and delay maturity, resulting in a decrease in rice yield and quality.

[0004] The mechanisms of salt stress tolerance in rice mainly include four aspects: osmotic regulation, ion balance regulation, hormone regulation, and antioxidant regulation. Many salt-tolerant genes involved in these regulatory mechanisms have been identified in rice. Salt stress induces the expression of genes involved in the biosynthesis of osmotic substances, and overexpression of these genes in rice can lead to salt tolerance. OsP5CS1, OsRPK1 and OsTPP1 When the gene is identical, the content of proline and trehalose in rice plants increases or decreases, thus affecting their salt tolerance. In the process of regulating salt tolerance through ion balance in rice, this is mainly achieved through Na+. + or K + Transporter protein (HKT), K + Transporter protein (HAK), Na + / H + Antiporter proteins NHX, SOS1 and Ca 2+Protein-mediated ion response mechanisms, such as channel proteins, are used to remove excess Na+. + Or to maintain ion homeostasis and avoid toxicity. Similarly, some hormone-responsive transcription factors play a crucial role in the regulation of salt stress in rice, such as... OsABAR1 Furthermore, the antioxidant system of rice plays an important role in improving rice's salt stress tolerance, and overexpression of antioxidant enzyme functional genes... OsMn-SOD1 , OsCu / Zn-SOD, OsGR3 and OsGRX8 and antioxidant enzyme regulatory genes OsZFP213 , OsMYB2 It can protect against the damage caused by salt stress.

[0005] Salt tolerance in rice is a complex quantitative trait, and the process of breeding salt-tolerant rice varieties using traditional breeding methods is lengthy. However, using modern breeding techniques to discover key salt-tolerant genes in rice, or to transfer homologous genes from other crops into rice, elucidating their physiological and molecular mechanisms, and applying them to practical breeding is of great significance for the full utilization of saline-alkali land and ensuring national food security. Summary of the Invention

[0006] The technical problem to be solved by this invention is how to regulate the salt tolerance of rice (e.g., increase or decrease the salt tolerance of rice). The technical problem to be solved is not limited to the described technical subject matter; other technical subject matter not mentioned herein will be clearly understood by those skilled in the art through the following description.

[0007] To solve the above-mentioned technical problems, the present invention provides the following technical solution:

[0008] The first aspect of this invention provides an application for reducing protein content and / or activity, said application being any of the following:

[0009] A1) Application in improving salt tolerance in rice;

[0010] A2) Application in the preparation of products that improve the salt tolerance of rice;

[0011] A3) Application in the cultivation of salt-tolerant rice;

[0012] A4) Application in the preparation of products for cultivating salt-tolerant rice;

[0013] A5) Application in salt-tolerant breeding of rice or improvement of salt-tolerant rice germplasm resources;

[0014] The protein, named OsSULTR2;2, meets the following conditions:

[0015] B1) A protein whose amino acid sequence is SEQ ID NO.1; or B2) A fusion protein with the same function obtained by attaching a tag to the N-terminus and / or C-terminus of B1).

[0016] In the above applications, the protein OsSULTR2;2 can be derived from rice.

[0017] Furthermore, the protein OsSULTR2;2 may be the rice salt tolerance-related protein OsSULTR2;2.

[0018] To facilitate the purification or detection of proteins in B1), a tag protein can be attached to the amino or carboxyl terminus of the protein, which consists of the amino acid sequence shown in SEQ ID No. 1 in the sequence listing.

[0019] The tagged proteins include, but are not limited to: GST (glutathione thiotransferase) tagged protein, His6 tagged protein (His-tag), MBP (maltose-binding protein) tagged protein, Flag tagged protein, SUMO tagged protein, HA tagged protein, Myc tagged protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag tagged protein.

[0020] A second aspect of the invention provides the application of biomaterials related to the protein OsSULTR2;2, wherein the application is any of the following:

[0021] D1) Application in improving salt tolerance in rice;

[0022] D2) Application in the preparation of products that improve the salt tolerance of rice;

[0023] Application of D3 in the cultivation of salt-tolerant rice;

[0024] D4) Application in the preparation of products for cultivating salt-tolerant rice;

[0025] D5) Application in salt-tolerant breeding of rice or improvement of salt-tolerant rice germplasm resources;

[0026] The biomaterial is any one of the following E1) to E7):

[0027] E1) Nucleic acid molecules that inhibit or reduce the expression of the gene encoding the protein described in claim 1;

