Application of TCF19 inhibiting reagent in preparation of medicine for treating lung adenocarcinoma

Abstract

The invention provides application of a reagent for inhibiting TCF19 in preparation of a medicine for treating lung adenocarcinoma, and belongs to the technical field of biological medicine. The research finds that the TCF19 is remarkably and highly expressed in lung adenocarcinoma tissues; by knocking down TCF19, lung adenocarcinoma proliferation can be inhibited, and the chemotherapy effect of 5-fluorouracil can be enhanced; meanwhile, the upstream regulatory factor for regulating and controlling the expression increase of the lung adenocarcinoma by the TCF19 is BRD4, and when the BRD4 is knocked down, the mRNA level of the TCF19 is obviously reduced, and the protein level is also obviously reduced. TCF19 can be used as a therapeutic target of lung adenocarcinoma, and a reagent for inhibiting TCF19 is used for preparing a medicine for treating lung adenocarcinoma and has very high application prospect and medical value.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to the use of a reagent for inhibiting TCF19 in the preparation of a drug for treating lung adenocarcinoma. Background Art

[0002] Currently, the treatment of LUAD mainly relies on targeted drugs for known targets such as EGFR, ALK, and ROS1. However, these targets only cover a portion of the patient population, and the problem of drug resistance to targeted therapy is widespread, resulting in poor long-term treatment effects. At the same time, although traditional chemotherapy drugs can kill tumor cells, they have serious toxic side effects and tumor cell resistance, which significantly limits their clinical application. In addition, immune checkpoint inhibitors have shown certain efficacy in the treatment of LUAD, but are only effective in some patients and may induce immune-related adverse reactions. Therefore, existing treatment methods still cannot meet the clinical needs of NSCLC patients, and there is an urgent need to find new potential tumor treatment targets.

[0003] In-depth research on the molecular mechanisms of LUAD development and progression has revealed that the processes of tumor cell proliferation, invasion, metastasis, and drug resistance involve numerous signaling pathways and biological molecules that have not yet been fully explored. Exploring new potential tumor therapeutic targets can not only expand the target range for LUAD treatment and provide more patients with precise treatment options, but also effectively overcome the drug resistance of existing treatments by developing specific drugs or combination treatment strategies targeting new targets, achieve chemotherapy sensitization, and enhance treatment efficacy. Therefore, further exploring new LUAD targets has important theoretical significance and clinical value for breaking through current treatment bottlenecks and improving patient prognosis, and is a key direction for conquering LUAD. Summary of the Invention

[0004] In view of this, the object of the present invention is to provide use of an agent that inhibits TCF19 in the preparation of a drug for treating lung adenocarcinoma.

[0005] The present invention provides use of a reagent for detecting TCF19 in preparing a reagent for auxiliary diagnosis of lung adenocarcinoma, wherein the TCF19 is significantly highly expressed in lung adenocarcinoma tissue.

[0006] The present invention provides use of a substance that inhibits TCF19 in preparing a medicine for treating lung adenocarcinoma.

[0007] Preferably, the substance that inhibits TCF19 includes a BET family inhibitor.

[0008] Preferably, the BET family inhibitor is JQ1.

[0009] Preferably, the substance that inhibits TCF19 includes shRNA of TCF19.

[0010] Preferably, the sense strand of the shRNA is shown as SEQ ID NO.1, and the antisense strand of the shRNA is shown as SEQ ID NO.2.

[0011] Preferably, the substance that inhibits TCF19 includes shRNA of BRD4, and the sequence of the shRNA of BRD4 is shown as SEQ ID NO.3.

[0012] Preferably, the substance that inhibits TCF19 includes an agent that overexpresses BRD4-BD1.

[0013] The present invention provides use of a substance that inhibits TCF19 in preparing a reagent for inhibiting the proliferation of lung adenocarcinoma cells, wherein the lung adenocarcinoma cells include lung adenocarcinoma cell lines A549 or H1299.

[0014] The present invention provides use of a substance that inhibits TCF19 in the preparation of a 5-fluorouracil chemotherapy sensitizer.

[0015] Compared with existing technologies, the present invention has the following beneficial effects: Research has found that TCF19 is significantly overexpressed in lung adenocarcinoma tissue; knocking down TCF19 can inhibit lung adenocarcinoma proliferation and enhance the chemotherapeutic effect of 5-fluorouracil; Furthermore, it was found that BRD4 is the upstream regulatory factor that regulates the elevated expression of TCF19 in lung adenocarcinoma; knocking down BRD4 significantly reduces both TCF19 mRNA and protein levels. TCF19 can serve as a therapeutic target for lung adenocarcinoma, and reagents that inhibit TCF19 can be used to prepare drugs for the treatment of lung adenocarcinoma, with promising application prospects and medical value. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1Figure 1 is the expression of TCF19 in lung adenocarcinoma, where A is the result of analyzing 483 lung adenocarcinoma tissues and 347 normal lung tissues in the TCGA database, and found that TCF19 was highly expressed in tumor tissues; B is the protein expression in tumor tissues and adjacent tissues of lung adenocarcinoma patients detected by WB technology, and compared with adjacent tissues, TCF19 protein was highly expressed in tumor tissues; C is the protein quantitative analysis showing that the expression level of TCF19 protein in tumor tissues was increased; D is the mRNA expression level in tumor tissues and adjacent tissues of lung adenocarcinoma patients detected by QPCR technology, and the results showed that compared with adjacent tissues, TCF19 mRNA expression in tumor tissues was higher than that in adjacent tissues. The level of TCF19 protein was increased; E was detected by WB technology in the lung tissue of the induced mouse lung cancer model and normal lung tissue, and it was found that TCF19 protein was significantly highly expressed in tumor tissue; F was protein quantitative analysis showing that the expression level of TCF19 protein in tumor tissue was increased; G was detected by QPCR technology in the lung tissue of the induced mouse lung cancer model and normal lung tissue, and it was found that TCF19 mRNA expression was significantly increased in tumor tissue; H was the result of immunohistochemistry staining of tumor tissue and adjacent tissue of clinical lung adenocarcinoma patients, and compared with adjacent tissue, TCF19 staining was darker in tumor tissue.

[0017] Figure 2 To construct a stable TCF19-overexpressing cell line and the effect of si-TCF19. A shows Western blotting to detect TCF19 overexpression in the lung adenocarcinoma cell line H1299; B shows Western blotting to detect TCF19 overexpression in the lung adenocarcinoma cell line A549. Flag-vector cells are cells overexpressing an empty viral vector. OV-flag-TCF19 cells are cells overexpressing TCF19. C shows Western blotting to detect TCF19 knockdown in the lung adenocarcinoma cell line H1299; D shows Western blotting to detect TCF19 knockdown in the lung adenocarcinoma cell line A549.

[0018] Figure 3 Clinical tissue testing revealed high TCF19 expression and a poor prognosis. Figure A shows an analysis of TCF19 expression intensity and patient survival using existing lung adenocarcinoma data from the TCGA database. Figure B shows immunohistochemical staining of TCF19 in lung adenocarcinoma tumor tissue. Figure C shows a score based on the area and intensity of the staining particles, combined with patient survival. The results indicate that patients with high TCF19 expression have a poor prognosis.

[0019] Figure 4Overexpression of TCF19 promotes tumor cell proliferation, while knockdown of TCF19 inhibits cell proliferation; A is the result of CCK8 experiment to detect cell proliferation, cells overexpressing TCF19 proliferate faster than cells overexpressing empty vector; cells with knockdown of TCF19 proliferate slower; B is cell cycle analysis of cells, compared with cells overexpressing empty vector, cells overexpressing TCF19 have less G0 / G1 phase and more S phase; C is clone formation experiment using OV-flag-vector, OV-flag-TCF19 and Sh-TCF19 cells respectively, compared with the overexpression empty vector group, overexpression of TCF19 increases the number of cell clones; after knockdown of TCF19, the number of cell clones decreases; D is EDU experiment to detect cell proliferation, cells overexpressing TCF19 proliferate faster, while cells with knockdown of TCF19 proliferate slower. E is a nude mouse subcutaneous tumor-bearing experiment, which found that the tumors formed by tumor cells overexpressing TCF19 in vivo were significantly larger than those formed by cells overexpressing an empty vector; F is the immunohistochemical staining results showing that the expression levels of cell proliferation markers KI67 and PCNA proteins in tumors formed by OV-flag-TCF19 cells were higher than those in tumors formed by OV-flag-vector cells.

