Application of SNP molecular marker related to pig gestation period character

Abstract

The application belongs to the field of pig marker-assisted selection technology, and particularly relates to application of a SNP molecular marker related to a pig gestation period trait. The SNP molecular marker is at a base at a 32922080 locus of a first chromosome in a pig genome Sscrofa11.1.109. The SNP locus of the molecular marker has C / G polymorphism, wherein C is a favorable allelic variation of the pig gestation period trait. The superior allele of the SNP can increase the frequency of the superior allele generation by generation, shorten the gestation period of the pig, and accelerate the genetic improvement progress of the pig, thereby effectively reducing the cost of breeding of a breeding pig.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of pig molecular marker assisted selection, in particular to an application of a SNP molecular marker related to a pig gestation period trait. BACKGROUND

[0002] At present, the global pork industry is facing the dual challenges of increasing market demand and improving breeding efficiency. In large-scale pig breeding, the length of the gestation period of sows affects the annual number of litters, etc. A natural gestation period that is too long in pigs limits the annual reproductive potential of sows and increases the cost of feed, labor, and pen management, and the extended empty period (non-pregnancy period) further reduces the turnover efficiency of the farm.

[0003] Traditional breeding methods rely on phenotypic selection (such as estrus cycle, lactation ability, etc.), which is difficult to accurately locate the genetic factors related to gestation period regulation, resulting in low breeding efficiency. Some farms, in order to improve the frequency of reproduction, shorten the gestation period of sows by artificial intervention (such as hormone-induced ovulation), but often cause fetal development abnormalities, decreased postpartum recovery ability of sows, and even lead to intergenerational decline in reproductive performance.

[0004] In recent years, genomics technology has developed rapidly, making it possible to explore the core genes and molecular mechanisms of gestation period regulation. Molecular marker assisted breeding is a method that uses the characteristics of close linkage between molecular markers and target trait genes. By detecting molecular markers, the presence of the target gene can be detected, achieving the purpose of selecting target traits, and having the advantages of being fast, accurate, and not affected by environmental conditions. Single nucleotide polymorphism (SNP) is a type of molecular marker, which refers to the change in DNA sequence caused by the variation of a single nucleotide at the same position in the genome of individuals. It can subsequently affect gene expression, transcription activity, and splicing modification, etc. The pig reproductive gestation period is long, and screening of genes and SNP genetic markers related to gestation period traits, combined with marker assisted breeding methods, can accelerate the breeding and breeding process of pigs. SUMMARY

[0005] The purpose of the present application is to provide a SNP molecular marker related to the gestation period of pigs, which provides guidance for the detection of gestation performance or molecular marker assisted breeding in pig reproduction.

[0006] The technical solution of the present application is as follows:

[0007] The present application provides a pig SNP molecular marker, which is at the base of the 32922080th position of chromosome 1 in the pig genome Sscrofa11.1.109. The SNP site of the molecular marker has C / G polymorphism, wherein C is the favorable allele variation of early gestation period in pigs.

[0008] The porcine SNP molecular marker and the substance for detecting the porcine SNP molecular marker may be used in any of the following ways:

[0009] Used for detecting or assisting in the detection of traits during pig pregnancy;

[0010] Genetic breeding for shortening the gestation period in pigs;

[0011] Preferably, the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1.

[0012] In this invention, the substance for detecting porcine SNP molecular markers includes PCR primers for amplifying genomic DNA fragments, including the SNP sites, or a kit containing the primers.

[0013] Preferably, the nucleotide sequences of the primers are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0014] Preferably, the kit also includes PCR amplification reagents.

[0015] The present invention also provides a method for detecting gestational traits in pigs, comprising: detecting the base type at locus 32922080 on chromosome 1 of the pig genome, and finding that the gestational traits of GC and GG genotype populations are longer than those of CC genotype populations.

[0016] Preferably, the method for detecting the base type at position 32922080 on chromosome 1 of the pig genome includes: designing primers to amplify the nucleotide sequence shown in SEQ ID NO.1, using the primers to perform PCR amplification on pig genomic DNA, and detecting the genotype at position 368 in the gene sequence of the amplified product.

