Magnetic field response type engineering bacterium intestinal targeting carrier system as well as construction method and application thereof

Abstract

The invention belongs to the technical field of biotechnology and medicine, and particularly relates to a magnetic field response type engineering bacterium intestinal targeting carrier system as well as a construction method and application thereof. The magnetic field response type engineering bacterium intestinal tract targeting carrier system is a temperature sensitive type engineering bacterium EcN-GadABC coated Fe3O4 magnetic nanoparticle coated polynoradrenaline; the temperature sensitive type engineering bacterium EcN-GadABC comprises a gene for coding the GadABC and a temperature response type promoter pRpL. The magnetic field response type engineering bacterium intestinal tract targeting carrier system provided by the invention can realize space-time manipulation, and provides possibility for the clinical application of recombinant engineering bacterium intestinal tract transplantation. Behavior data of a mouse in an experimental example shows that the magnetic field response type engineering bacterium intestinal tract targeting carrier system has a remarkable anti-anxiety effect, so that the magnetic field response type engineering bacterium intestinal tract targeting carrier system provided by the invention can be used for treating anxiety disorder.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and medicine, and specifically relates to a magnetic field-responsive engineered bacteria intestinal targeting vector system and a construction method and application thereof. Background Art

[0002] Anxiety disorder is a common mental health disorder. Anxiety disorder refers to persistent, excessive and unrealistic worries about everyday things. Anxiety disorders include generalized anxiety disorder, panic disorder and phobias. Because anxiety is difficult to control, anxiety disorders are often accompanied by many non-specific psychological and physical symptoms, such as muscle tension, fatigue, sleep disorders, inattention and irritability. Anxiety disorders have been listed by the World Health Organization as the ninth leading cause of health-related disability, seriously affecting the production and life of patients with anxiety disorders. At present, the treatment of anxiety disorders is mainly based on drug therapy and psychotherapy, but the individual efficacy varies significantly and is accompanied by side effects.

[0003] Clinical applications have shown that transplantation of recombinant engineered bacteria plays an indispensable role in the prevention, alleviation, and treatment of Clostridium difficile infection, inflammatory bowel disease, diabetes, cancer, cirrhosis, and related encephalopathy. Studies have reported that in animal models of Parkinson's disease, transplantation of recombinant engineered bacteria also plays an important role in regulating motor deficits and neuroinflammation. Furthermore, compared with oral or parenteral medications, bacteria, as endogenous "drug factories" in the intestine, are more suitable for the delivery of small molecule proteins and peptide drugs, avoiding degradation and immune rejection during drug delivery. Intestinal transplantation of recombinant engineered bacteria provides a new approach for the treatment of anxiety disorders.

[0004] Gamma-aminobutyric acid (GABA) is a potent inhibitory neurotransmitter in the central nervous system. Existing studies have shown that GABA can bind to and activate anxiolytic brain receptors, then synergize with other substances to prevent anxiety-related information from reaching the brain's signaling centers. Therefore, GABA can be used to treat anxiety disorders. The prior art discloses a variety of recombinant engineered bacteria that can produce high levels of GABA, but none of them can be directly used clinically. This is because the safety and efficacy of bacterial therapy relies on the spatiotemporal manipulation of the engineered bacteria's in vivo behavior, including control over bacterial colonization, payload synthesis, and drug release. The prior art discloses blue-light-responsive engineered bacteria that can convert near-infrared light into blue light to activate blue-light-sensitive plasmids transfected into the recombinant bacteria. This nano-optogenetic technique enables engineered bacteria to be manipulated in vivo using near-infrared light, thereby achieving controllable and effective bacterial colonization in the intestine. However, even though near-infrared light has greater tissue penetration than blue light, its penetration is still limited (only a few millimeters), which limits the clinical application of photomanipulation. Therefore, there is an urgent need to develop novel engineered bacteria that can be spatiotemporally manipulated in deep tissues by exogenous signals with strong tissue penetration. Summary of the Invention

[0005] In order to overcome the above problems, the present invention provides a magnetic field-responsive engineered bacteria intestinal targeting vector system and its construction method and application.

[0006] In order to achieve the above technical objectives, the present invention adopts the following technical solutions:

[0007] The first aspect of the present invention provides a magnetic field-responsive engineered bacteria intestinal targeted carrier system, wherein the system is a temperature-sensitive engineered bacteria EcN-GadABC@Fe3O4 magnetic nanoparticles@polynorepinephrine;

[0008] The temperature-sensitive engineering bacteria EcN-GadABC comprises a gene encoding GadABC and a temperature-responsive promoter pRpL.