[0020] Figure 5BRD4 is the direct upstream factor regulating TCF19 transcription; A is the use of RNAseq sequencing technology to detect cells overexpressing empty vector and overexpressing BRD4, and it was found that TCF19 was significantly upregulated in cells overexpressing BRD4; B is the use of RNAseq sequencing technology to compare the JQ1 treatment group and the non-drug treatment group, and it was found that TCF19 was significantly downregulated in the JQ1 treatment group; C is the use of 1μM concentration of BET family inhibitor JQ1 for 0h, 12h, 24h, and 48h. After treatment, the protein level of TCF19 gradually decreased with the extension of JQ1 action time, showing time dependence; D is by setting a JQ1 concentration gradient of 0μM, 0.01μM, 0.1μM and 1μM, it was observed that the protein expression level of TCF19 gradually decreased with the increase of JQ1 concentration, showing concentration dependence; E, F, G shows the knockdown efficiency of BRD2, BRD3 and BRD4 detected by QPCR technology to detect BET family members that affect TCF19; H and I show the knockdown of BRD2 and BRD3 for protein detection, and the TCF19 level remains basically unchanged; J shows that by knocking down BRD2, BRD3 and BRD4, it was found that the mRNA level of TCF19 was reduced only when BRD4 was knocked down; K shows the overexpression analysis of two functional motifs BD1 and BD2 of BRD4, and the results showed that overexpression of BD1 can significantly reduce the expression level of TCF19, indicating that the BD1 motif of BRD4 has a regulatory effect on TCF19; L shows the correlation between the expression levels of BRD4 and TCF19 found through immunohistochemical analysis of clinical lung adenocarcinoma samples; M shows the CHIP experiment, and the results show that BRD4 can directly bind to the promoter region of TCF19.

[0021] Figure 6 Exploring the downstream pathways of TCF19. Figures A and B show RNAseq analysis of cells overexpressing either empty vector or TCF19, revealing a significant upregulation of CyclinD2 in TCF19-overexpressing cells. Figure C shows the analysis of other genes with altered mRNA levels, revealing 20 genes associated with the cell cycle. Figure D shows a correlation analysis of these genes in C with TCF19, revealing a stronger correlation between CyclinD2 and TCF19 expression.

[0022] Figure 7TCF19 directly regulates the transcription of CyclinD2. A shows that the expression level of CyclinD2 protein is significantly increased under the condition of overexpression of TCF19; B shows that the expression level of CyclinD2 protein is significantly reduced after knocking down TCF19; C shows that the fluorescence intensity of CyclinD2 is significantly increased after overexpression of TCF19; D shows that the staining of mouse tumor tissue and normal lung tissue by immunohistochemistry technique shows that TCF19 and CyclinD2 staining is deepened in mouse tumor tissue; E shows that the staining of mouse skin by immunohistochemistry technique is deepened Figure 5 (A) shows tumor staining of the tumor formed by tumorigenesis, and the results show that CyclinD2 staining is deepened in tumor tissues overexpressing TCF19; F is WB detection of tumor-bearing tissues, and the protein expression level of CyclinD2 is significantly increased in tumor tissues overexpressing TCF19; G is Q-PCR detection, which found that in tumor tissues overexpressing TCF19, the mRNA expression level of CyclinD2 was significantly higher than that in the control group; H is a CHIP experiment, and the results show that TCF19 can directly bind to the promoter of CyclinD2.

[0023] Figure 8 The BRD4-TCF19-CyclinD2 pathway exists in lung adenocarcinoma; A is the WB results showing that after treatment with 1 μM concentration of BET family inhibitor JQ1, the expression levels of TCF19 and CyclinD2 proteins were significantly decreased. B shows that Q-PCR analysis showed that after treatment with 1 μM concentration of BET family inhibitor JQ1, the mRNA expression levels of TCF19 and CyclinD2 were significantly decreased; C shows that after knocking down BRD4, the protein expression levels of TCF19 and CyclinD2 were significantly decreased; D shows that after knocking down BRD4, the mRNA expression levels of TCF19 and CyclinD2 were significantly decreased; E shows that after overexpressing BRD4, the protein expression levels of TCF19 and CyclinD2 were significantly increased; F shows that after overexpressing BRD4, the mRNA expression levels of TCF19 and CyclinD2 were significantly increased; G and H show that the results of rescue experiments showed that BRD4 regulates the expression of CyclinD2 by upregulating TCF19, and TCF19 mediates the effect of BRD4 on CyclinD2, and TCF19 plays a mediating role.

[0024] Figure 95-Fluorouracil can affect the expression of TCF19 and CYCLIND2 by inhibiting BRD4, thereby regulating the chemotherapy resistance of lung adenocarcinoma; A and B show that by setting a 5-fluorouracil concentration gradient of 0 μM, 0.05 μM, 0.5 μM and 5 μM, using WB and Q-PCR detection technology, the mRNA and protein expression levels of TCF19 gradually decreased with the increase of 5-fluorouracil concentration, showing a concentration dependence; C and D show that after treatment with 5 μM 5-fluorouracil for 0 h and 12 h After 1, 24, and 48 hours, WB and Q-PCR assays revealed that TCF19 mRNA and protein levels gradually decreased with prolonged 5-FU exposure, showing a time-dependent pattern. Figure E shows that after 48 hours of treatment with 5 μM 5-fluorouracil, WB results revealed decreased protein expression of BRD4, TCF19, and CyclinD2. Figure F shows that real-time quantitative PCR results revealed decreased mRNA expression of TCF19 and CyclinD2 following 5-fluorouracil addition. Figure G shows that after TCF19 knockdown, the addition of 5-fluorouracil resulted in lower cell viability compared to the control group. DETAILED DESCRIPTION

[0025] The present invention provides use of a reagent for detecting TCF19 in preparing a reagent for auxiliary diagnosis of lung adenocarcinoma, wherein the TCF19 is significantly highly expressed in lung adenocarcinoma tissue.

[0026] In this study, an analysis of 483 lung adenocarcinoma tissues and 347 normal lung tissues from the TCGA database revealed that TCF19 is highly expressed in tumor tissues. Protein expression in both tumor and adjacent adjacent tissues from lung adenocarcinoma patients was also detected, revealing that TCF19 protein was highly expressed in tumor tissues compared to adjacent adjacent tissues. This suggests that TCF19 could be used as a biomarker for the development of diagnostic reagents for lung adenocarcinoma.

[0027] The present invention also provides the use of a substance that inhibits TCF19 in the preparation of a drug for treating lung adenocarcinoma. In the present invention, the substance that inhibits TCF19 preferably includes a BET family inhibitor, and the BET family inhibitor is preferably JQ1; the BET family inhibitor inhibits TCF19 by targeting and inhibiting the expression of BRD4. In the present invention, the substance that inhibits TCF19 preferably includes a BRD4 shRNA, and the sequence of the BRD4 shRNA is shown in SEQ ID NO.3. The BRD4 shRNA inhibits TCF19 by targeting and inhibiting the expression of BRD4. In the present invention, the substance that inhibits TCF19 also includes an agent that overexpresses BRD4-BD1. The agent that overexpresses BRD4-BD1 competitively inhibits BRD4 by overexpressing BD1, thereby inhibiting TCF19.

[0028] In the present invention, the substance that inhibits TCF19 preferably further includes shRNA of TCF19, the sense strand of the shRNA is shown as SEQ ID NO.1, and the antisense strand of the shRNA is shown as SEQ ID NO.2.

[0029] The present invention also provides the use of a substance that inhibits TCF19 in the preparation of an agent for inhibiting the proliferation of lung adenocarcinoma cells, including lung adenocarcinoma cell lines A549 or H1299. In the present invention, the substance that inhibits TCF19 includes, but is not limited to, the aforementioned BET family inhibitors, BRD4 shRNA, agents that overexpress BRD4-BD1, and TCF19 shRNA.

[0030] The present invention also provides the use of a substance that inhibits TCF19 in the preparation of a 5-fluorouracil chemotherapy sensitizer.

[0031] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0032] Example 1

[0033] Verification of TCF19 expression level in lung adenocarcinoma tissues

[0034] Statistical analysis of the TCGA database revealed that TCF19 mRNA levels in lung adenocarcinoma patients were significantly higher ( Figure 1 A).

[0035] Western blotting was performed on tissue proteins extracted from 10 pairs of lung adenocarcinoma tissues and adjacent adjacent tissues collected from the Affiliated Hospital of Guangdong Medical University.

