New application of Edwardsiella fish-sourced protein EseP or coding gene thereof

By using the EseP protein derived from Edwardsiella piscicida and expressing it in vivo through a recombinant vector, the problem of poor efficacy or large side effects of existing weight loss drugs is solved, and significant fat reduction effect and safety are achieved.

CN120643669APending Publication Date: 2025-09-16EAST CHINA UNIV OF SCI & TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510807761.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-17
Publication Date
2025-09-16

AI Technical Summary

Technical Problem

Existing weight loss drugs are ineffective or have significant side effects in treating obesity, and there is a lack of effective treatments with minimal side effects.

Method used

The protein EseP derived from Edwardsiella pisciculata or its coding gene is used to express the EseP protein in vivo through a recombinant expression vector for the preparation of weight loss drugs, which are applied to feed additives and pharmaceutical products in the aquaculture industry.

Benefits of technology

EseP protein significantly inhibits lipid droplet formation, reduces body weight and blood lipid indicators, has a good fat-reducing effect and is harmless to mice.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120643669A_ABST
    Figure CN120643669A_ABST
Patent Text Reader

Abstract

The invention relates to application of Edwardsiella fish-sourced protein EseP or a coding gene thereof in preparation of medicines for treating and / or preventing obesity. The screened Edwardsiella fish source protein EseP can inhibit lipid metabolism of cells HeLa and mice C57 / BL6J, and it is proved that the Edwardsiella fish source protein EseP has an obvious fat reducing effect and can be applied to aquaculture feed additives, medicine products and the like related to weight losing.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and in particular relates to a new use of a protein EseP derived from Edwardsiella piscicida or a coding gene thereof. Background Art

[0002] Edwardsiella piscicida is a major aquatic pathogen. It is a short, non-capsulated, Gram-negative bacterium with peritrichous flagella. It is widespread in the ocean and can infect over 20 major commercially cultivated fish species, including mullet, catfish, eel, and turbot. Edwardsiella piscicida can cause diseases such as hemorrhagic septicemia and gastroenteritis in fish, leading to mass mortality and significant economic losses to the aquaculture industry. During infection, Edwardsiella piscicida utilizes multiple proteins of its own to interfere with lipid metabolism in turbot and other fish.

[0003] Currently, commonly used weight loss drugs for the treatment of obesity include liraglutide, orlistat, and rimonabant. However, many weight loss drugs have been restricted from the market or withdrawn from clinical use, for example, because some of these drugs fail to achieve the desired effect or cause adverse reactions in patients.

[0004] Therefore, there is an urgent need to develop an effective method or drug for treating obesity and related diseases with few side effects. Summary of the Invention

[0005] The main purpose of the present invention is to address the above problems and provide a new use of the protein EseP derived from Edwardsiella piscicidalis or its encoding gene.

[0006] To achieve the above objectives, the first aspect of the present invention provides the use of a protein derived from Edwardsiella piscicida or its encoding gene in the preparation of a drug for treating and / or preventing obesity. The present invention has found that the protein EseP has the effect of reducing weight and fat.

[0007] Preferably, the amino acid sequence of the protein EseP is as shown in SEQ ID NO: 1, and SEQ ID NO: 1 is specifically: MPIFCVGLRGVDAIACCLPPRAATGECHFDDLFIDIILI.

[0008] Preferably, the nucleotide sequence of the gene encoding the protein EseP is shown in SEQ ID NO: 2, and SEQ ID NO: 2 is specifically:

[0009] tcatatcaatatgatatcaatgaataaatcatcaaaatgacactctcccgtcgccgctctcggcggcaagcagcaggcgatggcgtcgac gcccctcaatcccacacaaaaaataggcac.

[0010] Preferably, the protein EseP or its encoding gene is used for fat reduction.

[0011] The second aspect of the present invention provides a recombinant expression vector, the main feature of which is that the recombinant expression vector comprises a gene encoding the EseP protein derived from Edwardsiella piscicida to express the EseP protein.

[0012] Preferably, the recombinant expression vector is a recombinant expression AAV vector, and a nucleic acid fragment encoding the EseP protein is inserted into the recombinant expression vector to stably express the EseP protein.