[0009] In one or more embodiments, the genes encoding GadABC include gada, gadb and gadc, wherein the nucleotide sequence of gada is shown in SEQ ID NO.1, including:

[0010]

[0011] The nucleotide sequence of gadb is shown in SEQ ID NO.2, comprising:

[0012]

[0013] The gadc nucleotide sequence is shown in SEQ ID NO.3, comprising:

[0014]

[0015] The second aspect of the present invention provides a method for preparing the magnetic field-responsive engineered bacteria intestinal targeted carrier system, comprising:

[0016] (1) The gene encoding GadABC was cloned into the temperature-sensitive plasmid pBV223 to obtain the recombinant expression vector pBV223-GadABC;

[0017] (2) transforming the recombinant expression vector pBV223-GadABC in step (1) into Escherichia coli Nissle 1917 competent cells, selecting positive clones, and obtaining temperature-sensitive engineered bacteria EcN-GadABC;

[0018] (3) The temperature-sensitive engineered bacteria EcN-GadABC cultured to OD = 0.8-1 were centrifuged and resuspended in PBS buffer solution, 1-ethyl-3 (3-dimethylaminopropyl) carbodiimide (EDC), N-hydroxysuccinimide (NHS) and amino-surface modified magnetic nanoparticles (MNP-NH2) were added, and the modified engineered bacteria were separated by differential centrifugation after stirring, i.e., the temperature-sensitive engineered bacteria EcN-GadABC@Fe3O4 magnetic nanoparticles;

[0019] (4) The modified engineered bacteria obtained in step (3) were resuspended in PBS buffer solution, and norepinephrine (NE) was added. After shaking and incubating for 2.5 to 3.5 hours, the mixture was centrifuged to obtain the temperature-sensitive engineered bacteria EcN-GadABC@Fe3O4 magnetic nanoparticles@polynorepinephrine, i.e., a magnetic field-responsive engineered bacteria intestinal targeting carrier system.

[0020] In one or more embodiments, in step (3), based on 1×10 10 For the temperature-sensitive engineered bacteria EcN-GadABC cells, the dosage of EDC is 1.1-1.2 mg, the dosage of NHS is 1.2-1.4 mg, and the dosage of MNP-NH2 is 0.9-1.1 mg.

[0021] In one or more embodiments, in step (3), the stirring time is 2.5 to 3.5 hours, preferably 3 hours.

[0022] In one or more embodiments, in step (4), the amount of NE added is 0.45-0.55 mg / mL, preferably 0.5 mg / mL.

[0023] In one or more embodiments, in step (4), the shaking speed of the shaking incubation is 150 to 250 rpm, preferably 200 rpm.

[0024] In one or more embodiments, in step (4), after shaking incubation, the mixture is washed 2 to 4 times with a PBS buffer solution and then centrifuged to obtain the temperature-sensitive engineered bacteria EcN-GadABC@Fe3O4 magnetic nanoparticles@polynorepinephrine.

[0025] The third aspect of the present invention provides the use of the above-mentioned magnetic field-responsive engineered bacteria intestinal targeted carrier system in the preparation of drugs for treating anxiety disorders.

[0026] The fourth aspect of the present invention provides the use of the above-mentioned magnetic field-responsive engineered bacteria intestinal targeting vector system in the preparation of drugs for preventing anxiety disorders.

[0027] The beneficial effects of the present invention are:

[0028] (1) The present invention obtains a temperature-sensitive engineered bacterium EcN-GadABC through genetic recombination, and then Fe3O4 magnetic nanoparticles (Fe3O4 MNPs) are connected to the surface of the temperature-sensitive engineered bacterium EcN-GadABC through amide condensation to obtain temperature-sensitive engineered bacterium EcN-GadABC@Fe3O4 magnetic nanoparticles. Finally, polynorepinephrine is uniformly coated on the outer layer of the temperature-sensitive engineered bacterium EcN-GadABC@Fe3O4 magnetic nanoparticles to form temperature-sensitive engineered bacterium EcN-GadABC@Fe3O4 magnetic nanoparticles@polynorepinephrine, that is, a magnetic field-responsive engineered bacterium intestinal targeted carrier system.

[0029] Oral administration exposes the engineered bacteria to direct contact with digestive fluids in the digestive tract, leading to degradation and potentially impacting their survival. The temperature-sensitive engineered bacteria, EcN-GadABC@Fe3O4 magnetic nanoparticles, are uniformly coated with norepinephrine, which auto-oxidizes to form a polynorepinephrine membrane on the surface of the bacteria, protecting them from the external gastrointestinal environment. Furthermore, norepinephrine's catecholamine groups are enriched in mussel foot proteins, which impart strong mucosal adhesion to the engineered bacteria, enhancing their ability to adhere to the intestinal mucosa and enabling precise and effective colonization of the small intestine. When exposed to an alternating magnetic field, the Fe3O4 magnetic nanoparticles convert magnetic signals into thermal signals. Upon increasing temperature, the temperature-responsive promoter pRpL heat-induces expression of the gene encoding GadABC, increasing γ-aminobutyric acid production. Therefore, the magnetic field-responsive engineered bacteria intestinal targeting vector system provided by the present invention can achieve spatiotemporal manipulation, providing the possibility for the clinical application of recombinant engineered bacteria intestinal transplantation.