[0036] (1) Protein extraction: Accurately weigh 150 mg of tissue sample and wash the surface impurities and blood with PBS. Add 1 ml of RIPA cell lysis buffer and protease inhibitor PMSF (final concentration 1 mM, add immediately before use) to the grinding tube containing grinding beads and tissue, place it in a freezing grinder, grind at a frequency of 70 Hz for 60 seconds, and repeat this process three times. Lyse on ice for 30 minutes, centrifuge at 12000 rpm at 4°C for 10 minutes, take 500 μL of the supernatant, add 100 μL of 6xprotein loading buffer, mix well by pipetting, and boil in a 95°C metal bath for 15 minutes to obtain a denatured and stable tissue protein sample.

[0037] (2) Preparation of polyacrylamide gel: Wash and dry the 1.50mm glass plate before preparing the separation gel. After installation and fixing, add double distilled water to test for leaks for 10 minutes. After successful leak testing, discard the water and set the glass plate aside. The separation gel formula is as follows: lower layer gel solution: 3.50ml, lower layer gel buffer: 3.50ml, improved coagulant: 70μL. After the separation gel is prepared, quickly add it to the glass plate and add 3ml of deionized water to seal the gel. Let it stand for 30 minutes until the separation gel solidifies, then discard the sealing gel layer and prepare the concentrated gel. The concentrated gel formula is upper layer gel solution: 1.50ml, upper layer gel buffer: 1.50ml, improved coagulant: 30μL, insert the sample comb, and place the gel plate at room temperature until the concentrated gel is completely solidified and then pull out the sample comb. After the gel is prepared, transfer it to a 4℃ refrigerator for storage and place the gel in a sealed bag filled with deionized water to maintain the stability and integrity of the gel.

[0038] (3) Protein loading: Fix the prepared gel in the electrophoresis device, add the newly prepared electrophoresis buffer to the inner tank, and add the recovered electrophoresis buffer to the outer tank. Start adding protein samples and protein standard molecular weight markers at the same time, and fill the sample wells with 1x protein loading buffer.

[0039] (4) Electrophoresis: After loading the sample, the initial voltage is 80 V. When the sample migrates to the separation gel area and the marker is clearly visible, adjust the voltage to 120 V and continue electrophoresis. Stop electrophoresis when the sample reaches the bottom of the gel.

[0040] (5) Transfer: Place the electrodes in the order of "positive electrode - filter paper - gel - membrane (NC membrane) - filter paper - negative electrode", ensuring that there are no bubbles between the layers. Ensure that the electrodes are oriented correctly (protein transfers from gel to membrane). Turn on the power supply, use constant voltage mode, voltage of 80V, and transfer time of 90 minutes. After the transfer is completed, turn off the power supply and remove the membrane.

[0041] (6) Blocking: Add 1% Tween 20 to PBS to prepare a PBST solution. Use this PBST solution to prepare a blocking solution containing 7% skim milk. Immerse the NC membrane in this blocking solution, place it at room temperature, and shake it on a shaker at a slow speed for 60 minutes.

[0042] (7) Incubation with primary antibody: After blocking, dilute the primary antigen solution with freshly prepared milk and incubate overnight at 4°C.

[0043] (8) Washing the membrane: Recover the primary antibody and wash the NC membrane with PBST buffer for 10 min each time, repeat three times.

[0044] (9) Incubation with primary antibody: Select secondary antibody of corresponding species and incubate at 4°C for 1-2 hours.

[0045] (10) Secondary membrane washing: After incubation, recover the secondary antibody and wash the membrane three times with PBST solution on a shaker.

[0046] (11) Chemiluminescence detection: After washing the membrane, the chemiluminescence substrate solution A and solution B were mixed in a volume ratio of 1:1, and then the mixed substrate was evenly dropped onto the membrane surface for chemiluminescence imaging, and the detection results were saved. It can be seen that the expression level of TCF19 protein was increased in tumor tissue. ( Figure 1 B and E)

[0047] The mRNA level of TCF19 was verified by fluorescence quantitative PCR experiments using tissue mRNA extracted from the pathological tissues of the above 10 pairs of clinical patients.

[0048] (1) RNA extraction:

[0049] 1. Accurately weigh 150 mg of tissue sample and rinse with PBS to remove any surface impurities and blood. Add 1 ml of Trizol reagent to the grinding tube containing the grinding beads and tissue. Place the sample in a cryo-mill at 70 Hz for 60 seconds. Repeat this process three times.

[0050] 2. Add 200 μl of chloroform to each tube, shake vigorously up and down, and let it stand for 5 minutes. After standing, centrifuge the tube at 13,000 rpm and 4°C for 15 minutes.

[0051] 3. Gently aspirate 400 μl of the upper transparent liquid and transfer it to a new 1.5 ml enzyme-free centrifuge tube. Add 400 μl of isopropanol, shake gently, let it stand at room temperature for 10 minutes, and centrifuge at 13,000 rpm for 10 minutes.

[0052] 4. Discard the supernatant, add 1 ml of 75% ethanol to each tube, gently pipette to wash the precipitate, and then centrifuge at 13,000 rpm for 5 minutes at 4°C.

[0053] 5. Discard the supernatant and use filter paper to absorb the remaining liquid in the centrifuge tube. After air drying, add 10 μl of DEPC water to each tube to dissolve the precipitate. Finally, test the concentration of the extracted RNA.

[0054] (2) Reverse transcription:

[0055] Prepare 20 μL reverse transcription system:

[0056] mRNA 1 μg

[0057] 5xqRT SuperMix (Novozymes) 4 μL

[0058] Make up to 20 μL with DEPC water

[0059] Perform reverse transcription using a PCR instrument. The reaction procedure is as follows:

[0060] 50℃15min

[0061] 85℃5s

[0062] Obtain the reverse transcription product cDNA.

[0063] (5) Fluorescence quantitative PCR:

[0064] The TCF19 QPCR primers were found through published literature and the sequences are as follows:

[0065] GAPDH-QPCR-F: CATGTTCGTCATGGGTGTGAACCA (SEQ ID NO.4)

[0066] GAPDH-QPCR-R: ATGGCATGGACTGTGGTCATGAGT (SEQ ID NO.5)

[0067] TCF19-QPCR-F: GGGCGGTGATCCTACAC (SEQ ID NO.6)

[0068] TCF19-QPCR-R: GGGAGTCGGACATTATTGACCA (SEQ ID NO.7)

[0069] GAPDH-Mouse-F:CATGTTCGTCATGGGTGTGAACCA(SEQ ID NO.8)

[0070] GAPDH-Mouse-R: TGTAGACCATGTAGTTGAGGTCA (SEQ ID NO.9)

[0071] TCF19-Mouse-F:AGTCTGGCTGCACCTATGGAT(SEQ ID NO.10)

[0072] TCF19-Mouse-R:AGTCGTCCCCTTGGAGTTCA(SEQ ID NO.11)

[0073] Prepare 10 μL fluorescent quantitative PCR reaction system in a 96-well plate:

[0074] Primers: 0.5 μL each of forward and reverse primers

[0075] cDNA: 1 μL

[0076] 3 μL DEPC water

[0077] 2xchamQ SYBR qPCR Master Mix (Novozymes) 5μL

[0078] Fluorescence quantitative PCR was performed on a QS6P QPCR instrument. The reaction procedure was as follows:

[0079] 1.95℃5min

[0080] 2.95℃20s

[0081] 3.60℃20s

[0082] 4.72℃20s

[0083] Steps 2-4 were cycled 40 times.

[0084] Set a reasonable threshold, collect fluorescence signals, obtain CT values ​​in the exponential amplification phase, and the relative expression level of the target gene is measured by The analysis showed that the mRNA level of TCF19 was significantly increased in tumor tissue ( Figure 1 D and G in ).

[0085] Immunohistochemical staining was performed on 90 pairs of lung adenocarcinoma tissue and adjacent tissue microarrays, which were purchased from Shanghai Tufei Biotechnology (Cat. No. TFLungade-01):

[0086] (1) Dewaxing and hydrating: The sections were baked in a 65°C incubator for 2 h, then dewaxed in wax immersion and dewaxing transparent liquid 1 and 2 for 10 min, and hydrated in 100% ethanol, 95% ethanol, 85% ethanol, 75% ethanol, 50% ethanol, and water for 5 min, respectively.

[0087] (2) Heat antigen repair: Use 0.5 mM EDTA and 0.05% Tween antigen repair solution, place the slices in a 95 ° C water bath for heat antigen repair for 25 minutes, take out and cool naturally to room temperature, and wash with PBS solution three times, each time for 5 minutes.

[0088] (3) Removal of endogenous catalase: Place the slices in 3% hydrogen peroxide solution (prepared with 100% methanol) for 10 minutes to remove endogenous catalase in the tissue slices, and then wash them with PBS three times, each time for 5 minutes.