[0017] Further optimization was performed using Sanger sequencing to obtain the genotype of the 1:32922080C>G locus.

[0018] This invention also provides a genetic breeding method for shortening the gestation period trait in pigs, comprising: determining the base type at locus 32922080 on chromosome 1 of breeding pigs in the core pig population, and making corresponding selections based on the base type:

[0019] In the breeding of pigs, individuals with the CC and CG bases at the 32922080 locus on chromosome 1 are selected, while individuals with the GG base are eliminated, in order to increase the frequency of the C gene at this locus in each generation, thereby shortening the gestation period of offspring pigs.

[0020] Preferably, the base at position 32922080 of the pig chromosome 1 is as shown at position 368bp in the sequence shown in SEQ ID NO.1.

[0021] Advantages of the present application:

[0022] The present application studies and determines the SNP molecular marker affecting the pig gestation period, and early molecular marker assisted selection is carried out using the molecular marker, so that the pig breeding process can be accelerated.

[0023] The present application predicts the pig gestation period by detecting the base type of the molecular marker SNP site, and the CG genotype and GG genotype population gestation period is longer than the CC genotype population. The application of the primer set for amplifying the molecular marker affecting the pig gestation period, through the molecular marker and the primer set, establishes a high-efficiency and accurate pig molecular marker assisted breeding technology, which is applied to pig breeding, can screen piglets with early gestation period, and eliminate inferior piglets in time, so as to shorten the pig gestation period and improve the breeding efficiency of the pig farm. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 It is a Manhattan plot (left) and a QQ plot (right) for pig gestation period GWAS.

[0025] Figure 2 It is a correlation analysis result graph of different genotypes of the SNP molecular marker and the gestation period.

[0026] Figure 3 It is a sanger sequencing result of 1:32922080C>G site. DETAILED DESCRIPTION

[0027] The present application obtains all high-quality SNPs on the genome by whole genome resequencing of pig genomic DNA, aligning the resequencing data with the pig reference genome (Sscrofa11.1.109), and obtaining a molecular marker related to the pig gestation period by analyzing the correlation between each site and the pig gestation period. The SNP molecular marker is located at the base of the 32922080 site of the first chromosome in the pig genome Sscrofa11.1.109, and the SNP site of the molecular marker has C / G polymorphism, wherein C is the advantageous allelic variation of the pig gestation period.

[0028] The nucleotide sequence of the SNP molecular marker of the present application is shown in SEQ ID NO:1:

[0029] GATGGAATTCACCAACCAAAAGCCCAGTCACATTTGGTCTTAATCCTCCAGAGTAAAGCATAATACAGAGATCAGAGAAGAAGACTAGGACAAGGTCCTGGACAGACTCTTATGCTATGCTATGGAGAAGAGCCTTTGATTTGCAAGTAATTGGAGGGGTTTTAGTTCAAATTGGGGTTTTAGCTGGATTTCTGGTTGCAAAAAAATAAGGCTGGAGACAGTTGTCAAAGGTCAAGGATGGGTCTGATCTATGAGAATGAGGGTGGAAATTAGCAAAAAGTTATATGTTCCGGAAGTATCTAGATGTAAATCTAGAAAGTAAAATTGCTAAGAATTGGATGCTGAGGGTTAGGGAAAAGGAAAGGGACTGCCCTTAGGTAATTTCTAAGCTTCTGTCTAGAAGAAGGTAACTGAGAGAATGATGGTGGAACTGAGACAGGAAATAGAGGAAGTAAGCAGGTCTTGGAGGAGCTAGGGAGGAAATGAGAGCTTCCGTTTAGACAAAGAGCCCATTTACTTGATATTTATGGGAGAAATACAAATCAGTGTGTGTAGGTGTGCGTGTGTCA (SEQ ID NO. 1).

[0030] 1:32922080C>G site is located at the 368th position from the 5' end of the sequence SEQ ID NO. 1, the C / G polymorphism of the site is significantly related to the pregnancy period of pigs, the pregnancy period of the CC genotype individual is significantly lower than that of the GC genotype (P<0.05), the pregnancy period of the GC genotype individual is extremely significantly lower than that of the GG genotype (P<0.01), and the pregnancy period of the CC genotype individual is extremely significantly lower than that of the GG genotype (P<0.001).