[0030] (2) The behavioral data of mice in the experimental examples of the present invention show that the magnetic field-responsive engineered bacteria intestinal targeted vector system has a significant anti-anxiety effect. Therefore, the magnetic field-responsive engineered bacteria intestinal targeted vector system provided by the present invention can be used to treat anxiety disorders. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] The accompanying drawings, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0032] Figure 1 is a map of plasmid pBV220;

[0033] Figure 2 is a map of plasmid pBV223;

[0034] Figure 3 Figure 3 shows the construction of the temperature-sensitive engineered bacteria EcN-GadABC. A shows the results of 1% agarose gel electrophoresis for the amplification of the Gad fragment, which are gada, gadb, and gadc from left to right. B shows the results of electrophoresis for the digestion of pBV220 and pBV223 with EcoRI, which are pBV220 and pBV223 with EcoRI. C shows the results of colony PCR for the construction of the knockout vector, which are gada-pBV220, gadb-pBV220, and gadc-pBV223 from left to right. D shows the results of the amplification of pL-gada and pL-gadb fragments and gadc-pBV223. EcoRI-BamHI enzyme digestion electrophoresis detection results, from left to right are the pL-gada fragment amplification results, pL-gadb fragment amplification results and gadc-pBV223 EcoRI-BamHI enzyme digestion results; E is the colony PCR identification result of gadabc-pBV223 knockout vector construction; F is the EcN-GadABC colony PCR identification result;

[0035] Figure 4 is a map of the recombinant expression vector pBV223-GadABC;

[0036] Figure 5 The temperature responsiveness of the temperature-sensitive engineered bacteria EcN-GadABC is shown. The GABA expression levels of EcN-GadABC and EcN-GadABC cultured at 37°C and 42°C are shown from left to right at 0.5h, 1h, 2h, and 4h.

[0037] Figure 6A is the particle size of EcN-GadABC, EcN-GadABC@Fe3O4 cells and EcN-GadABC@Fe3O4 magnetic nanoparticles@polynephrine cells; B is the zeta potential of EcN-GadABC, EcN-GadABC@Fe3O4 cells and EcN-GadABC@Fe3O4 magnetic nanoparticles@polynephrine cells; C is the transmission electron microscopy image of EcN-GadABC, EcN-GadABC@Fe3O4 cells and EcN-GadABC@Fe3O4 magnetic nanoparticles@polynephrine cells;

[0038] Figure 7 Figure 3 shows the temperature change of temperature-sensitive engineered bacteria EcN-GadABC@Fe3O4 magnetic nanoparticles under an alternating magnetic field. A shows the solution temperature change of EcN-GadABC@Fe3O4 under AMF treatment, and B shows the infrared temperature imaging results of EcN-GadABC and EcN-GadABC@Fe3O4 under AMF treatment.

[0039] Figure 8 Figure 5 is the result of external environment resistance test, where A is the cell survival rate exposed to SGF (pH 1.5) supplemented with pepsin (0.32%), B is the cell survival rate exposed to SIF (pH 6.8) supplemented with trypsin (10 mg / mL), and C is the cell survival rate exposed to bile salts (0.4%); Note: In each figure A, B and C, from left to right are EcN-GadABC cells, EcN-GadABC@Fe3O4 cells and EcN-GadABC@Fe3O4 magnetic nanoparticles@poly-NE cells;

[0040] Figure 9The results show the adhesion effect of temperature-sensitive engineered bacteria EcN@Fe3O4 magnetic nanoparticles@polynorepinephrine in vivo, where A is the fluorescence image of the in vitro intestine after incubation with EcN-PAKgfpLux2, EcN-PAKgfpLux2@Fe3O4 cells and EcN-PAKgfpLux2@Fe3O4 magnetic nanoparticles@polynorepinephrine cells; B is the regional analysis of intestinal fluorescence intensity; C is the fluorescence image of EcN-PAKgfpLux2, EcN-PAKgfpLux2@Fe3O4 after administration of Bioluminescence images of the gastrointestinal tract of mice 48 hours after administration of EcN-PAKgfpLux2@Fe3O4 magnetic nanoparticles@polynorepinephrine cells; D is the regional analysis of intestinal fluorescence intensity at 24 hours; E is the bioluminescence images of mice administered with EcN-PAKgfpLux2, EcN-PAKgfpLux2@Fe3O4 cells, and EcN-PAKgfpLux2@Fe3O4 magnetic nanoparticles@polynorepinephrine cells at different time points; F is the regional analysis of intestinal fluorescence intensity at different time points;

[0041] Figure 10 These are the test results of the temperature-sensitive engineered bacteria EcN-GadABC@Fe3O4 magnetic nanoparticles@polynorepinephrine in alleviating anxiety in mice. A is the result of the open field test, B is the result of the elevated plus maze test, and C is the result of the light-dark box test. DETAILED DESCRIPTION

[0042] It should be noted that the following detailed descriptions are exemplary and intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used in the present invention have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0043] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is intended to include the plural form. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, they indicate the presence of features, steps, operations, devices, components and / or combinations thereof.

