Application of circular RNA hsacirc0008135 in acute myelogenous leukemia with NPM1 mutation
By studying the differentially expressed circular RNA hsa_circ_0008135 in NPM1 mutation AML patients, regulating OCI-AML3 cell proliferation and ferroptosis, the treatment problem of NPM1 mutation leukemia was solved and a new therapeutic target was provided.
Patent Information
- Application Number
- CN202510598167.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-09
- Publication Date
- 2025-09-16
- Estimated Expiration
- 2045-05-09
AI Technical Summary
At present, the clinical treatment of NPM1-mutated acute myeloid leukemia faces relapse and refractory disease, and there is a lack of effective individualized treatment targets. The role of circular RNA in NPM1-mutated leukemia has not been reported.
The study found that the differentially expressed circular RNA in NPM1-mutated AML patients and non-NPM1-mutated AML patients was hsa_circ_0008135. Knockdown or overexpression of hsa_circ_0008135 regulated OCI-AML3 cell proliferation and ferroptosis, providing a new therapeutic target.
Knockdown of hsa_circ_0008135 inhibited OCI-AML3 cell proliferation and promoted ferroptosis, while overexpression of hsa_circ_0008135 inhibited ferroptosis, providing new possibilities for the treatment of NPM1-mutated AML.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the application of circular RNA hsa_circ_0008135 in acute myeloid leukemia with NPM1 mutation. Background Art
[0002] Acute myeloid leukemia (AML) is a malignant clonal blood disorder characterized by the abnormal proliferation of primitive, immature myeloid cells in the bone marrow and peripheral blood, accompanied by blocked differentiation of bone marrow hematopoietic stem or progenitor cells. Clinical data indicate that nearly one-third of newly diagnosed AML patients harbor mutations in the nucleophosmin 1 (NPM1) gene. Due to its unique clinicopathological and molecular features, NPM1-mutant AML was included as a distinct disease subtype in the 2017 World Health Organization (WHO) classification guidelines for hematopoietic and lymphoid tumors. These patients often have normal karyotypes and are less likely to harbor recurrent AML-like genetic abnormalities. Despite the recent emergence of new molecularly targeted drugs such as the Bcl-2 inhibitor venetoclax and various immunotherapy regimens, the current clinical treatment of NPM1-mutant leukemia remains plagued by relapse and refractory disease. Therefore, there is an urgent need to further elucidate the pathogenesis of NPM1-mutant AML and to develop personalized, precise diagnostic and treatment strategies.
[0003] Circular RNA (circRNA) was first discovered in RNA viruses in 1976 and initially thought to be viroids. CircRNAs were observed in eukaryotic cell lines using electron microscopy in 1991 and were once thought to be byproducts of mis-splicing. With the rapid development of high-throughput sequencing technology and bioinformatics, numerous circRNAs have been identified in eukaryotes, clearly demonstrating that they are not accidental or mis-splicing byproducts but rather a class of RNA molecules that play important roles in cells. CircRNAs are endogenous noncoding RNAs that, unlike traditional linear RNAs, lack a 5' cap or 3' poly(A) tail. Instead, they form closed circular structures by reverse splicing of exon sequences. They are highly stable and resistant to degradation, exhibiting remarkable conservation across most species while also exhibiting tissue-specific and developmental-stage specific expression. As important regulatory factors in the human genome, circRNAs are closely associated with the malignant transformation of tumors. Current research indicates that circRNAs are emerging as important potential diagnostic, prognostic, and therapeutic targets for leukemia.
[0004] The research progress of circular RNA in the occurrence and development of leukemia[1] disclosed that circRNAs with high expression levels in AML were screened by gene chip, including hsa_circ_0004277, hsa_circ_00750, etc. It was found that the expression levels of these circRNAs in AML showed corresponding dynamic changes with the evolution of AML. At the biological level, they have competitive or cleavage effects with homologous linear RNAs, and have high potential as prognostic indicators for AML.