[0089] (4) Blocking: Prepare 3% BSA solution using PBS solution, draw a circle around the sliced ​​tissue using an immunohistochemistry pen, and then add 3% BSA solution inside the circle for blocking for 10 minutes.

[0090] (5) Incubation with primary antibody: Discard the blocking 3% BSA, add 1:200 TCF19 primary antibody prepared in PBS to the slices, place in a humidified box, and incubate in a 4°C refrigerator for 16 h.

[0091] (6) Incubation with secondary antibody: Remove the wet box from the refrigerator at 4 degrees Celsius. After the sections return to room temperature, wash them three times with PBS, each time for 5 minutes. Then add horseradish peroxidase-labeled secondary antibody (Proteintech, ready-to-use HRP-labeled goat anti-mouse / rabbit secondary antibody), incubate at room temperature for 30 minutes, and wash them three times with PBS solution, each time for 5 minutes.

[0092] (7) DAB staining: Use DAB color developing solution for color development and observe the degree of staining under a microscope. Stop staining immediately after 2 minutes.

[0093] (8) Nuclear staining: Soak in distilled water for 2 minutes, then place in hematoxylin solution for 10 minutes, and rinse three times with tap water. Differentiate in 70% alcohol containing 1% hydrochloric acid for 3-5 seconds, and then re-bluish in water for 60 minutes. (Observe under a microscope to see if the nucleus has been stained blue).

[0094] (9) Dehydration, transparency, and sealing with neutral resin sealing agent: Dehydrate in 50% ethanol, 75% ethanol, 95% ethanol, 95% ethanol, and 100% ethanol for 3 minutes respectively, then use wax dewaxing and transparency liquid 1 and 2 for transparency for 10 minutes respectively, take out, wipe dry, and seal with neutral resin sealing agent.

[0095] (10) After the sealing agent is dried, the images are taken under a microscope. It was found that TCF19 is highly expressed in tumor tissues ( Figure 1 H) in the following statistical scoring ( Figure 3 B), and TCF19-related survival analysis was performed based on the score and tissue source patient information: patients with high TCF19 expression had a poor prognosis ( Figure 3 Middle C).

[0096] Example 2

[0097] Construction and expression verification of TCF19 overexpression and knockdown recombinant lentiviral vectors:

[0098] Construction of TCF19 overexpression recombinant lentiviral vector

[0099] (1) Design PCR primers: Find the TCF19 coding sequence on the National Center for Biotechnology Information website and select pLVX-EF1a-IRES-Puro as the vector, which was purchased from Takara Bio. Using Primer Premier 5 software, add the FLAG tag protein sequence to the primers based on the TCF19 sequence and the vector restriction sites to design appropriate PCR primers. The primer sequences are:

[0100] TCF19-EcoR I (SEQ ID NO. 12):

[0101] GGAATTCATGGGAGACTACAAGGACGATGATGACAAGATGCTGCCCTGCTTCCAAC

[0102] TCF19-Not 1 (SEQ ID NO. 13):

[0103] ATAAGAATGCGGCCGCTTAGGTCTGAATGCCAGCCC

[0104] (2) Amplification of TCF19 fragment: Using the cDNA obtained by reverse transcription of mRNA from lung adenocarcinoma cell line H1299 as a template, PCR amplification of TCF19 fragment was performed, and a 50 μL PCR reaction system was prepared. The system is as follows:

[0105]

[0106] PCR reaction, the procedure is as follows

[0107]

[0108] 35 cycles of steps 2-4

[0109] Continue extension: 72℃ for 10 min.

[0110] (3) Identification and gel recovery: The PCR product was subjected to agarose gel electrophoresis, and the target DNA band of 1 kb was cut out under ultraviolet light and gel recovery was performed using a gel recovery kit (TIANgel Company).

[0111] (4) Enzyme digestion and ligation: The PCR product recovered from the gel and the lentiviral vector pLVX-EF1a-IRES-Puro were double-digested at 37°C using restriction endonucleases EcoR I and Not I, respectively. The enzyme digestion system is as follows:

[0112] PCR product digestion system:

[0113] 1 μL each of EcoR I and Not I

[0114] O buffer 2μL (10x) 2μL

[0115] Gel recovery PCR product 16 μL

[0116] Lentiviral vector enzyme digestion system:

[0117]

[0118] The double enzyme digestion products were purified using a universal DNA purification kit (TIANgel Company) and the purified products were enzyme-linked.

[0119] Enzyme-linked system:

[0120]

[0121]

[0122] The enzyme was incubated for 16 h at a constant temperature of 16°C in a PCR instrument.

[0123] (5) Conversion

[0124] 1. Thaw the competent cells DH5a on ice.

[0125] 2. Add the above 20 μl ligation product into 30 μl competent cells and gently pipette to mix.

[0126] 3. Place on ice for 30 minutes.

[0127] Heat shock in a 42°C water bath for 90 seconds and place on ice for 5 minutes.

[0128] 5. Add 500 μl of LB liquid medium without antibiotics and culture at 37°C and 200 rpm for 60 min.

[0129] 6. Centrifuge at 3000 rpm for 5 minutes, leaving about 100 μl of liquid to mix the bacteria.

[0130] 7. Add the bacterial solution to the LB plate, spread it evenly with a sterile spreading rod, and invert and culture at 37℃ for 16 hours.

[0131] (6) Identification: After the plate is recovered, 50-100 colonies can be seen. Use a 10 μL pipette tip to pick up a single growing colony and put it into 10 μL sterile water. Gently pipette and use it as a PCR template for colony PCR identification.

[0132] The PCR system is:

[0133]

[0134] Agarose gel electrophoresis was performed and PCR-positive colonies were obtained after UV irradiation. 1 μL of the positive bacterial solution was added to 6 ml of liquid LB medium containing antibiotics and cultured at 37°C with shaking at 200 rpm for 16 hours. The plasmid was then extracted using a plasmid extraction kit (TIANgel) and identified by PCR.

[0135] The PCR system is:

[0136]

[0137] Agarose gel electrophoresis was performed and ultraviolet irradiation was performed to obtain a plasmid with a positive PCR result. The plasmid was sent to Qingke Biotechnology Company for sequencing. After the results were obtained, BLAST was performed on the National Center for Biotechnology Information website, and the pLVX-EF1a-IRES-Puro-TCF19 plasmid with no mutation in the target fragment and completely correct sequence was obtained.

[0138] TCF19 knockdown recombinant lentiviral vector acquisition: PLVX-shRNA2-TCF19 (constructed by Ubao Biotechnology Co., Ltd.), plasmid functional sequence:

[0139] shTCF19-sense (SEQ ID NO. 1):

[0140] CCGGCAAGGCCACACTGATCCTAAACTCGAGTTTAGGATCAGTGTGGCCTTGT TTTTG

[0141] shTCF19-antisense(SEQ ID NO.2):

[0142] AATTCAAAAACAAGGCCACACTGATCCTAAAACTCGAGTTTAGGATCAGTGTG

[0143] GCCTTG

[0144] Stable cell line construction:

[0145] (1) Cell preparation: 293T cells were cultured in a 10 cm cell culture dish using DMEM medium containing 10% fetal bovine serum and passaged once every 2-3 days.

[0146] (2) Cell plating: When the density of 293T cells reaches 90%, plating is performed. The specific steps are as follows: aspirate the culture medium, add 5 ml of PBS solution for washing, aspirate the PBS, add 1 ml of trypsin containing 0.02% EDTA, and allow to act for about 1 minute. Add DMEM medium containing 10% fetal bovine serum to terminate digestion, blow off the cells, collect them into a centrifuge tube, centrifuge at 1000 rpm for 3 minutes, aspirate the supernatant, and resuspend in culture medium for plating.

[0147] (3) Transfection: 12 h after plating, the cell density reached 60% and the culture medium was replaced with serum-free medium.

[0148] Prepare the transfection system:

[0149] 1. pLVX-EF1a-IRES-Puro-TCF19 transfection system:

[0150] 200 μL serum-free culture medium

[0151] 8 μg of pLVX-EF1a-IRES-Puro-TCF19 plasmid

[0152] VSVG packaging plasmid 6 μg

[0153] DR packaging plasmid 4 μg

[0154] Lipo 8000 transfection reagent 36 μL

[0155] 2.PLVX-shRNA2-TCF19 system:

[0156] 200 μL serum-free culture medium

[0157] PLVX-shRNA2-TCF19 plasmid 8 μg

[0158] VSVG packaging plasmid 6 μg

[0159] DR packaging plasmid 4 μg

[0160] Lipo 8000 transfection reagent 36 μL

[0161] Mix gently by pipetting and incubate for 20 minutes, then add dropwise to the 293T cell culture dish and place in a 37°C incubator.