[0044] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0045] Example 1

[0046] (1) Construction of temperature-sensitive engineered bacteria EcN-GadABC:

[0047] Plasmid pBV220 was purchased from Hangzhou Baosai Biotechnology Co., Ltd. with the catalog number E013. The plasmid map is shown in Figure 1 As shown, the sequence is:

[0048]

[0049] Plasmid pBV223 was purchased from Hangzhou Baosai Biotechnology Co., Ltd. with the catalog number A2055. The plasmid map is shown in Figure 2 As shown, the sequence is:

[0050]

[0051] Using DNA from E. coli Nissle 1917 (purchased from Hangzhou Baosai Biotechnology Co., Ltd., catalog number T023) as a template, primers Gada-F / R, Gadb-F / R, and Gadc-F / R were used to amplify gada, gadb, and gadc fragments, respectively. Electrophoresis was performed to verify the fragments. Figure 3 As shown in A, from left to right are gada, gadb, gadc), and then the PCR products are recovered for use.

[0052] The nucleic acid sequence of Gada-F is shown in SEQ ID NO.4:

[0053] AAAAATTAAGGAGAATTCATGGACCAGAAGCTGTTAACGG;

[0054] The nucleic acid sequence of Gada-R is shown in SEQ ID NO.5:

[0055] CAGGTCGACGGATCCCCGGTCAGGTGTGTTTAAAGCTGTT;

[0056] The nucleic acid sequence of Gadb-F is shown in SEQ ID NO.6:

[0057] TTGGTTAAAAATTAAGGAATGGATAAGAAGCAAGTAACGGA;

[0058] The nucleic acid sequence of Gadb-R is shown in SEQ ID NO.7:

[0059] ACGGATCCCCGGGAATTCTTAGGTGTGTTTTAAAGCTGTTC;

[0060] The nucleic acid sequence of Gadc-F is shown in SEQ ID NO.8:

[0061] TTGGTTAAAAATTAAGGAATGGCTACATCAGTACAGACAG;

[0062] The nucleic acid sequence of Gadc-R is shown in SEQ ID NO.9:

[0063] CGGATCCCCGGGAATTCTTAGTGTTTCTTGTCATTCATCA.

[0064] pBV220 and pBV223 were cloned with EcoRI (Thermo Scientific TMFastDigest EcoRI, product number FD0274) and the digestion product was recovered for later use ( Figure 3 As shown in B, from left to right are the results of EcoRI digestion of pBV220 and pBV223, respectively. The amplified fragments and the digested vectors (gada and gadb were connected to pBV220, and gadc was connected to pBV223) were seamlessly cloned (the seamless cloning kit was mix 5*infusion cloning mix, purchased from Hangzhou Baosai Biotechnology Co., Ltd.) to obtain gada-pBV220, gadb-pBV220, and gadc-pBV223. 2 μL of 5× infusion cloning mix, 6 μL of recovered fragments, and 2 μL of recovered vector were mixed and placed on ice for 30 min. The cells were then electroporated into E. coli DH5alphA competent cells. 50 mg / mL ampicillin (Amp) plates were coated with gada-pBV220 and gadb-pBV220, and 34 mg / mL kanamycin (Kan) plates were coated with gadc-pBV223. The cells were cultured overnight at 37°C, and single colonies were picked. PCR identification and sequencing were performed using identification primers pBV-F / R ( Figure 3 As shown in center C, from left to right are gada-pBV220, gadb-pBV220, and gadc-pBV223).

[0065] The nucleic acid sequence of pBV-R is shown in SEQ ID NO. 10, which is:

[0066] CTGCGTTCTGATTTAATCTG;

[0067] The nucleic acid sequence of pBV-F is shown in SEQ ID NO. 11, which is:

[0068] AAGAAGGGCAGCATTCAAAG.

[0069] The pL-gada fragment with promoter pL was amplified using primers Gada-bsaI-F / R with the correctly sequenced gada-pBV220 plasmid as template; the pL-gadb fragment with promoter pL was amplified using primers Gadb-bsaI-F / R with the correctly sequenced gadb-pBV220 plasmid as template; gadc-pBV223 was amplified using EcoRI-BamHI (Thermo Scientific TM FastDigestBamHI, product number FD0054) double enzyme digestion for 1h and the digestion product was recovered for later use ( Figure 3As shown in Figure D, from left to right are the results of amplification of the pL-gada fragment, the pL-gadb fragment, and the gadc-pBV223 EcoRI-BamHI digestion. The purified PCR products amplified from the pL-gada fragment and the pL-gadb fragment were digested with bsaI (bsaI purchased from New England Biolabs, catalog number R3733) and then seamlessly ligated into gadc-pBV223 (EcoRI-BamHI) (seamless cloning kit: mix 5*infusion cloning mix, purchased from Hangzhou Baosai Biotechnology Co., Ltd.). The map of the recombinant expression vector pBV223-GadABC is shown in Figure D. Figure 4 The cells were then transformed into Ecoli DH5alphA competent cells, plated on 34 mg / mL Kan plates, cultured overnight at 37°C, and positive colonies were screened. PCR identification and sequencing were performed using primers Gada-cx-F / Gadb-cx-R ( Figure 3 (as shown in E).