[0013] The protein EseP derived from Edwardsiella piscicida screened by the present invention can inhibit lipid metabolism in HeLa cells and C57 / BL6J mice, and has been shown to have a significant fat-reducing effect. It can be applied to aquaculture feed additives, pharmaceutical products, and the like related to weight loss. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 These are confocal images of lipid droplet numbers in wild-type Edwardsiella piscicidal strain, type III secretion system-deficient strain, EseP-deficient strain, EseP-complemented strain, and uninfected HeLa cells.

[0015] Figure 2 This is an immunofluorescence staining image of EseP expression in mice, where blue is the nucleus stain DAPI, green is the lipid dye Bodipy, and red is the EseP protein with HA tag.

[0016] Figure 3 Figure 2 is the relative curve of body weight change of C57 / BL6J male mice, where ND is the normal diet group, HFD is the high-fat diet group, and EseP+HFD is the high-fat diet group injected with an AAV vector containing the EseP fragment.

[0017] Figure 4 A to Figure 4 D is the result of testing four blood lipid indicators of C57 / BL6J male mice eight weeks after the injection of AAV vector. Among them, TG is triglyceride, T-CHO is cholesterol, LDL-C is low-density lipoprotein, HDL-C is high-density lipoprotein, ND is the normal diet group, HFD is the high-fat diet group, and EseP+HFD is the high-fat diet group injected with AAV vector containing EseP fragment.

[0018] Figure 5 The results of oil red staining of the liver of C57 / BL6J male mice eight weeks after the injection of AAV vectors. Among them, ND is the normal diet group, HFD is the high-fat diet group, and EseP+HFD is the high-fat diet group injected with AAV vectors containing EseP fragments.

[0019] Figure 6 These are the results of HE staining of the liver of C57 / BL6J male mice eight weeks after the injection of AAV vectors. ND is the normal diet group, HFD is the high-fat diet group, and EseP+HFD is the high-fat diet group injected with AAV vectors containing EseP fragments. DETAILED DESCRIPTION

[0020] In order to more clearly understand the technical content of the present invention, the following embodiments are given in detail. However, it should be noted that these descriptions are only for further illustrating the features and advantages of the present invention, and are not intended to limit the claims of the invention.

[0021] Unless otherwise specified, the reagents and methods involved in the examples are commonly used in the art.

[0022] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0023] The present invention has confirmed through research that the EseP protein derived from Edwardsiella piscicida can inhibit the formation of lipid droplets in HeLa cells; and after being expressed in C57 / BL6J male mice via an AAV vector, the four indicators of body weight, oil red staining and blood lipids were tested to prove that it has a good fat-reducing effect, and HE staining proved that it has no harm to mice.

[0024] Example 1

[0025] EseP inhibits lipid droplet accumulation in HeLa cells after infection

[0026] The EseP gene deletion strain, overexpression strain and type III secretion system gene deletion strain were constructed by homologous recombination. Edwardsiella piscicida EIB202 (CCTCC M208068) and EIB202 strain EseP gene deletion strain, EseP gene overexpression strain and type III secretion system gene deletion strain were added at an MOI of 10:1. 7Each well was inoculated with 1 ml of Opti-MEM medium. The cells were inoculated in an incubator with 5% CO2 at 35°C. After 2 hours of infection, the cells were rinsed twice with PBS. Then, 1 ml of Opti-MEM medium containing 1000 μg / ml gentamicin was added. After 20 minutes, the cells were rinsed twice with PBS and then 1 ml of Opti-MEM medium containing 10 μg / ml gentamicin was added for 4 hours. After 4 hours, the cells were rinsed twice with PBS and stained for lipid droplets and nuclei with Bodipy 493 / 503 (green) and DAPI (blue), respectively. The cells were then observed using a confocal microscope.

[0027] The experimental results are as follows Figure 1 As shown, infection of HeLa cells with the EseP deletion strain stimulates the formation of lipid droplets in the cells. After infection of the cells with the EseP overexpression strain, the size and number of lipid droplets in the cells decreased significantly.