[0162] (3) Lentiviral packaging: 8 h after transfection, the culture medium was replaced with DMEM medium containing 10% fetal bovine serum and culture was continued. During the period, attention was paid to adding culture medium so that the color of the culture medium in the culture dish did not turn yellow and the pH did not change significantly, which would affect the lentiviral packaging. 72 h after transfection, the culture supernatant was collected and filtered with a 4.5 μm diameter sterile filter to obtain the lentiviral supernatant containing pLVX-EF1a-IRES-Puro-TCF19 and PLVX-shRNA2-TCF19.

[0163] (4) Lentivirus infection and screening: Lung adenocarcinoma cells A549 and H1299 were cultured in 1640 medium containing 10% fetal bovine serum. The cells were purchased from the cell bank of the Chinese Academy of Sciences. When the cell density reached 90%, they were plated onto 6 cm cell culture dishes. 12 hours after plating, the cell density reached 60%, 3 ml of lentivirus suspension was added, and polybrene (final concentration of 10 μg / ml to enhance infection efficiency) was added. After 48 hours of infection, puromycin (final concentration of 1 μg / ml) was added for screening. Lung adenocarcinoma cells not infected with the lentivirus were killed. After 72 hours of screening, the surviving cells were infected with pLVX-EF1a-IRES-Puro-TCF19 and PLVX-shRNA2-TCF19 and stably transfected cell lines.

[0164] Western blotting of stable cell lines:

[0165] (1) Collect cells and extract proteins: Collect lung adenocarcinoma cells from a 6 cm cell culture dish, wash with pre-cooled PBS, centrifuge at 4000 rpm, discard the supernatant, retain the cell pellet, add 400 μL of RIPA cell lysis buffer and protease inhibitor PMSF (final concentration 1 mM, add immediately before use), lyse on ice for 30 min, centrifuge at 12000 rpm at 4°C for 10 min, take 350 μL of supernatant, add 70 μL of 6x protein loading buffer, mix thoroughly by pipetting, place in a 95°C metal bath for 15 min, and then store in a -80°C refrigerator after aliquoting to obtain denatured and stable cell protein samples.

[0166] (2) After protein extraction, WB detection (the specific steps have been described in detail above) showed that the expression of TCF19 protein in lung adenocarcinoma cells was significantly increased after pLVX-EF1a-IRES-Puro-TCF19 infection ( Figure 2 A and B in Figure 3); After infection with PLVX-shRNA2-TCF19, the expression of TCF19 protein in lung adenocarcinoma cells was significantly reduced ( Figure 2 C and D in the above example).

[0167] Example 3

[0168] Verification of the effect of TCF19 on proliferation ability in stably transfected cell lines

[0169] Cell proliferation assay:

[0170] (1) Cell preparation: H1299 cells overexpressing pLVX-EF1a-IRES-Puro-TCF19, PLVX-shRNA2-TCF19, and pLVX-EF1a-IRES-Puro that are in good growth condition and have a density of 80-90% were digested, resuspended, and counted.

[0171] (2) Calculation: Assuming 1000 cells per well of a 96-well plate, design three replicate wells for each experimental group and control group, and calculate the required cell volume.

[0172] (3) Prepare single-cell suspension: Pipette 10 ml of complete culture medium into a large dish, add the required amount of cells, and shake thoroughly.

[0173] (4) Plating: The obtained single-cell suspension was added to a 96-well plate, 200 μL per well, and 200 μL PBS was added to the peripheral wells of the experimental group and the control group as a blank group.

[0174] (5) Place the plated 96-well plate in a cell culture incubator at 5% CO2 and 37°C. After the cells adhere, discard the old culture medium and wash once with PBS. Add 180 μL of culture medium and 20 μL of CCK-8 reagent to each well and mix well. After incubation in the cell culture incubator for 3 hours, transfer 180 μL of cell supernatant to an enzyme label strip and measure the OD value at 450 nm using a microplate reader. The same method is used to detect the OD values ​​of the cells at 0h, 12h, 24h, 36h, 48h, and 72h of culture.

[0175] (6) Data were collected and statistically analyzed. It was found that after overexpression of TCF19, the proliferation of lung adenocarcinoma cells was accelerated, and after knockdown of TCF19, the proliferation of lung adenocarcinoma cells was inhibited ( Figure 4 A and B in ).

[0176] Cell cycle detection

[0177] (1) Cell treatment: 1. Cells were plated at a density of 35%. When the cell density reached about 80%, the culture medium was discarded, the cells were rinsed once with PBS, and trypsin was added for digestion. After complete digestion, the cells were stopped with complete culture medium, the cells were blown off, and the cells were centrifuged at 800 rpm for 3 min. The supernatant was discarded. 1 ml of PBS was added to resuspend and wash once, and the cells were centrifuged at 800 rpm for 3 min. The supernatant was discarded and the precipitate at the bottom of the tube was flicked off.

[0178] (2) Cell fixation: Take another 1.5 ml EP tube, add 700 μL of anhydrous ethanol, take 300 μL of PBS to resuspend the cells at the bottom of the tube, drop the cell suspension into the anhydrous ethanol, gently pipette to mix, and fix at 4°C or -20°C overnight. Centrifuge at 600g for 10 min in a pre-cooled centrifuge at 4°C, discard the supernatant, add 1 ml of cold PBS, resuspend the cells, centrifuge at 600g / 10 min, discard the supernatant, and gently flick the cells to prevent cell clumping.

[0179] (3) RNase digestion and PI staining: PI staining solution (50 μg / ml PI + 50 μg / ml RNAase) was added to the 500 μL system for staining. The cells were incubated at 37°C in the dark for 30 min. Mix once during the staining process. After staining, the cells were stored at 4°C or on ice in the dark.

[0180] (4) Flow cytometry analysis: Use a flow cytometer to detect red fluorescence PE channel at an excitation wavelength of 480 nm. Use a low speed to acquire cells. The low speed can ensure that the difference between cells is small and ensure higher accuracy. Use appropriate analysis software (such as Modifit software) to analyze the cell DNA content. The results showed that after overexpression of TCF19, the proliferation rate of lung adenocarcinoma cells was accelerated, and more cells entered the S phase from the G0 / G1 phase for DNA synthesis ( Figure 4 B) in.

[0181] Colony formation assay:

[0182] (1) Cell preparation: Digest, resuspend, and count the pLVX-EF1a-IRES-Puro-TCF19, PLVX-shRNA2-TCF19, and pLVX-EF1a-IRES-Puro cells that are in good growth condition and have a density of 80-90%.

[0183] (2) Calculation: Assuming 1000 cells per well of a 6-well plate, design three replicate wells for each experimental group and control group, and calculate the required cell quantity.

[0184] (3) Prepare single-cell suspension: Pipette 10 ml of complete culture medium into a large dish, add the required amount of cells, and shake thoroughly.

[0185] (4) Plating: Add the obtained single-cell suspension to a 6-well plate with 2 ml of culture medium per well.

[0186] (5) Place the 6-well plate after plating in a cell culture incubator at 5% CO2 and 37°C. Change the culture medium once every 2-3 days. Process after 10-14 days. Discard the culture medium, wash with PBS first, fix with 4% paraformaldehyde for 10 minutes, and then stain with 0.05% crystal violet for 30 minutes. After staining, recover the crystal violet, wash the six-well plate with ultrapure water 3-5 times, turn it upside down to dry, and then take images. The analysis results show that after overexpression of TCF19, the proliferation of lung adenocarcinoma cells is accelerated, and after knocking down TCF19, the proliferation rate of lung adenocarcinoma cells is inhibited ( Figure 4 C).

[0187] EDU detection of cell proliferation

[0188] (1) Preparation of slides: First, place the slides in a 24-well plate, add polylysine and treat for 10 minutes, then recover the polylysine, and place the 24-well plate in a sterile operating table with ventilation and UV treatment for 30 minutes for sterilization.

[0189] (2) Cell preparation: Wash the 24-well plate three times with PBS, and plate the cells at a density of 40%-80% so that the cells are evenly attached to the slide.

[0190] (3) EDU labeling: First, dilute the EDU stock solution with cell culture medium at a ratio of 1000:1 to prepare an appropriate amount of 10 μM EDU. Add 2 μl of 10 μM EDU to each well. After incubation for 2 h, discard the culture medium and wash the cells twice with PBS for 5 min each time.