[0070] The nucleic acid sequence of Gada-bsaI-F is shown in SEQ ID NO. 12, which is:

[0071] CTTTGGTCTCGAATTAGATCTCTCACCTACCAAACAATG

[0072] The nucleic acid sequence of Gada-bsaI-R is shown in SEQ ID NO. 13:

[0073] CTTTGGTCTCGATCTTCAGGTGTGTTTAAAAGCTGTTCTG

[0074] The nucleic acid sequence of Gadb-bsaI-F is shown in SEQ ID NO. 14, which is:

[0075] CTTTGGTCTCGAGATCTCTCACCTACCAAACAATGCCCCC

[0076] The nucleic acid sequence of Gadb-bsaI-R is shown in SEQ ID NO. 15, which is:

[0077] CTTTGGTCTCGGATCTTAGGTGTGTTTAAAAGCTGTTCTGC

[0078] The nucleic acid sequence of Gada-cx-F is shown in SEQ ID NO. 16, which is:

[0079] ATGGACCAGAAGCTGTTAACGG

[0080] The nucleic acid sequence of Gadb-cx-R is shown in SEQ ID NO. 17, which is:

[0081] AATCCATCAACTTATGGACA

[0082] 1 μL of the correctly sequenced gadabc-pBV223 plasmid was added to the prepared EcN1917 electroporation competent cells, placed on ice for 5 minutes, electroporated at 2500V, added with 1 mL of LB medium, cultured at 37°C for 1 hour, and then spread on 34 mg / mL Kan plates for colony PCR identification ( Figure 3 F in the figure), and the identification primers were gada-cx-F / gadb-cx-R (nucleic acid sequences are shown in SEQ ID NOs. 16 and 17). The E. coli Ecoli 1917 cells successfully identified by sequencing were named the engineered strain EcN-GadABC.

[0083] Example 2

[0084] After activation of EcN-GadABC at 37°C for 4 hours, the cells were transferred to 37°C and 42°C for incubation. 1 mL of the culture medium was sampled after 1 hour, 2 hours, and 4 hours for HPLC analysis. Prior to analysis, the sample was derivatized. Derivatization conditions were as follows: 100 μL of the sample to be tested, 200 μL of 0.5 mol / L NaHCO₃ solution, and 100 μL of 8 g of dansyl chloride in acetone were incubated at 40°C in the dark for 1 hour before filtration through a 0.22 μm microporous filter. The HPLC operating conditions were as follows: the chromatographic separation column was Hypersil ODS2C18 (250 mm x 4.6 mm), the UV detection wavelength was set at 254 nm, the injection volume was 10 μL, the flow rate was 1 mL / min, the mobile phase A was a methanol solution containing 0.01% trichloroacetic acid, and the mobile phase B was tetrahydrofuran:methanol:0.05 mol / L sodium acetate (5:75:420, v / v) (pH 6.2), and the gradient elution program was shown in Table 1. Figure 5 As shown in the data, after the engineered bacteria EcN-GadABC was cultured at 42°C for 1 hour, the production of γ-aminobutyric acid (GABA) in the culture medium was significantly higher than that when cultured at 37°C. The GABA production increased with the extension of the incubation time at 42°C, indicating that the engineered bacteria EcN-GadABC is temperature-responsive and the GABA production is regulated by temperature.

[0085] Table 1 Gradient elution program

[0086]

[0087] Example 3

[0088] (1) Assembly of temperature-sensitive engineered bacteria EcN-GadABC and Fe3O4 nanoparticles (EcN-GadABC@Fe3O4):

[0089] 12.5 mL of the temperature-sensitive engineering bacteria EcN-GadABC (synthesized in Example 1) was cultured to OD = 0.8 (1×10 10 Temperature-sensitive engineered bacteria EcN-GadABC cells) were centrifuged and resuspended in 12.5 mL of PBS buffer solution, and 1.15 mg of EDC, 1.3 mg of NHS, and 1 mg of MNP-NH2 were added. After stirring for 3 h, the modified engineered bacteria were separated by differential centrifugation (3000 rpm, 5 min) and washed three times with PBS buffer solution to obtain temperature-sensitive engineered bacteria EcN-GadABC@Fe3O4 magnetic nanoparticles.

[0090] (2) Polynorepinephrine encapsulation temperature-sensitive engineered bacteria EcN-GadABC@Fe3O4 magnetic nanoparticles to generate EcN-GadABC@Fe3O4 magnetic nanoparticles@polynorepinephrine (EcN-GadABC@Fe3O4-NE):

[0091] The engineered bacteria EcN-GadABC@Fe3O4 magnetic nanoparticles synthesized in step (1) were resuspended in 10 mL of PBS buffer solution, and then 0.5 mg / mL norepinephrine was added. After shaking and incubating for 3 h, the mixture was centrifuged to obtain the temperature-sensitive engineered bacteria EcN-GadABC@Fe3O4 magnetic nanoparticles@polynorepinephrine, that is, the magnetic field-responsive engineered bacteria intestinal targeting carrier system.