[0031] The application provides a substance for detecting the pig SNP molecular marker, including a PCR primer for amplifying a genomic DNA fragment of the molecular marker SNP site, or a kit containing the primer. The primer for amplifying the SNP molecular marker of the application includes an upstream primer F: 5'-GATGGAATTCACCAACCAAAAGCCC-3' (SEQ ID NO. 2) and a downstream primer R: 5'-TGACACACGCACACCTACACACACT-3' (SEQ ID NO. 3). The kit further includes a PCR amplification reagent.

[0032] In the present application, the PCR amplification reagent is preferably 2x Taq Master Mix (Dye), which is prepared by mixing Taq DNA polymerase, dNTP mixture, MgCl2 and reaction buffer in advance to obtain a mixture with a concentration of 2 times, and then optimizing the ratio to obtain a mixture with a concentration of 2 times. The amplification efficiency is good, and the detection sensitivity is high.

[0033] The pig genomic DNA is subjected to PCR amplification using the primer set described above. As an embodiment, the PCR amplification procedure is as follows: pre-denaturation at 94℃ for 1 min, denaturation at 98℃ for 10 s, annealing at 63℃ for 15 s, extension at 72℃ for 45 s, 34 cycles, and finally extension at 72℃ for 5 min. The obtained amplification product is sequenced to detect the genotype of the 1:32922080C>G site.

[0034] The standard for judging the quality of the pregnancy period of the pig is as follows:

[0035] If the genotype of the 1:32922080C>G site is GG, the pregnancy period of the pig is long.

[0036] If the genotype of the 1:32922080C>G site is GC, the pregnancy period of the pig is medium.

[0037] If the genotype of the 1:32922080C>G site is CC, the pregnancy period of the pig is short.

[0038] The sequencing method is not particularly limited in the present application, and a known sequencing method in the art can be used. In the embodiments of the present application, Sanger sequencing is used to determine the DNA sequence obtained by amplification. As an embodiment, the DNA sequence is sequenced by Oko (Wuhan) Biotechnology Co., Ltd., and the forward and reverse reactions of the gene fragment are performed. According to the type of the base at the 368th position from the 5' end in the measured sequence, the quality of the pregnancy period of the pig is judged, so that the detection of the pregnancy period of the pig and the genetic breeding of the pregnancy period of the pig can be performed.

[0039] The SNP molecular marker of the present application can be applied to the association analysis of the pig pregnancy period related genotype or the pig pregnancy period related trait, and provides a new molecular marker resource for the molecular marker assisted selection of pig reproductive performance.

[0040] The technical solutions of the present application will be described in more detail below in combination with the embodiments and the drawings. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by a person of ordinary skill in the art without creative labor fall within the scope of protection of the present application.

[0041] The reagent consumables used in the application are ordinary market products and can be obtained by market purchase.

[0042] The following takes Eqing black pigs as an example to illustrate the technical solutions of the application, but is not a limitation of the technical solutions of the application. Those skilled in the art can apply the technical solutions of the application to other pig breeds to detect and optimize breeding of the gestation period traits of pigs, which also belongs to the protection scope of the application.

[0043] Example 1

[0044] Screening of molecular markers related to the gestation period of pigs

[0045] (1) Data collection of reproductive traits of Eqing black pigs

[0046] 244 Eqing black pigs, all female, from Qingping Pig Farm in Dangyang City, Hubei Province, were selected to collect their gestation period data.

[0047] (2) Sample collection and genomic DNA extraction of Eqing black pigs

[0048] The ear tissue or tail tissue of the above-mentioned Eqing black sow was collected using ear pliers and placed in a 1.5 mL centrifuge tube containing 75% alcohol and stored at -20℃. The universal column type genomic extraction kit of Kangwei Century was used to extract the sample genomic DNA according to the manufacturer's instructions. After passing the quality inspection, it was stored in the -20℃ refrigerator.