[0191] (4) Cell fixation: Add 500 μL of 4% paraformaldehyde fixative to each well and fix at room temperature for 15 minutes. After discarding the fixative, add 1 ml of 3% BSA to each well and wash three times for 5 minutes each time. (3% BSA is prepared in PBS).

[0192] (5) Cell permeabilization: Add 1 ml of PBS containing 0.3% Triton X-100 to each well and incubate on a shaker at room temperature for 20 min. Discard the permeabilization solution and add 1 ml of 3% BSA to each well and wash three times for 5 min each time.

[0193] (6) Fluorescent labeling: Prepare the Click reaction solution based on the number of experimental samples, referring to the table below. (The reaction solution must be used within 15 minutes of preparation.)

[0194] Table 1 Click reaction solution preparation

[0195]

[0196]

[0197] Discard the supernatant, add 500 μL of Click reaction solution prepared according to the above table, and incubate in a shaker at room temperature in the dark for 30 minutes; discard the supernatant, add 1 ml of 3% BSA to each well and wash three times, each time for 5 minutes.

[0198] (7) DNA staining: Discard the supernatant and add 500 μL of DAPI working solution to each well. Incubate at room temperature in the dark for 20 min. Discard the supernatant and add 1 ml of 3% BSA to each well. Wash three times for 5 min each time.

[0199] (8) Image acquisition and analysis: Immediately after staining, images were acquired using a confocal fluorescence microscope. It was found that after overexpression of TCF19, the proliferation of lung adenocarcinoma cells was accelerated; after knockdown of TCF19, the proliferation of lung adenocarcinoma cells was inhibited ( Figure 4 D) in.

[0200] Nude mouse subcutaneous tumor bearing experiment to detect cell proliferation

[0201] (1) Experimental animals: Nude mice about 6 weeks old, weighing 15-18 grams, were selected.

[0202] (2) Cell preparation: Collect cells overexpressing pLVX-EF1a-IRES-Puro-TCF19 and pLVX-EF1a-IRES-Puro in the logarithmic growth phase, digest them with trypsin, and collect them into sterile centrifuge tubes. Centrifuge at 1000 rpm for 3 min, discard the supernatant, resuspend the cells in PBS, and centrifuge at 1000 rpm for 3 min. Discard the supernatant, resuspend the cells in an appropriate amount of PBS, adjust the cell concentration to the desired level, and place on ice until ready for use.

[0203] (3) Subcutaneous injection:

[0204] 1. Anesthesia: Anesthetize nude mice by intraperitoneal injection of 1% sodium pentobarbital.

[0205] 2. Disinfection: Disinfect the back or axillary area of ​​the nude mouse with a 75% ethanol cotton ball.

[0206] 3. Injection: 0.2 ml of cell suspension (2×10 6 The cells were injected subcutaneously into the axilla of nude mice. The needle was left for a few seconds after injection to prevent leakage of the cell suspension.

[0207] (4) Monitoring tumor growth: Observe 2-3 times a week and record the survival status and tumor growth of nude mice. When the tumor volume reaches 150-200 mm 3 The experiment can be ended when .

[0208] (5) End of experiment and sampling: When the tumor reached the predetermined size or the experimental period ended, the nude mice were killed by cervical dislocation. After removing the subcutaneous tumor tissue, the tissue was classified into groups and photographed. The results showed that overexpression of pLVX-EF1a-IRES-Puro-TCF19 could promote the proliferation of lung adenocarcinoma cells ( Figure 4 E).

[0209] After the tissue was embedded and sliced, the proliferation of tumor tissue was detected by immunohistochemistry (the specific steps have been described in detail above). It was found that overexpression of pLVX-EF1a-IRES-Puro-TCF19 significantly promoted the proliferation of lung adenocarcinoma cells ( Figure 4 F in.

[0210] Example 4

[0211] Searching for upstream regulatory factors of TCF19

[0212] RNA-SEQ omics analysis of TCF19 and BRD4 concluded that after overexpression of BRD4, the RNA level of TCF19 increased ( Figure 5 A).

[0213] RNA-SEQ omics analysis of TCF19 and JQ1 concluded that the RNA level of TCF19 decreased after JQ1 treatment ( Figure 5 B) in.

[0214] The function of BET proteins (BRD2, BRD3, and BRD4) was inhibited by JQ1, and cell proteins were extracted. The TCF19 protein level was verified by western blotting.

[0215] (1) Cell plating: Lung adenocarcinoma cell lines A549 and H1299 were passaged and then plated on six-well plates and cultured in a cell culture incubator at 5% CO2 and 37°C for 12 h.

[0216] (2) Inhibition of BET protein function: 12 hours after cell plating, the culture medium was replaced with 1640 culture medium containing 0.5% fetal bovine serum for 24 hours of starvation treatment. Then, the BET protein inhibitor JQ1 was added and treated with a time gradient (0h, 12h, 24h, 48h) and concentration gradient (0uM, 0.01uM, 0.1uM, 1uM).

[0217] (3) Cell proteins were extracted and subjected to western blot analysis (the specific experimental process has been described in detail above). The results showed that the protein level of TCF19 decreased significantly with the increase of the time and concentration of JQ1 stimulation ( Figure 5 C and D in the above example).

[0218] By knocking down the expression of specific BET proteins (BRD2, BRD3, and BRD4), cellular proteins and RNA were extracted, and TCF19 protein and mRNA levels were verified by protein immunoblotting and quantitative PCR (Q-PCR) experiments.

[0219] (1) Cell plating: Lung adenocarcinoma cell lines A549 and H1299 were passaged and then plated on six-well plates and cultured in a cell culture incubator at 5% CO2 and 37°C for 12 h.

[0220] (2) Plasmid transfection: 12 h after cell plating, the density was 40%, and the old culture medium was discarded and replaced with serum-free culture medium.

[0221] BRD2, BRD3, and BRD4 shRNA plasmids were purchased from Qingke Biotechnology.

[0222] The functional sequence of the plasmid is:

[0223] BRD2-shRNA (SEQ ID NO.14):

[0224] CCGGGCTGCTGATGTACGGCTTATGCTCGAGCATAAGCCGTACATCAGCAGCT TTTTT

[0225] BRD3-shRNA (SEQ ID NO.15):

[0226] CCGGGGGAGATGCTATCCAAGAAGCCTCGAGGCTTCTTGGATAGCATCTCCCT TTTTT

[0227] BRD4-shRNA (SEQ ID NO. 3):

[0228] CCGGCAGAGTGATCTATTGTCAATACTCGAGTATTGACAATAGATCACTCTGT TTTTT.

[0229] Prepare the transfection system:

[0230] ShRNA plasmid: 2 μg

[0231] Lopo8000 transfection reagent: 4 μL

[0232] Serum-free medium: 100 μL.

[0233] (The specific transfection steps have been described in detail before)

[0234] 48 hours after transfection, cell RNA was extracted and quantitative PCR (Q-PCR) experiments were performed (the specific experimental steps have been described in detail before)

[0235] Primer sequences:

[0236] GAPDH-QPCR-F: CATGTTCGTCATGGGTGTGAACCA (SEQ ID NO.16)

[0237] GAPDH-QPCR-R: ATGGCATGGACTGTGGTCATGAGT (SEQ ID NO.17)

[0238] TCF19-QPCR-F: GGGCGGTGATCTCTACAC (SEQ ID NO.18)

[0239] TCF19-QPCR-R: GGGAGTCGGACATTATTGACCA (SEQ ID NO.19)

[0240] BRD2-QPCR-F: GAGGTGTCCAATCCCAAAAAGC (SEQ ID NO.20)

[0241] BRD2-QPCR-R: ATGCGAACTGATGTTTCCACA (SEQ ID NO. 21)

[0242] BRD3-QPCR-F: TCAAATTGAACCTGCCGGATT (SEQ ID NO.22)

[0243] BRD3-QPCR-R: TGCATACATTCGCTTGCACTC (SEQ ID NO. 23)

[0244] BRD4-QPCR-F: GAGCTACCCACAGAAGAAACC (SEQ ID NO. 24)

[0245] BRD4-QPCR-R:GAGTCGATGCTTGAGTTGTGTT (SEQ ID NO.25)

[0246] The results showed that BRD2, BRD3, and BRD4 were successfully knocked down. Figure 5 E, F, G in it).