[0092] The particle size and zeta potential of the sample cells were measured by dynamic light scattering nanoparticle size analyzer (DLS). 100 μL of sample culture medium was diluted with 1 mL of PBS and then tested on the instrument. The morphology of EcN-GadABC cells, EcN-GadABC@Fe3O4 magnetic nanoparticle cells, and EcN-GadABC@Fe3O4 magnetic nanoparticles@polynorepinephrine cells were observed by transmission electron microscopy (TEM). The particle sizes of EcN-GadABC cells, EcN-GadABC@Fe3O4 magnetic nanoparticle cells, and EcN-GadABC@Fe3O4 magnetic nanoparticles@polynorepinephrine cells were as follows: Figure 6 As shown in A, the zeta potential is Figure 6As shown in Figure B, after the engineered bacteria were coated with the NE layer, the size of the EcN increased from 1231 nm to 1576 nm, and the zeta potential increased from -24.7 MV to -11.9 MV, indicating the presence of the NE layer on the surface of the engineered bacteria. At the same time, TEM can clearly show that the Fe3O4 magnetic nanoparticles are attached to the EcN, and the NE layer is wrapped around the outside of the EcN cells (as shown in Figure 4). Figure 6 (as shown in C).

[0093] Example 4 Magnetic Field Responsiveness

[0094] The magnetocaloric effect of EcN-GadABC@Fe3O4 magnetic nanoparticles was measured by placing the solution at the center of an induction coil to receive an alternating magnetic field (310 kHz, 18 kA / m) generated by an induction heating system (MSI Automation, USA). The temperature of the bacterial suspension was measured using a fiber optic thermometer and an infrared thermometer. Figure 7 As shown, after alternating magnetic field (AMF) treatment, the temperature of the EcN-GadABC@Fe3O4 suspension increased significantly with the extension of treatment time, demonstrating the efficacy of magnetocaloric effect.

[0095] Example 5

[0096] In order to explore the protective effect of the polynorepinephrine layer on the engineered bacteria in the gastrointestinal tract, external environment resistance tests were performed using simulated gastric fluid (SGF), simulated intestinal fluid (SIF) and bile salt simulations.

[0097] Preparation of SGF: SGF was prepared by dissolving 2.0 g of NaCl and 3.2 g of pepsin in 1 L of distilled water and adjusting the pH to 1.5 with HCl. SGF was filtered through a 0.22 μm filter membrane before use.

[0098] Preparation of SIF: 6.8 g of KH2PO4 and 10 g of trypsin were dissolved in 1 L of distilled water to prepare SIF. The pH was adjusted to 6.8 with NaOH. SIF was filtered through a 0.22 μm filter membrane before use.

[0099] Bile salt preparation: 4 g of bile salt (Sigma-Aldrich, B8756) was dissolved in 1 L of distilled water to prepare a bile salt solution (mass fraction of solute was 0.4%), and the solution was filtered through a 0.22 μm filter membrane before use.

[0100] SGF resistance assay: Equal amounts of EcN-GadABC, EcN-GadABC@Fe3O4, and EcN-GadABC@Fe3O4-NE were placed in SGF and incubated at 37°C with shaking at 225 rpm. At predetermined time points, 50 μL samples were washed with PBS and plated on LB agar plates in a serial 10-fold dilution pattern. Colonies were counted after 24 hours of incubation at 37°C.

[0101] SIF and bile salt resistance assays: Equal amounts of EcN-GadABC, EcN-GadABC@Fe3O4, and EcN-GadABC@Fe3O4-NE were treated with SIF and bile salts in LB medium. At the designated time points, samples were collected and washed with PBS. The samples were then resuspended in 100 μL of PBS, followed by the addition of 10 μL of CCK-8 solution and incubation at 37°C for 1 hour. OD450 values ​​were recorded to assess cell viability.

[0102] The results of SGF, SIF and bile salt resistance assays were as follows Figure 8 As shown, from Figure 8 As shown in Figure A, when treated with SGF, the activity of the temperature-sensitive engineered bacteria EcN-GadABC@Fe3O4-NE was significantly higher than that of EcN-GadABC and EcN-GadABC@Fe3O4 at 0.5, 1, and 2 h of incubation. Figure 8 As can be seen from Figures B and C, the temperature-sensitive engineered bacteria EcN-GadABC@Fe3O4-NE showed a higher survival rate when subjected to SIF and bile salt treatment, thus proving that the polyNE layer has a protective effect on the engineered bacteria and prevents attacks from the external environment of the gastrointestinal tract.