[0028] E2) An expression cassette containing the nucleic acid molecules described in E1);

[0029] E3) A recombinant vector containing the nucleic acid molecule described in E1), or a recombinant vector containing the expression cassette described in E2);

[0030] E4) Recombinant microorganisms containing the nucleic acid molecules described in E1), or recombinant microorganisms containing the expression cassette described in E2), or containing

[0031] E3) The recombinant microorganisms of the recombinant vector;

[0032] E5) A transgenic plant cell line containing the nucleic acid molecule described in E1), or a transgenic plant cell line containing the expression cassette described in E2), or a transgenic plant cell line containing the recombinant vector described in E3;

[0033] E6) Transgenic plant tissue containing the nucleic acid molecules described in E1), or transgenic plant tissue containing the expression cassette described in E2);

[0034] E7) A transgenic plant organ containing the nucleic acid molecule described in E1) or a transgenic plant organ containing the expression cassette described in E2).

[0035] In the above applications, the nucleotide sequence of the gene encoding the protein OsSULTR2;2 (CDS) is the nucleotide sequence shown in SEQ ID NO. 2.

[0036] A third aspect of the present invention provides a method for cultivating salt-tolerant plants, the method comprising reducing the content and / or activity of the protein OsSULTR2;2 in a target plant to obtain a salt-tolerant plant with higher salt tolerance than the target plant, wherein the plant is rice.

[0037] In the above method, the reduction of the content and / or activity of the protein OsSULTR2;2 in the target plant is achieved by reducing the expression level of the gene encoding the protein OsSULTR2;2 in the target plant.

[0038] In the above method, reducing the expression level of the gene encoding the protein in the target plant is achieved by using gene knockout technology to decrease the expression level of the gene encoding the protein OsSULTR2;2 in the genome of the target plant.

[0039] In the above method, the expression level of the gene encoding the protein OsSULTR2;2 in the genome of the target plant is reduced by gene knockout technology using a CRISPR / Cas9 vector. The CRISPR / Cas9 vector is a recombinant vector constructed based on the dual target sites of the encoding gene: sgRNA1 (SEQ ID NO.5): GCCAAGCTGGACCCTCAGTATGG and sgRNA2 (SEQ ID NO.6): ACGCCGTCATGGGGACGTCGCGG.

[0040] The present invention has the following beneficial effects:

[0041] This invention, for the first time, proposes that the OsSULTR2;2 protein and its encoding gene can regulate the salt tolerance of rice. By reducing the content and / or activity of the OsSULTR2;2 protein in the target plant (e.g., by inhibiting, silencing, or interfering with the expression of the OsSULTR2;2 gene), the salt tolerance of the target plant can be significantly improved. Therefore, the rice salt tolerance-related protein OsSULTR2;2 and its encoding gene have important theoretical significance and practical value in regulating rice salt tolerance. This invention is of great significance for breeding salt-tolerant transgenic rice. Attached Figure Description

[0042] Figure 1 for OsSULTR2;2 Gene mutants ( ko-OsSULTR2;2-1 and ko-OsSULTR2;2-2 )middle OsSULTR2;2 The mutation site of a gene and the sequences flanking it.

[0043] Figure 2 Wild-type medium-flowered 11 (WT) and OsSULTR2;2 Gene mutants ( ko-OsSULTR2;2-1

[0044] and ko-OsSULTR2;2-2 Seedling phenotype under salt stress.

[0045] Figure 3 Wild-type medium-flowered 11 (WT) and OsSULTR2;2 Gene mutants ( ko-OsSULTR2;2-1 and ko- OsSULTR2;2-2 Seedling survival rate under salt stress. Detailed Implementation

[0046] The following embodiments define the present invention and describe its application in constructing... OsSULTR2;2 CRISPR mutant materials were obtained, their genotypes were identified to obtain homozygous mutants, and their seedling salt stress phenotypes were assessed. Based on all or part of the implementation steps described below, those skilled in the art can determine the basic characteristics of the invention, and various changes and modifications can be made to the invention to suit different uses and conditions without departing from its spirit and scope. Unless otherwise specified, the technical solutions described in this invention are conventional solutions in the art; the reagents or materials described, unless otherwise specified, are all from commercial sources.