[0247] After knocking down BRD4, the mRNA level of TCF19 was significantly reduced, suggesting that the upstream protein member of the BET protein family that mainly regulates TCF19 is BRD4 ( Figure 5 J in

[0248] 72 hours after transfection, cell proteins were extracted and western blotted (specific experimental steps have been described in detail above). The results showed that after knocking down BRD4, the protein level of TCF19 was significantly reduced, suggesting that the upstream protein member of the BET protein family that mainly regulates TCF19 is BRD4 ( Figure 5 H, I, L in ).

[0249] Cell proteins were extracted by overexpressing BRD4, and TCF19 protein levels were verified by western blotting.

[0250] (1) Cell plating: Lung adenocarcinoma cell lines A549 and H1299 were passaged and then plated on six-well plates and cultured in a cell culture incubator at 5% CO2 and 37°C for 12 h.

[0251] (2) Plasmid transfection: 12 hours after cell plating, the cells were plated at a density of 40%. The old culture medium was discarded and replaced with serum-free culture medium. 2 μg of ov-flag-BRD4 plasmid purchased from Qingke Bio was transfected. Cell protein was harvested 48 hours after transfection and analyzed by western blotting. The results showed that the protein level of TCF19 was significantly increased after overexpression of BRD4.

[0252] By overexpressing the two leads of BRD4, BD1 and BD2, the functions of the two leads of BRD4 are competitively inhibited.

[0253] (1) Construction of GFP-tagged BD1 and BD2 overexpression plasmids on pcDNA3.0 (the specific construction steps have been described in detail above)

[0254] Primer sequences:

[0255] BRD4-BD1-BamHI-F: CGGGATCCAGGCAGACCAACCAACTGC (SEQ ID NO. 26)

[0256] BRD4-BD1-xbal-R: GCTCTAGATTGCAAGAAGAGCTTTCCAG (SEQ ID NO. 27)

[0257] BRD4-BD2-BamHI-F: CGGGATCCAAGGTCTCGGAGCAGCTCAAG (SEQ ID NO. 28)

[0258] BRD4-BD2-xbaI-R: GCTCTAGAAGGCTCGTCCGGCATCTTG (SEQ ID NO. 29)

[0259] After successful construction, the plasmid was amplified.

[0260] (2) Transfect 3 μg of each plasmid (the specific experimental steps have been described in detail before).

[0261] (3) 24-48 hours after transfection, cell proteins were extracted and western blot analysis was performed (the specific experimental steps have been described in detail above). The results showed that after overexpression of BRD4-BD1, the protein level of TCF19 was significantly reduced, suggesting that the two leads in BRD4 that regulate TCF19 are BRD4-BD1 ( Figure 5 K in ).

[0262] Immunohistochemical staining of BRD4 and TCF19 was performed on clinical pathological tissues (the specific steps have been described in detail above): BRD4 and TCF19 have consistent expression, that is, TCF19 is also highly expressed in cancer tissues and adjacent tissues with high BRD4 expression, and there is a clear correlation between the two ( Figure 5 L in the .

[0263] Chromatin immunoprecipitation experiments further verified that BRD4 binds to the promoter of the TCF19 gene and regulates the transcription of TCF19:

[0264] (1) Cross-linking and cell harvesting

[0265] 1. Cells were passaged and plated onto 10 cm culture dishes. The cells were divided into untreated, BRD4-overexpressing, and JQ1-overexpressing groups for treatment. Once the cells were confluent, 37% formaldehyde solution was added to the culture medium to a final concentration of 1%, depending on the volume of the culture medium. The cells were shaken gently on a shaker at room temperature for 10 minutes to crosslink DNA and proteins. (A 1% formaldehyde solution can be prepared in PBS).

[0266] 2. Add 1.25 M glycine according to the volume of culture medium to a final concentration of 125 mM. Shake slowly on a shaker at room temperature for 5 minutes to terminate the cross-linking reaction.

[0267] 3. Wash the cells twice with 10 ml of pre-chilled PBS.

[0268] 4. Add 1 ml of solution A, scrape the cells, and collect them in a 1.5 ml centrifuge tube. Centrifuge at 4000 rpm and 4°C for 5 min. Discard the supernatant and retain the pellet.

[0269] (2) Ultrasonic fragmentation

[0270] 1. Add 600 μL of solution C (add protease inhibitors immediately before use), resuspend the cells, and vortex to lyse the cells. B. After sonication, run a DNA gel to determine fragment size (a DNA gel concentration of approximately 1.5% is appropriate). Fragments between 200 and 1000 bp are ideal.

[0271] 2. Centrifuge at 12000 rpm, 4°C for 15 min. Collect the supernatant and discard the precipitate.

[0272] (3) Preclear samples

[0273] 1. Add 50 μL of protein A / G beads and protamine (final concentration 200 μg / ml. Stock solution 10 mg / ml, prepared in ddH2O) to 400-500 μL of supernatant and incubate at 4°C with rotation for 2 h.

[0274] 2. Centrifuge at 12000 rpm, 4°C for 15 min. Collect the supernatant and discard the precipitate.

[0275] 3. Take 20 μL of the supernatant as input.

[0276] (4) Combination

[0277] 1. Take 200 μL of supernatant and add 4 μL of primary antibody, 8 μL of protein A / G beads, protamine (final concentration 200 μg / ml), and BSA (final concentration 1 mg / ml). Bring the total volume to 300 μL with Chip1 solution. Incubate with rotation at 4°C overnight or for 4-6 hours. Freeze the remaining supernatant at -80°C until needed.

[0278] (5) Cleaning

[0279] Centrifuge at 3000 rpm for 1 min at 1.4°C to pellet the beads and discard the supernatant.

[0280] 2. Wash the beads with 400 μL each of Chip1 solution, Chip2 solution, Chip3 solution, and TE solution. When washing, add DTT (final concentration is 1 mM) to these four solutions.

[0281] (6) Proteinase K digestion

[0282] 1. Add 100 μl of elution buffer (0.5% SDS, 0.1 M NaHCO3, and 5 μg Proteinase K). This and subsequent treatments should also be performed on the input sample. The elution buffer should be prepared immediately before use.

[0283] Shake at 2.65°C on a molecular hybridization instrument overnight or for 6 hours.

[0284] (7) DNA purification, precipitation and dissolution

[0285] 1. Add 300 μL of phenol-chloroform to each tube and shake vigorously until a white milky substance appears. Centrifuge at 8000 rpm, 4°C for 3 minutes, remove the supernatant, and discard the beads. Repeat the extraction 2-3 times until no white milky substance appears and the supernatant is clear.

[0286] 2. Take the supernatant, add 100 μL of chloroform, shake vigorously, centrifuge at 8000 rpm, 4°C for 3 min, and take the supernatant.

[0287] 3. Add 300 μL (3 times the volume) of anhydrous ethanol, 10 μL (1 / 10 volume) of 3M NaOAc, and 0.3 μL (1 / 100 volume) of glycogen (20 mg / ml), and precipitate at -20°C for 30 min.

[0288] 4. Centrifuge at 12000 rpm for 10 min at room temperature.

[0289] 5. Discard the supernatant and wash the pellet once with 70% ethanol.

[0290] 6. Centrifuge at 12,000 rpm for 10 minutes at room temperature. Drain as much ethanol as possible and let the precipitate air dry.

[0291] 7. Add 40 μL TE to dissolve the DNA. The input group can be dissolved in 60-80 μL TE.

[0292] (8) PCR reaction: The results of Chip can be reflected by Q-PCR experiment, or by ordinary PCR and then running DNA gel. Then perform fluorescence quantitative PCR (Q-PCR) experiment. Q-PCR primer sequence:

[0293] TCF19-chip-F (SEQ ID NO.30): TGTGAACTAATCAGAAAAAGTGG

[0294] TCF19-chip-R(SEQ ID NO.31):GTTTGACAGCCAAGAAGCC

[0295] The Q-PCR primer sequence binds to the promoter sequence of TCF19. The results suggest that BRD4 binds to the promoter of the TCF19 gene and regulates the transcription of TCF19 ( Figure 5 M in ).

[0296] Example 5

[0297] Searching for downstream regulatory factors of TCF19

[0298] RNA-SEQ genomic analysis of CyclinD2 and TCF19 concluded that after overexpression of TCF19, the RNA level of CyclinD2 increased. At the same time, the RNA expression levels of 20 cell cycle-related genes were found to have changed. Correlation analysis revealed that the expression of CyclinD2 was more correlated with that of TCF19. Figure 6 A, B, C, D)

[0299] After overexpression of TCF19 and knockdown of TCF19, protein immunoblotting experiments (the specific steps have been described in detail before) showed that the protein level of CyclinD2 was significantly increased and decreased after overexpression and knockdown of TCF19 ( Figure 7 A and B in

[0300] After overexpression of OV-Flag-TCF19, cell immunofluorescence analysis was performed

[0301] (1) Preparation of slides: First, place the slides in a 24-well plate, add polylysine and treat for 10 minutes, then recover the polylysine, and place the 24-well plate in a sterile operating table with ventilation and UV treatment for 30 minutes for sterilization.