[0103] Example 6

[0104] Detection of the adhesion effect of temperature-sensitive engineered bacteria EcN-GadABC@Fe3O4 magnetic nanoparticles@polynorepinephrine in vivo:

[0105] First, wild-type EcN cells were electroporated with the fluorescent reporter plasmid PAKgfpLux2 for IVIS imaging to monitor bacterial distribution in vivo. The PAKgfpLux2 plasmid was purchased from Hangzhou Baosai Biotechnology Co., Ltd. 1 μL of the PAKgfpLux2 plasmid was added to the prepared EcN1917 electroporated competent cells. The cells were placed on ice for 5 minutes, heated at 1800V for 4 milliseconds, and then incubated with 1 mL of LB medium at 37°C for 1 hour. The cells were then plated on LB plates containing 34 mg / mL Kan and cultured overnight. Single colonies were picked to obtain EcN-PAKgfpLux2. EcN containing the PAKgfpLux2 plasmid was then combined with Fe3O4 magnetic nanoparticles to generate EcN-PAKgfpLux2@Fe3O4. Poly-nephrine was then coated onto the EcN-PAKgfpLux2@Fe3O4 to form EcN-PAKgfpLux2@Fe3O4-NE. The generated EcN-PAKgfpLux2@Fe3O4-NE was orally administered to mice, and the distribution of EcN was monitored by the fluorescence signal of the small animal in vivo optical imaging system (IVIS), and the colonization of the engineered bacteria was determined by analyzing the intensity of the fluorescence signal.

[0106] Mice (male, 6-8 weeks old) were randomly divided into three groups (n = 3 in each group). Each group of mice was orally administered with EcN-PAKgfpLux2, EcN-PAKgfpLux2@Fe3O4 and EcN-PAKgfpLux2@Fe3O4-NE (bacterial dose, 1×10 8 CFU). Bioluminescence in mice was detected by IVIS at 2, 8, and 24 h. In addition, mice were euthanized 24 h after receiving the different EcN preparations, and their gastrointestinal tracts were isolated and imaged.

[0107] The results are as follows Figure 9As shown, compared with EcN-PAKgfpLux2 and EcN-PAKgfpLux2@Fe3O4, the intestinal fluorescence of mice treated with EcN-PAKgfpLux2@Fe3O4-NE exhibited a longer retention time, and the bioluminescence intensity of the EcN-PAKgfpLux2@Fe3O4-NE group was significantly higher than that of the EcN-PAKgfpLux2 group and the EcN-PAKgfpLux2@Fe3O4 group at 8 and 24 hours, indicating that the NE layer can enhance the adhesion of bacteria to the intestinal mucosa. In addition, there was no significant difference in fluorescence intensity and fluorescence retention time between the EcN-PAKgfpLux2 group and the EcN-PAKgfpLux2@Fe3O4 group, indicating that the anchoring of Fe3O4 on the EcN surface did not affect the adhesion ability of the NE layer. After 24 h, the mice were euthanized and the gastrointestinal tract was collected for ex vivo IVIS imaging. It was found that the bioluminescence intensity of the EcN-PAKgfpLux2@Fe3O4-NE group was significantly higher than that of EcN-PAKgfpLux2 and EcN-PAKgfpLux2@Fe3O4, indicating that the NE layer coating conferred enhanced mucosal adhesion ability of bacteria.

[0108] Experimental Example 1

[0109] Evaluation of the functional effects of EcN-GadABC@Fe3O4-NE

[0110] Adult C57 / BL6 male mice, weighing 20-25 g, were randomly divided into a normal group, a wild-type EcN@Fe3O4-NE-treated group, and an EcN-GadABC@Fe3O4-NE-treated group, with 6-8 mice in each group, and were treated by gavage every day as follows: Figure 10 As shown in A, the normal group was gavaged with normal saline, the wild-type EcN@Fe3O4-NE-treated group and the EcN-GadABC@Fe3O4-NE-treated group were gavaged with engineered bacteria preparation (bacterial dose, 1×10 8 CFU), and 12 hours after gavage, the mice were restrained in the center of the induction coil to receive an alternating magnetic field for 1 hour for a total of 10 days for behavioral testing.

[0111] In order to verify the effectiveness of engineered bacteria in alleviating anxiety, three groups of mice treated with normal saline, wild-type EcN@Fe3O4-NE and EcN-GadABC@Fe3O4-NE by gavage were subjected to open field test, elevated plus maze and light-dark box test respectively.

[0112] An open field test was used to measure the time animals spent in the center of an open area for 5 minutes before entering the area. This was used to assess the level of anxiety caused by the open space and the preventive and therapeutic effects of the engineered bacteria on anxiety. The distance the animals moved within the entire open field area within 10 minutes was recorded to verify the effect of the engineered bacteria on animal mobility.

[0113] The elevated plus maze was used to test the number of times animals entered the open arms, the time they stayed in the open arms, the number of times they entered the closed arms, and the time they stayed in the closed arms. This was done to measure the animals' anxiety levels caused by elevation and the preventive and therapeutic effects of the engineered bacteria on anxiety.