[0005] The study "Expression and clinical significance of MDM2 circular RNA in the bone marrow of patients with acute myeloid leukemia" [2] disclosed that upregulation of circ-MDM2 expression is a common event in AML patients. Bone marrow circ-MDM2 levels have certain diagnostic value for AML and can be used as a potential biomarker to distinguish AML patients from controls. Circ-MDM2 expression is associated with CEBPA mutations and has no significant relationship with patients' overall survival or leukemia-free survival.
[0006] "Research Progress of Circular RNA in Leukemia Prognosis and Imatinib Resistance" [3] disclosed: circ-VIM, circ-PVT1, circ-DLEU2, circ-ANAPC7, circ-PAN3, circ-HIPK2, hsa_circ_0004277, hsa_circ_0075001 for the diagnosis of acute myeloid leukemia biomarkers or therapeutic targets.
[0007] The study "CircZBTB46 Protects Acute Myeloid Leukemia Cells from Ferroptotic Cell Death by Upregulating SCD"[4] published an analysis of a circRNA chip dataset and found differentially expressed circRNAs in AML patients. Among them, circZBTB46 was significantly upregulated in AML patients and AML cells. Further analysis showed that the expression level of circZBTB46 was closely related to the disease stage of AML patients, and it showed high sensitivity and specificity in the diagnosis of AML, and is expected to become a potential biomarker for the diagnosis of AML.
[0008] "Deregulation of CircANXA2, Circ0075001, and CircFBXW7 Gene Expressions and Their Predictive Value in Egyptian Acute Myeloid Leukemia Patients" [5] disclosed: the expression of circANXA2, circ0075001 and circFBXW7 genes in AML patients and the relationship between their expression levels and clinical, cytogenetic and overall survival outcomes, emphasizing the diagnostic role and prognostic impact of the three circular RNAs in AML disease.
[0009] "A novel circular RNA (hsa_circ_0000370) increases cell viability and inhibits apoptosis of FLT3-ITD-positive acute myeloid leukemia cells by regulating miR-1299and S100A7A" [6] disclosed that a novel circular RNA circ_0000370 was significantly increased in FLT3-ITD+AML, promoted AML cell proliferation, and played a pro-cancer role; bioinformatics prediction and in vitro experiments confirmed that circ_0000370 exerted its biological function through the miR-1299 / S100A7A axis.
[0010] In summary, more research is focused on exploring the pathogenesis of AML and the relationship between circular RNA and AML. However, at this stage, the clinical treatment of NPM1-mutated leukemia still faces the dilemma of relapse and refractory disease. Finding new therapeutic targets is an urgent clinical solution. The role of circular RNA hsa_circ_0008135 in NPM1-mutated acute myeloid leukemia has not yet been reported.
[0011] References:
[0012] [1] Ma Wenjuan, Zhao Chuan, Chen Che. Research progress of circular RNA in the occurrence and development of leukemia[J]. Basic Medicine and Clinic, 2019(4):4.DOI:CNKI:SUN:JCYL.0.2019-04-024.
[0013] [2] Zhao Qian, Wu Delong, Su Xiaoyu, et al. Expression and clinical significance of MDM2 circular RNA in the bone marrow of patients with acute myeloid leukemia[J]. Journal of Jiangsu University: Medical Edition, 2021, 31(6): 6. DOI: 10.13312 / j.issn.1671-7783.y210073.