[0028] Example 2

[0029] EseP significantly reduced the body weight, blood lipids and other related indicators of mice

[0030] The present invention synthesizes an AAV vector containing EseP by Guangdong Paizhen Biotechnology, such as Figure 2 As shown, EseP is expressed in mice, where blue is the nuclear stain DAPI (from Shanghai Beyotime Biotechnology), green is the lipid dye BODIPY (from Thermo Fisher Scientific (China)), and red is the Flag-tagged EseP protein (Flag antibody from Shanghai Beyotime Biotechnology).

[0031] In order to verify whether EseP also has a fat-reducing effect in the body, 36 5-week-old C57 / BL6J male mice were fed for 7 days and then divided into groups according to body weight, namely, a normal feed-fed group, a high-fat feed-fed group, and a high-fat feed group injected with an AAV vector containing EseP synthesized by Guangdong Paizhen Biotechnology, and recorded as week 0. The normal feed-fed group was fed with breeding irradiated mouse feed provided by Jasejie Company, and the high-fat feed group was fed with D12492 feed provided by Research Diet Company. The 36 mice were weighed every week. The results are as follows. Figure 3 As shown, the weight gain of mice in the high-fat diet group was the fastest, while the weight of the high-fat fed group injected with the AAV vector containing EseP was comparable to that of the normal chow fed group.

[0032] The weight loss ratio was calculated based on the body weight of each group. The results are shown in Table 1 below. HFD refers to the high-fat diet group, and EseP+HFD refers to the high-fat diet group injected with an AAV vector containing the EseP segment. The weight loss ratio for the high-fat diet group injected with the AAV vector containing the EseP segment was 1.20% relative to the high-fat diet group.

[0033] Table 1

[0034] HFD EseP+HFD Initial average weight 19.53 21.53 Final average weight 28.60 27.63 Weight loss ratio 0 1.20%

[0035] The mice were raised to the eighth week and tested for triglycerides, cholesterol, low-density lipoprotein, and high-density lipoprotein using a Nanjing Jiancheng Biological Kit. 2.5 μL of mouse orbital blood was added, followed by 250 μL of the working solution. The plate was shaken to mix, and the absorbance of each well was measured using a microplate reader after incubation at 37°C. The results were as follows: Figure 4 A to Figure 4 D, The triglycerides, cholesterol, low-density lipoprotein, and high-density lipoprotein levels of mice in the high-fat diet group were the highest, while the body weight of the high-fat diet group injected with the AAV vector containing EseP was comparable to that of the normal diet group.

[0036] At the same time, the livers of mice raised to the 8th week were sent to Worden Pathology Company for oil red staining. The tissues were first fixed with 10% neutral formaldehyde and prepared into frozen sections, and then stained with filtered diluted oil red storage solution for 10 minutes. Figure 5 As shown, the fat content of the oil red-stained sections of the high-fat diet group mice was the highest, while the fat content of the high-fat fed group injected with the AAV vector containing EseP was relatively low and there was a tendency for fat accumulation.

[0037] The above experimental results show that EseP has a good fat-reducing effect in the body and can affect lipid metabolism.

[0038] Example 3

[0039] AAV vectors containing EseP are not harmful to mice

[0040] HE staining was performed on the liver of the mice raised to the 8th week in the above embodiment. Figure 6 As shown, no lesions were produced in the HE-stained sections of the normal feed-fed group, the high-fat feed-fed group, and the high-fat feed-fed group injected with the AAV vector containing EseP, indicating that the AAV vector containing EseP is not harmful to mice.

[0041] In this specification, the present invention has been described with reference to specific embodiments thereof. However, it will be apparent that various modifications and variations may be made without departing from the spirit and scope of the present invention. Therefore, the description is to be regarded as illustrative rather than restrictive.

Claims

1. Use of the protein EseP derived from Edwardsiella piscicida or its encoding gene in the preparation of a drug for treating and / or preventing obesity.

2. The use according to claim 1, characterized in that The amino acid sequence of the protein EseP is shown in SEQ ID NO:

1.

3. The use according to claim 1, characterized in that The nucleotide sequence of the gene encoding the protein EseP is shown in SEQ ID NO:

2.

4. The use according to claim 1, characterized in that The protein EseP or its encoding gene is used for fat reduction.

5. A recombinant expression vector, characterized in that: The recombinant expression vector comprises a gene encoding the EseP protein derived from Edwardsiella piscicida to express the EseP protein.