[0047] Example 1: Rice OsSULTR2;2 Cloning of gene coding region (CDS) sequences

[0048] Using cDNA from the aboveground part of rice cultivar Zhonghua 11 seedlings as a template, a primer pair consisting of Primer1 and Primer2 was used to generate the gene.OsSULTR2;2 The CDS fragment was amplified by PCR.

[0049] Primer1:5'-ATGGAGGACACGGCGGCGGCGGTC-3' (SEQ ID NO.3);

[0050] Primer2:5'-TCAGCATTCCAGAGCAGTGCCCTT-3' (SEQ ID NO. 4).

[0051] The PCR reaction system (50 μL) consisted of: 1 μL template cDNA (200 ng / μL), 1.5 μL Primer 1 (10 μM), 1.5 μL Primer 2 (10 μM), 5 μL 10×PCR Buffer for KOD-Plus-Neo, 5 μL 2 mM dNTP, 3 μL 25 mM MgSO4, 1 μL KOD-Plus-Neo (1 U / μL), and 32 μL ddH2O. The PCR amplification reaction was performed in a PCR instrument. The PCR reaction program was: 94℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 60℃ annealing for 30 s, 68℃ extension for 2 min, for 35 cycles; 68℃ extension for 5 min; and storage at 4℃.

[0052] The PCR products were recovered and purified using a DNA purification kit (Nanjing Novizan Biotechnology Co., Ltd.), ligated into the pEASY-Blunt expression vector (Beijing TransGen Biotech Co., Ltd.), and the ligation product was transformed into Escherichia coli DH5α competent cells (Baori Biotechnology (Beijing) Co., Ltd.). Positive clones were selected for sequencing (Sangon Biotech (Shanghai) Co., Ltd.).

[0053] Sequencing results showed that the PCR amplification obtained OsSULTR2;2 The CDS fragment of the gene has the nucleotide sequence shown in SEQ ID NO.2, encoding a protein consisting of 660 amino acid residues as shown in SEQ ID NO.1.

[0054] Example 2: Construction of transgenic plants of the rice gene OsSULTR2;2 mutant

[0055] one, OsSULTR2;2 Construction of gene knockout vector

[0056] according to OsSULTR2;2The genome sequence (SEQ ID NO.1) was used to design CRISPR-Cas9 sgRNA targets using the CRISPR-P V2.0 website (http: / / crispr.hzau.edu.cn / CRISPR2 / ). The target was selected for... OsSULTR2;2 The dual target sequences for constructing the gene editing vector are: GCCAGCTGGACCCTCAGTATGG (SEQ ID NO. 6) and ACGCCGTCATGGGGACGTCGCGG (SEQ ID NO. 7).

[0057] Based on the target sequence, Primer3 and Primer4, and Primer5 and Primer6 were synthesized. The two primer pairs were annealed to obtain two double-stranded DNA molecules with sticky ends. These two double-stranded DNA molecules were ligated into a BsaI-cleaved pOs-sgRNA linearized vector (the vector construction method is described in the literature "Targeted mutagenesis in rice using CRISPR-Cas system") using T4 DNA ligase. The ligation product was transformed into DH5α *E. coli*. Positive clones were identified by colony PCR, and plasmids were extracted and sequenced. Sequencing results showed that a recombinant vector containing the sequences shown in SEQ ID NO. 5 and SEQ ID NO. 6 was obtained and named pOs-sgRNA- OsSULTR2;2 .

[0058] Primer3: 5'-ggcaGCCAAGCTGGACCCTCAGTATGG-3' (SEQ ID NO.7);

[0059] Primer4: 5'-aaacCCATACTGAGGGTCCAGCTTGGC-3' (SEQ ID NO.8);

[0060] Primer5: 5'-ggcaGCCAAGCTGGACCCTCAGTATGG-3' (SEQ ID NO.9);

[0061] Primer6: 5'-aaacCCATACTGAGGGTCCAGCTTGGC-3' (SEQ ID NO. 10).