[0049] (3) Whole genome resequencing and SNP detection quality control

[0050] The qualified samples were taken to construct the sequencing library using YZSeq Tn5 Library Prep Kit. After the library construction, the library quality inspection was performed, and after passing the quality inspection, the sequencing was performed on the DNBSEQ-T7B platform to obtain the original down-machine data RawReads, and the results were stored in the fastq file format.

[0051] The raw data was filtered using fastp software: removing adaptor sequences; removing reads with a proportion of N bases of more than 3%; removing reads with a length of less than 30 bases; removing reads with a proportion of low-quality (quality value less than 15) bases of more than 40%. Finally, the effective data (clean data) that can meet the requirements of data analysis was obtained.

[0052] The clean reads were aligned to the pig reference genome (Sscrofa11.1.109) using BWA software, and the alignment results were output in sam format. The sam file was compressed, sorted and duplicate reads were removed using Sambamba software. For the sorted and de-duplicated bam file, Sentieon software was used to detect SNP sites.

[0053] The SNP was filtered using BCFtools software, and the filtering parameters were QUAL < 30.0 || QD < 2.0 || FS > 60.0 || MQ < 40.0 || SOR > 4.0 || ReadPosRankSum < -8.0. Then VCFtools was used for quality control: remove variants with a deletion rate higher than 0.5; remove variants with a sequencing depth less than 3 and greater than 100; retain variants with an allele number of 2. Then Plink 2.0 was used to perform more stringent quality control on the result file output by VCFtools, and the quality control conditions were: retaining autosomal variants; filtering out variants with a minimum allele frequency less than 5%; filtering out variants with a deletion rate higher than 10%; filtering out variants that do not meet Hardy-Weinberg equilibrium. Finally, 13899481 high-quality SNPs were obtained for subsequent analysis.

[0054] (4) GWAS analysis

[0055] The MLM model of rMVP software was used to perform GWAS analysis on the gestation period (GP) traits of Eqing black pigs, and Manhattan plots and QQ plots were generated. Figure 1 ). Taking P = 2.48e-06 as the threshold for significant SNP sites, the SNPs sites significantly associated with the gestation period traits of Eqing black pigs were obtained.

[0056] Example 2

[0057] Association analysis of different genotypes of significant SNPs with gestation period

[0058] For the significant SNPs sites screened by GWAS, the genotype data of each Eqing black pig at the C>G mutation site at position 32922080 on chromosome 1 was extracted using plink software, individuals with the same genotype were grouped into one group, and then the effect of different genotypes on the phenotype was detected using the single factor ANOVA test method of SPSS 26.0 software. The statistical data are expressed as mean ± standard deviation, * represents P < 0.05, ** represents P < 0.01, and *** represents P < 0.001. Finally, GraphPad Prism 8 software was used for plotting.

[0059] The results showed that Figure 2Or Table 1), the 1:32922080C>G site mutation can cause the increase of the pregnancy period of the E'qing black pigs, and the average pregnancy periods of the wild CC genotype, hybrid mutation GC genotype and homozygous mutation GG genotype are 113.70, 114.23 and 115.60 days respectively, the GC hybrid type is significantly higher than the CC wild type (P<0.05), and the GG homozygous type is extremely significantly higher than the CC wild type and the GC hybrid type (P<0.01), so for the population pursuing early pregnancy period, the CC wild type of the site is the favorable allele genotype of early pregnancy period, and the GC and GG mutant types are the unfavorable allele genotypes, and the selection of the mutant individuals should be reduced in breeding.

[0060] Table 11: Association analysis of different genotypes of 1:32922080C>G site and pregnancy period

[0061] Genotype Number of individuals Pregnancy duration (days) Comparison group P-value CC 129 113.70±1.68 CC vs GC 0.017* GC 88 114.23±1.46 GC vs GG 0.006** GG 12 115.60±1.67 CC vs GG 0.0001***

[0062] Example 3

[0063] Verification of polymorphic site

[0064] In order to verify the authenticity and reliability of the SNP site obtained by high-throughput sequencing, not caused by sequencing error, 6 pregnant pigs were selected as samples and marked as 1-6, the pregnancy period of the pigs was recorded, the DNA sequence of the pig sample was extracted, and the genotype of 1:32922080C>G site was subjected to Sanger sequencing.