[0014] [3] Research progress on circular RNA in leukemia prognosis and imatinib resistance
[0015] [4]CircZBTB46 Protects Acute Myeloid Leukemia Cells from FerroptoticCell Death by Upregulating SCD
[0016] [5]Deregulation of CircANXA2,Circ0075001,and CircFBXW7 GeneExpressions and Their Predictive Value in Egyptian Acute Myeloid LeukemiaPatients
[0017] [6]A novel circular RNA(hsa_circ_0000370) increases cell viability and inhibits apoptosis of FLT3-ITD-positive acute myeloid leukemia cells byregulating miR-1299and S100A7A Summary of the Invention
[0018] To address the problems existing in the prior art, this application studied and identified hsa_circ_0008135 as the differentially expressed circular RNA in patients with NPM1-mutated AML and those without NPM1-mutated AML. Knockdown of hsa_circ_0008135 inhibited the proliferation of OCI-AML3 cells, while overexpression of hsa_circ_0008135 promoted the proliferation of OCI-AML3 cells. Knockdown of hsa_circ_0008135 promoted ferroptosis in OCI-AML3 cells. Overexpression of hsa_circ_0008135 inhibited ferroptosis in OCI-AML3 cells. The specific technical solutions of the present invention are as follows:
[0019] First, we investigated the differentially expressed circular RNAs in patients with NPM1-mutated AML and those without NPM1-mutated AML.
[0020] (I) Database screening for differentially expressed circular RNAs in patients with NPM1 mutations and those without NPM1 mutations
[0021] CircRNA expression microarray data from three patients with NPM1-mutated AML, three patients with non-NPM1-mutated AML, and four healthy controls were downloaded from GEO (GSE94591). We identified differentially expressed circRNAs in patients with NPM1-mutated AML and those without. Results: Compared with circRNAs in patients with non-NPM1-mutated AML, four circRNAs were significantly overexpressed in patients with NPM1-mutated AML, including hsa_circ_0008135.
[0022] We identified circRNAs that were differentially expressed between NPM1-mutated AML patients and healthy controls. Results: Compared with the circRNAs in healthy controls, 137 circRNAs were significantly overexpressed in NPM1-mutated AML patients, including hsa_circ_0008135. Therefore, hsa_circ_0008135 was selected for subsequent experiments.
[0023] (II) Using clinical samples to verify whether hsa_circ_0008135 is a differentially expressed circular RNA in patients with NPM1-mutated AML and those without NPM1-mutated AML
[0024] Clinical samples were tested using qRT-PCR;
[0025] Conclusion: The expression level of hsa_circ_0008135 in patients with NPM1 mutation acute myeloid leukemia (AML) (n=23) was significantly higher than that in patients with non-NPM1 mutation acute myeloid leukemia (AML) (n=49).
[0026] Second, investigate the expression differences of hsa_circ_0008135 in 7 myeloid leukemia cells
[0027] Conclusion: Compared with six myeloid leukemia cell lines, including NB4, THP-1, HL-60, U937, OCI-AML2, and KG-1α cells, hsa_circ_0008135 is relatively highly expressed in OCI-AML3, a leukemia cell line naturally carrying NPM1 gene mutations.
[0028] The third aspect is the effect of knockdown of hsa_circ_0008135 on the proliferation of OCI-AML3 cells
[0029] (I) CCK8 assay to detect the effect of hsa_circ_0008135 knockdown on OCI-AML3 cell proliferation
[0030] CCK8 was used to detect the relative absorbance value of OCI-AML3 cells with hsa_circ_0008135 knockdown.
[0031] Conclusion: Knockdown of hsa_circ_0008135 significantly inhibited the proliferation of OCI-AML3 cells.
[0032] (II) EdU detection of the effect of hsa_circ_0008135 knockdown on OCI-AML3 cell proliferation
[0033] EdU detection of OCI-AML3 cells with hsa_circ_0008135 knockdown + Cell percentage.
[0034] Results: EdU knockdown of hsa_circ_0008135 in OCI-AML3 cells + The percentage of cells decreased significantly.
[0035] (III) Clone formation assay: Effect of hsa_circ_0008135 knockdown on OCI-AML3 cell proliferation
[0036] Results: The cell colonies of OCI-AML3 cells with hsa_circ_0008135 knockdown became smaller, and the colony formation rate was significantly reduced.
[0037] In summary, knockdown of hsa_circ_0008135 inhibited the proliferation of OCI-AML3 cells.