[0062] pOs-sgRNA- OsSULTR2;2 The plasmid and CRISPR-Cas9 vector plasmid were subjected to PCR amplification according to the corresponding system; the PCR reaction system (10 μL) was: 6 μL H2O, 2 μL CRISPR-Cas9 vector plasmid, and pOs-sgRNA-OsSULTR2;2 1 μL of plasmid and 1 μL of enzyme mix were added, and then all components were mixed on ice. After mixing, the mixture was incubated at room temperature (20°C) for 1 hour. Transformation into *E. coli*: 5 μL of the reaction solution was added to at least 50 μL of competent cells, mixed, and incubated on ice for 30 minutes; the cells were gently removed, heat-shocked at 42°C for 60 seconds, and immediately placed on ice for 2 minutes; 500 μL of SOB / LB was added, and the cells were incubated at 37°C and 200 rpm for 1 hour; an appropriate amount of bacterial culture was spread on LB agar plates containing kanamycin and incubated overnight at 37°C upside down; positive clones were identified by colony PCR, and the plasmid was extracted and sequenced to obtain the plasmid pH-Ubi-cas9- containing the sequences shown in SEQ ID NO. 6 and SEQ ID NO. 7. OsSULTR2;2 .

[0063] II. Obtaining Recombinant Agrobacterium

[0064] pH-Ubi-cas9- OsSULTR2;2 Mix with Agrobacterium EHA105 competent cells, incubate on ice for 5 min, and then electroporate (1500V, 5ms) pH-Ubi-Cas9- OsSULTR2;2 The recombinant strain was obtained by transformation into Agrobacterium EHA105 competent cells. The recombinant strain, which was correctly identified by colony PCR, was named EH-pH-Ubi-cas9. -OsSULTR2;2 .

[0065] III. Obtaining Transgenic Plants

[0066] The above-mentioned recombinant Agrobacterium strain was transformed into the rice variety Nipponbare, using the following method:

[0067] Seed induction: Wash in the following order: 30 seconds with alcohol, 15 minutes with 30% sodium hypochlorite solution, and 5 times with sterile water. Finally, remove excess water and place in induction medium for culture.

[0068] Callus subculture: Use sterile forceps to separate the buds and seeds, retain the mature callus tissue, and place it on a culture medium for further culture.

[0069] Agrobacterium activation: Dip a 200 μL pipette tip into the Agrobacterium culture, plot it on a YEP plate, and incubate in the dark at 28 degrees Celsius for 2 days.

[0070] Agrobacterium infection: The carrier on the plate was rinsed into a suspension with the infection solution. The callus was soaked in the suspension for 15 minutes. Then the callus was transferred to sterile filter paper to absorb the excess liquid and placed at 25 degrees Celsius for 3 days of incubation.

[0071] Selection culture: The callus after dark culture was washed with water containing carbenicillin, dried with air in a clean bench, and then placed on selection culture medium for selection culture.

[0072] Differentiation and regeneration: Positive particles that grow on the selection medium are transferred to the differentiation medium for regeneration.

[0073] Seedling rooting: Seedlings growing on differentiation medium are rooted into rooting tubes for root strengthening culture.

[0074] The differentiated rice seedlings were hardened off and then transferred to the field for growth, resulting in T0 generation transgenic plants.

[0075] Example 3: Rice OsSULTR2;2 Molecular identification of transgenic plants with gene mutants

[0076] The obtained from Example 2 OsSULTR2;2 The aboveground parts of seedlings of the T0 generation transgenic plants were sampled, and genomic DNA was extracted as a template. Primers composed of Primer7 and Primer8 were used to amplify the DNA fragments on and around the editing target sites shown in SEQ ID NO.6 and SEQ ID NO.7.

[0077] Primer7: 5'-GCAGTAACCAGCATAACAGAAAAG-3' (SEQ ID NO. 11);

[0078] Primer8: 5'-TCTTGTTCGGCTTAACTGTAGTAA-3' (SEQ ID NO. 12).

[0079] The obtained PCR products were detected by 1% agarose gel electrophoresis and then sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. Based on the sequencing results, two [products / products] were identified. OsSULTR2;2 The individual plants with specific gene mutations are: ko- OsSULTR2;2 -1 and ko- OsSULTR2;2 -2, the editing target site and the DNA sequences flanking it in these two individual plants are as follows Figure 1 As shown.

[0080] in ko- OsSULTR2;2 -1 single plant, OsSULTR2;2 The gene has four nucleotides deleted at the second exon (CCTC) and one nucleotide deleted at the third exon (G).

[0081] in ko- OsSULTR2;2 -2 single plants, OsSULTR2;2 The gene has thirteen nucleotides missing in the second exon (ACCCTCAGTATGG) and one nucleotide missing in the third exon (G).

[0082] In these two mutant monoplantsOsSULTR2;2 Mutations in the CDS sequence of the gene all lead to frameshift mutations in the encoded protein and premature termination.