[0302] (2) Cell preparation: Wash a 24-well plate three times with PBS, and plate the cells at a density of 40%-80% to ensure that the cells are evenly attached to the slide.

[0303] (3) Fixation: Aspirate the culture medium and wash 1-2 times with PBS. Be careful not to wash off the cells.

[0304] Pipette 500 μL of 4% paraformaldehyde to fix the cells for 15 minutes, discard the paraformaldehyde, add 500 μL of PBS and shake slowly on a shaker for 5 minutes to wash, for a total of 3 times.

[0305] (4) Penetration: Add 500 μL of 1% Triton X-100 in PBS and perforate for 15 minutes. Aspirate and discard the perforation solution, add 500 μL of PBS and shake slowly on a shaker for 5 minutes to wash, for a total of 3 times.

[0306] (5) Add 2% BSA and incubate on a shaker at room temperature for 30 minutes to block nonspecific proteins.

[0307] (6) Discard BSA, add primary antibody (TCF19, CyclinD2 diluted at a ratio of 1:100), and incubate on a shaker at 4°C for 16 h

[0308] (7) Recover the primary antibody, wash with PBS 2-3 times, add fluorescent secondary antibody with the corresponding excitation wavelength, and dilute the secondary antibody with PBS according to the instructions. Incubate at 4°C in the dark for 2 h.

[0309] (8) Add 500 μL PBS and shake slowly for 5 min to wash, for a total of 3 times.

[0310] (9) Add DAPI stain and incubate on a shaker at room temperature for 20 min. After incubation, wash with PBS on a shaker for 5 min, three times.

[0311] (10) The slides were transferred to glass slides, fixed with neutral resin, and photographed under a laser confocal fluorescence microscope for analysis. The results showed that when TCF19 was overexpressed, the protein level of CyclinD2 was also significantly increased ( Figure 7 C).

[0312] Immunohistochemical staining of TCF19 and CyclinD2 was performed on a mouse lung cancer model (the specific steps have been described in detail before): TCF19 and CyclinD2 are highly expressed in tumor tissues ( Figure 7 D)

[0313] Immunohistochemical staining of TCF19 and CyclinD2 was performed on a subcutaneous tumor-bearing mouse model (the specific steps have been described in detail above): After overexpression of TCF19, the protein level of CyclinD2 was also significantly increased. Figure 7 E)

[0314] Western blotting and quantitative PCR (Q-PCR) experiments were performed on subcutaneous tumor-bearing mouse models.

[0315] QPCR primers:

[0316] CyclinD2-QPCR-F (SEQ ID NO.32): TGCATGTTCCTAGCTTCC

[0317] CyclinD2-QPCR-R(SEQ ID NO.33):CTCTTGACGGAACTGCTG

[0318] (The specific steps have been described in detail before): It can be found that after overexpression of TCF19, the protein level and mRNA expression level of CyclinD2 also increased significantly. ( Figure 7 F and G in

[0319] Chromatin immunoprecipitation experiments further verified that TCF19 binds to the promoter of the CyclinD2 gene and regulates the transcription of CyclinD2.

[0320] The cells were divided into untreated group, TCF19 overexpression group and TCF19 knockdown group for treatment. Q-PCR primer sequences:

[0321] CyclinD2-chip-F(SEQ ID NO.34):GGATCGTGTTTGAAGTTTGGTC

[0322] CyclinD2-chip-R(SEQ ID NO.35):CCTTTTGGCTGAATGGGAGA

[0323] (The specific steps have been described in detail before): Q-PCR primer sequence binds to the promoter sequence of CyclinD2. The results suggest that TCF19 binds to the promoter of CyclinD2 gene and regulates the transcription of CyclinD2 ( Figure 7 H in.

[0324] Example 6

[0325] It is clear that the BRD4-TCF19-CyclinD2 pathway exists in lung adenocarcinoma.

[0326] After JQ1 stimulation, BRD4 overexpression, BRD4 knockdown, and Western blotting and quantitative PCR (Q-PCR) experiments (the specific steps have been described in detail above), the protein and mRNA expression levels of TCF19 and CyclinD2 increased and decreased accordingly ( Figure 8 A, B, C, D, E, F).

[0327] After overexpression of BRD4 and knockdown of TCF19, it was clearly seen through Western blotting experiments and Q-PCR (the specific steps have been described in detail above) that the protein and mRNA levels of TCF19 and CyclinD2 increased and decreased accordingly ( Figure 8 G and H in the figure), combined with the above, it can be concluded that BRD4 regulates the mRNA transcription of CyclinD2 by regulating the expression of TCF19, thereby affecting its expression.

[0328] Example 7

[0329] 5-Fluorouracil can regulate chemotherapy resistance in lung adenocarcinoma by inhibiting BRD4 and affecting the expression of TCF19 and CyclinD2.

[0330] Lung adenocarcinoma cell A549 can inhibit the expression of TCF19 after adding the anticancer drug 5-fluorouracil: 12 hours after plating, the culture medium was replaced with 1640 culture medium containing 0.5% fetal bovine serum and starved for 12 hours. After adding the anticancer drug 5-fluorouracil, the cells were treated with a time gradient (0h, 12h, 24h, 48h) and a concentration gradient (0μM, 0.05μM, 0.5μM, 5μM). Cell proteins were extracted for protein immunoblotting and Q-PCR (the specific experimental process has been described in detail above). The results showed that with the increase in the time and concentration of 5-fluorouracil stimulation, the protein and mRNA expression levels of TCF19 decreased significantly ( Figure 9 A, B, C, D in the above figure).

[0331] After the addition of the anticancer drug 5-fluorouracil, the protein and mRNA expression levels of BRD4, TCF19, and CyclinD2 in lung adenocarcinoma cell A549 were significantly reduced: 12 hours after plating, the culture medium was replaced with 1640 culture medium containing 0.5% fetal bovine serum and starved for 12 hours. After the addition of the anticancer drug 5-fluorouracil (final concentration of 5 μM), the cells were stimulated for 48 hours, and cell proteins were extracted for protein immunoblotting and Q-PCR (the specific steps have been described in detail above). The protein and mRNA expression levels of BRD4, TCF19, and CyclinD2 were significantly reduced ( Figure 9 E and F). After knocking down TCF19, adding 5-fluorouracil, the cell survival rate was lower than that of the control group cells ( Figure 9 G in ).

[0332] The above examples demonstrate that knocking down TCF19 can inhibit lung adenocarcinoma cell proliferation and enhance the chemotherapeutic efficacy of 5-fluorouracil. Furthermore, it was discovered that BRD4 is an upstream regulator of TCF19 expression in lung adenocarcinoma. Knocking down BRD4 significantly reduces both TCF19 mRNA and protein levels. This suggests that TCF19 could serve as a therapeutic target for lung adenocarcinoma, demonstrating its promising application and medical value.

[0333] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. Use of a reagent for detecting TCF19 in the preparation of a reagent for assisting the diagnosis of lung adenocarcinoma, characterized in that: The TCF19 is significantly overexpressed in lung adenocarcinoma tissues.

2. Use of substances that inhibit TCF19 in the preparation of drugs for the treatment of lung adenocarcinoma.

3. The use according to claim 2, characterized in that The substance that inhibits TCF19 includes a BET family inhibitor.

4. The use according to claim 3, characterized in that The BET family inhibitors include JQ1.

5. The use according to claim 2, characterized in that The substance that inhibits TCF19 includes TCF19 shRNA.

6. The use according to claim 5, characterized in that The sense strand of the shRNA is shown in SEQ ID NO.1, and the antisense strand of the shRNA is shown in SEQ ID NO.

2.

7. The use according to claim 2, characterized in that The substance that inhibits TCF19 includes shRNA of BRD4, and the sequence of the shRNA of BRD4 is shown in SEQ ID NO.

3.

8. The use according to claim 7, characterized in that The substance that inhibits TCF19 includes an agent that overexpresses BRD4-BD1.

9. Use of a substance that inhibits TCF19 in the preparation of an agent for inhibiting the proliferation of lung adenocarcinoma cells, characterized in that: The lung adenocarcinoma cells include lung adenocarcinoma cell lines A549 or H1299.

10. Use of substances that inhibit TCF19 in the preparation of 5-fluorouracil chemotherapy sensitizers.

Images