[0038] Fourthly, the effect of overexpression of hsa_circ_0008135 on the proliferation of OCI-AML3 cells
[0039] (I) CCK8 assay to detect the effect of overexpression of hsa_circ_0008135 on the proliferation of OCI-AML3 cells
[0040] Conclusion: Overexpression of hsa_circ_0008135 promotes the proliferation of OCI-AML3 cells.
[0041] (II) EdU detection of the effect of overexpression of hsa_circ_0008135 on the proliferation of OCI-AML3 cells
[0042] Results: EdU expression in OCI-AML3 cells overexpressing hsa_circ_0008135 + The percentage of cells increased significantly.
[0043] (III) Effect of overexpression and knockdown of hsa_circ_0008135 on the proliferation of OCI-AML3 cells
[0044] Results: The cell colonies of OCI-AML3 cells overexpressing hsa_circ_0008135 became larger, and the colony formation rate was significantly increased.
[0045] In summary, overexpression of hsa_circ_0008135 promotes the proliferation of OCI-AML3 cells.
[0046] Fifth, the effect of knockdown of hsa_circ_0008135 on ferroptosis in OCI-AML3 cells
[0047] (I) Effect of knockdown of hsa_circ_0008135 on the intracellular iron level in OCI-AML3 cells. The iron level in OCI-AML3 cells with knockdown of hsa_circ_0008135 was detected.
[0048] Conclusion: Knockdown of hsa_circ_0008135 can significantly increase the relative iron level in OCI-AML3 cells.
[0049] (2) Effect of knockdown of hsa_circ_0008135 on ROS levels in OCI-AML3 cells ROS levels in OCI-AML3 cells with knockdown of hsa_circ_0008135 were detected using ROS.
[0050] Conclusion: Knockdown of hsa_circ_0008135 promotes ROS expression in OCI-AML3 cells.
[0051] (III) Effect of knockdown of hsa_circ_0008135 on SLC7A11 protein levels in OCI-AML3 cells
[0052] Western blotting was used to detect the SLC7A11 protein level in OCI-AML3 cells with hsa_circ_0008135 knockdown.
[0053] Conclusion: Knockdown of hsa_circ_0008135 inhibits SLC7A11 protein expression in OCI-AML3 cells.
[0054] In summary, knockdown of hsa_circ_0008135 promoted ferroptosis in OCI-AML3 cells.
[0055] Effect of overexpression of hsa_circ_0008135 on ferroptosis in OCI-AML3 cells
[0056] (I) Effect of hsa_circ_0008135 overexpression on intracellular iron levels in OCI-AML3 cells
[0057] Conclusion: Overexpression of hsa_circ_0008135 can significantly inhibit the relative iron level in OCI-AML3 cells.
[0058] (2) Effect of overexpression of hsa_circ_0008135 on ROS levels in OCI-AML3 cells Conclusion: Overexpression of hsa_circ_0008135 inhibits ROS expression in OCI-AML3 cells.
[0059] (III) Effect of hsa_circ_0008135 overexpression on SLC7A11 protein levels in OCI-AML3 cells
[0060] Conclusion: Overexpression of hsa_circ_0008135 promotes SLC7A11 protein expression in OCI-AML3 cells.
[0061] In summary, overexpression of hsa_circ_0008135 inhibits ferroptosis in OCI-AML3 cells.
[0062] Seventh aspect, the effect of circular RNA disclosed in references [1], [4] and [6] on the proliferation of OCI-AML3 cells
[0063] (I) Detection of the expression levels of hsa_circ_0004277 and hsa_circ_00750 in seven myeloid leukemia cell lines
[0064] The expression levels of hsa_circ_0004277 and hsa_circ_00750 in OCI-AML3, OCI-AML2, KG-1α, THP-1, HL-60, U937 and NB4 cell lines were detected by qRT-PCR.
[0065] Results: Compared with OCI-AML3 cells carrying NPM1-mA, hsa_circ_0004277 expression was not different in NB4, THP-1, HL-60, U937, OCI-AML2, and KG-1α cells.