[0083] Example 4: OsSULTR2;2 Salt tolerance phenotype identification of seedlings of gene mutant plants

[0084] The two identified in Example 3 OsSULTR2;2 Two generations of self-crossing were performed on the T0 generation of transgenic mutant plants to obtain the homozygous mutant line ko- OsSULTR2;2 -1 and ko- OsSULTR2;2 -2. The two homozygous mutant lines were compared with the wild type of Zhonghua 11 in a seedling salt tolerance identification experiment.

[0085] (1) Select plump rice seeds and soak them in tap water for 2 days in a 37℃ incubator, followed by germination for 1 day. Select seeds with uniform germination and sow them onto a 96-well PCR plate without tube bottoms. Place the plates in blue culture trays filled with tap water and cultivate the seedlings in an artificial climate chamber. The cultivation conditions are: 14h light (28℃) / 10h darkness (24℃), 100% light intensity, and 70% relative humidity. After culturing in tap water for another week, the seedlings are then cultured in 800×Yoshida rice nutrient solution (three components).

[0086] (2) When the rice seedlings grow to the three-leaf stage, the nutrient solution is replaced with 800×Yoshida rice nutrient solution (three components) containing 8‰ NaCl to carry out salt stress treatment.

[0087] (3) After 14 days of NaCl treatment, the rice seedlings were rehydrated using 800×Yoshida rice nutrient solution (three components) without NaCl. After 7 days, the survival rate of the rice seedlings was calculated. Survival rate = number of surviving seedlings / total number of seedlings treated × 100%.

[0088] (4) Salt tolerance test results are shown in the figure: compared with the wild type (WT) of Zhonghua 11, both... OsSULTR2;2 Gene mutant lines (ko- OsSULTR2;2 -1 and ko- OsSULTR2;2 -2) The symptoms of salt damage, such as wilting and drying of leaves, are relatively mild. Figure 2 After 14 days of salt stress treatment and 7 days of rehydration, ko- OsSULTR2;2 -1 and ko- OsSULTR2;2 The survival rate of seedlings of strain -2 was significantly higher than that of its wild type (WT). Figure 3 ).

[0089] The above experimental results show that OsSULTR2;2 The gene has the function of negatively regulating the salt tolerance of rice seedlings, and knocking out the gene can significantly improve the salt tolerance of rice.

[0090] The present invention has been described in detail above. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0091] The term "protein" is used interchangeably herein to mean a polymer of amino acid residues. The term applies to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are non-naturally encoded amino acids. As used herein, the term encompasses amino acid chains of any length, including full-length proteins (i.e., antigens), wherein the amino acid residues are linked via covalent peptide bonds.

[0092] The term "conversion" refers to the method of introducing a heterologous DNA sequence into a host cell or organism.

[0093] The term "expression" refers to the transcription and / or translation of endogenous genes or transgenes in plant cells.

[0094] For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments are given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. Use of a gene coding for an OsSULTR2;2 protein, characterized in that, The application is any one of the following: A1) application in improving salt tolerance of rice; A2) application in breeding salt-tolerant rice; A3) application in salt-tolerant breeding of rice or improvement of salt-tolerant germplasm resources of rice; The sequence of the gene encoding the OsSULTR2;2 protein is shown in SEQ ID NO.

2.

2. A method for breeding salt-tolerant plants, characterized in that, The method comprises knocking out the gene of the OsSULTR2;2 protein in a plant to obtain a plant with high salt tolerance, the plant is rice, and the nucleotide sequence of the nucleic acid molecule encoding the OsSULTR2;2 protein is shown in SEQ ID NO.

2.

3. The method of claim 2, wherein, The gene of the OsSULTR2;2 protein knocked out in the plant is to reduce the expression amount of the gene encoding the OsSULTR2;2 protein in the plant by using a gene knockout technology.

4. The method of claim 3, wherein, The reduction of the expression amount of the gene encoding the OsSULTR2;2 protein in the plant by using a gene knockout technology is carried out by using a CRISPR / Cas9 vector, and the CRISPR / Cas9 vector is a recombinant vector constructed based on the double target sites sgRNA1: GCCAAGCTGGACCCTCAGTATGG and sgRNA2: ACCCCGTCATGGGGACGTCGCGG of the encoding gene.

Citation Information

Patent Citations

  • SULTR sulfate transport protein of soybean and coding gene and application of sulfate transport protein

    CN104087599A

  • A tea tree sulfate transporter CsSULTR1; application of gene 1

    CN116676316A