[0065] 1. Primer design: using the "subseq" parameter of seqtk software to extract the sequence information of 500bp upstream and downstream of 1:32922080 site. According to the extracted 1000bp DNA sequence, the primer design software Primer Premier 5.0 was used to design primers.

[0066] F: GATGGAATTCACCAACCAAAAGCCC;

[0067] R: TGACACACGCACACCTACACACACT;

[0068] The primer amplification sequence information is as follows, wherein the 1:32922080C>G site is located at the 368th position from the 5' end of the sequence marked in bold, and the underlined part is the corresponding sequence of the primer.

[0069]

[0070] 2. PCR amplification: 1 μL of DNA template, 8 μL of double distilled water, 10 μL of 2x Es Taq MasterMix (Dye), and 0.5 μL of primer were added to a 20 μL system.

[0071] The PCR reaction conditions were as follows: 1 min of pre-denaturation at 94℃, 10 s of denaturation at 98℃, 15 s of annealing at 63℃, 45 s of extension at 72℃, 34 cycles, and finally 5 min of extension at 72℃.

[0072] 3. Sanger sequencing: The sequence of the DNA amplification product was sequenced in Wuhan Bio-tech Co., Ltd. The positive and negative reactions of the gene fragment were measured. The measured sequence was compared with the sequence of the pig reference genome (Sscrofa11.1.109) in Ensembl genome, and the mutation of the corresponding SNP site was obtained.

[0073] The sequencing results are shown in Figure 3 and Table 2, wherein Figure 3 A, B and C are GC genotype samples, and D, E and F are GG genotype samples, which are matched with the pregnancy period traits of the detected pigs.

[0074] Table 2: The pregnancy period of the sample pigs and the genotype of the 1:32922080C>G site

[0075] Sample number Pregnancy duration (days) Genotype 1 114.29 GC 2 114.67 GC 3 114.67 GC 4 115.29 GG 5 115.60 GG 6 116.00 GG

[0076] In summary, the SNP molecular marker related to the average pregnancy period traits of pigs provided by the present application can be used to identify the pregnancy period traits of pigs according to the genotype, realize early selection, and accelerate the breeding process.

[0077] The above only describes the preferred embodiments of the present application, and it should be noted that, for those skilled in the art, without departing from the principles of the present application, a number of improvements and refinements can be made, and these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. Use of a porcine SNP molecular marker or a substance for detecting the porcine SNP molecular marker in any of the following aspects, characterized in that, the porcine SNP molecular marker is used for detecting or assisting in detecting a porcine gestation period trait; the porcine SNP molecular marker is used for genetic breeding of a shortened porcine gestation period; the SNP molecular marker is a base at the 368th position in the sequence shown in SEQ ID NO. 1, and the SNP site of the molecular marker has a C / G polymorphism, wherein C is a favorable allelic variation of a shortened porcine gestation period.

2. Use according to claim 1, characterized in that, The substance for detecting the porcine SNP molecular marker includes a PCR primer for amplifying a genomic DNA fragment of the SNP site of the molecular marker, or a kit containing the primer.

3. Use according to claim 2, characterized in that, The nucleotide sequence of the primer is shown in SEQ ID NO. 2 and SEQ ID NO.

3.

4. Use according to claim 3, characterized in that, The kit further includes a PCR amplification reagent.

5. A method of detecting a trait of porcine gestation, characterized in that, The gestation period of a population of pigs with a GC genotype and a GG genotype of the base type at the 368th position in the sequence shown in SEQ ID NO. 1 is longer than that of a population of pigs with a CC genotype.

6. The method of claim 5, wherein, The method for detecting the base type at the 368th position in the sequence shown in SEQ ID NO. 1 includes: designing a primer for amplifying the nucleotide sequence shown in SEQ ID NO. 1, performing PCR amplification on porcine genomic DNA using the primer, and detecting the genotype of the 368th position in the gene sequence of the amplification product.

7. The method of claim 6, wherein, The genotype of the 368th position in the sequence shown in SEQ ID NO. 1 is obtained by Sanger sequencing.

8. The method of claim 6, wherein, The genotype of the 368th position in the sequence shown in SEQ ID NO. 1 is obtained by Sanger sequencing.

Images