[0114] The light-dark box test was used to measure the time when the animals first entered the light box, the number of times they entered the light box, and the time they stayed in the light box, to measure the level of anxiety caused by strong light in the animals and the preventive and therapeutic effects of the engineered bacteria on anxiety.

[0115] The results are as follows Figure 10 As shown, the elevated plus maze test was used as Figure 10 As shown in B, the light and dark box test is as follows Figure 10 As shown in C, the open field test results are as follows Figure 10 As shown in Figure D. Behavioral data demonstrated that EcN-GadABC@Fe3O4-NE exhibited significant anxiolytic effects. Compared to control mice, oral administration of EcN-GadABC@Fe3O4-NE significantly increased the number and duration of visits to the open arms, demonstrating that the engineered bacteria significantly mitigated the anxiety-induced effects of altitude-induced height increases in mice. Light-dark box testing demonstrated that oral administration of EcN-GadABC@Fe3O4-NE significantly reduced the time it took for mice to first visit the light box, while increasing the number of visits to the dark box and the duration of their stay in the light box, suggesting that the engineered bacteria have a protective effect against anxiety-induced by bright light. These data demonstrate that mice treated with EcN-GadABC@Fe3O4-NE combined with AMF exhibited a tendency to actively move, representing a reduction in anxiety-induced behaviors.

Claims

1. A magnetic field-responsive engineered bacteria intestinal targeting vector system, characterized in that: The system is a temperature-sensitive engineered bacterium EcN-GadABC@Fe3O4 magnetic nanoparticles@polynorepinephrine; The temperature-sensitive engineering bacteria EcN-GadABC comprises a gene encoding GadABC and a temperature-responsive promoter pRpL.

2. The magnetic field-responsive engineered bacteria intestinal targeting vector system according to claim 1, characterized in that: The genes encoding GadABC include gada, gadb and gadc; The nucleotide sequence of gada is shown in SEQ ID NO.1; the nucleotide sequence of gadb is shown in SEQ ID NO.2; and the nucleotide sequence of gadc is shown in SEQ ID NO.

3.

3. The method for preparing the magnetic field-responsive engineered bacteria intestinal targeting carrier system according to any one of claims 1 to 2, characterized in that: include: (1) The gene encoding GadABC was cloned into the temperature-sensitive plasmid pBV223 to obtain the recombinant expression vector pBV223-GadABC; (2) transforming the recombinant expression vector pBV223-GadABC in step (1) into Escherichia coli Nissle 1917 competent cells, selecting positive clones, and obtaining temperature-sensitive engineered bacteria EcN-GadABC; (3) The temperature-sensitive engineered bacteria EcN-GadABC cultured to OD = 0.8-1 were centrifuged and resuspended in PBS buffer solution, 1-ethyl-3 (3-dimethylaminopropyl) carbodiimide (EDC), N-hydroxysuccinimide (NHS) and amino-surface modified magnetic nanoparticles (MNP-NH2) were added, and the modified engineered bacteria were separated by differential centrifugation after stirring, i.e., the temperature-sensitive engineered bacteria EcN-GadABC@Fe3O4 magnetic nanoparticles; (4) The modified engineered bacteria obtained in step (3) were resuspended in PBS buffer solution, and norepinephrine (NE) was added. After shaking and incubating for 2.5 to 3.5 hours, the mixture was centrifuged to obtain the temperature-sensitive engineered bacteria EcN-GadABC@Fe3O4 magnetic nanoparticles@polynorepinephrine, i.e., a magnetic field-responsive engineered bacteria intestinal targeting carrier system.

4. The preparation method according to claim 3, wherein In step (3), based on 1×10 10 For the temperature-sensitive engineered bacteria EcN-GadABC cells, the dosage of EDC is 1.1-1.2 mg, the dosage of NHS is 1.2-1.4 mg, and the dosage of MNP-NH2 is 0.9-1.1 mg.

5. The preparation method according to claim 3, wherein In step (3), the stirring time is 2.5 to 3.5 hours, preferably 3 hours.

6. The preparation method according to claim 3, wherein The amount of NE added is 0.45-0.55 mg / mL, preferably 0.5 mg / mL.

7. The preparation method according to claim 3, wherein In step (4), the shaking speed of the shaking incubation is 150 to 250 rpm, preferably 200 rpm.

8. The preparation method according to claim 3, wherein In step (4), after incubation with shaking, the mixture is washed 2 to 4 times with a PBS buffer solution and then centrifuged to obtain the temperature-sensitive engineered bacteria EcN-GadABC@Fe3O4 magnetic nanoparticles@polynorepinephrine.

9. Use of the magnetic field-responsive engineered bacteria intestinal targeting carrier system according to any one of claims 1 to 2 in the preparation of drugs for treating anxiety disorders.

10. Use of the magnetic field-responsive engineered bacteria intestinal targeting carrier system according to any one of claims 1 to 2 in the preparation of a drug for preventing anxiety disorders.

Images