[0066] Conclusion: There was no statistical difference in the expression of hsa_circ_0004277 and hsa_circ_00750 circRNAs in NPM1 mutation acute myeloid leukemia and non-NPM1 mutation acute myeloid leukemia, and there was no statistical difference in the expression of hsa_circ_0004277 and hsa_circ_00750 circRNAs in NPM1 mutation acute myeloid leukemia and healthy controls, indicating that hsa_circ_0004277 and hsa_circ_00750 are not specifically expressed in NPM1 mutation leukemia, so no further study is needed.
[0067] (II) CCK8 assay to detect the effect of overexpression of circ_ZBTB46 (described in reference [4]) on the proliferation of OCI-AML3 cells
[0068] Conclusion: Knockdown and overexpression of circ_ZBTB46 had no effect on the proliferation of OCI-AML3 cells.
[0069] (III) CCK8 detection of the effect of overexpression of hsa_circ_0000370 (mentioned in reference [6]) on the proliferation of OCI-AML3 cells
[0070] Conclusion: Knockdown and overexpression of hsa_circ_0000370 had no effect on the proliferation of OCI-AML3 cells.
[0071] Compared with the prior art, the present invention has the following advantages:
[0072] This application discovered for the first time that the differentially expressed circular RNA in patients with NPM1 mutation AML and non-NPM1 mutation AML was hsa_circ_0008135. Knockdown of hsa_circ_0008135 inhibited the proliferation of OCI-AML3 cells, while overexpression of hsa_circ_0008135 promoted the proliferation of OCI-AML3 cells. Knockdown of hsa_circ_0008135 promoted intracellular ferroptosis in OCI-AML3 cells, while overexpression of hsa_circ_0008135 inhibited intracellular ferroptosis in OCI-AML3 cells, providing a possible new therapeutic target for the clinical treatment of NPM1 mutation AML. BRIEF DESCRIPTION OF THE DRAWINGS
[0073] Figure 1 , circRNAs differentially expressed between NPM1 mutation AML patients and non-NPM1 mutation AML patients, among which,
[0074] A is a volcano plot showing differentially expressed circRNAs in NPM1-mutated AML patients and non-NPM1-mutated AML patients. NPM1-mutated AML patients are marked with “NPM1 + ” indicates that patients with AML without NPM1 mutations are indicated by “NPM1 - "express,
[0075] B is a volcano plot showing differentially expressed circRNAs between NPM1 mutant AML patients and healthy controls. NPM1 mutant AML patients are marked with “NPM1 + ", healthy controls are represented by "HCs",
[0076] C is a Venn diagram showing the intersection of differentially expressed circRNAs in different groups;
[0077] Figure 2 ,hsa_circ_0008135 structural diagram;
[0078] Figure 3 , Statistical graph showing the difference in hsa_circ_0008135 expression between clinical samples of NPM1-mutated AML patients and clinical samples of non-NPM1-mutated AML patients detected by qRT-PCR method, where clinical samples of NPM1-mutated AML patients are represented by NPM1-mutated, and clinical samples of non-NPM1-mutated AML patients are represented by NPM1-unmutated;
[0079] Figure 4 , qRT-PCR method was used to detect the expression level of hsa_circ_0008135 in 7 leukemia cells;
[0080] Figure 5 , qRT-PCR method confirmed the effects of knockdown and overexpression of hsa_circ_0008135, among which,
[0081] The left figure is a statistical chart confirming the effect of knocking down hsa_circ_0008135. shcircRNA#1 and shcircRNA#2 are OCI-AML3 cell groups 1 and 2 with hsa_circ_0008135 knockdown, respectively. shNC is OCI-AML3 cells, serving as the control group.
[0082] The right side is a statistical chart confirming the effect of overexpressing hsa_circ_0008135. circRNA represents the OCI-AML3 cell group overexpressing hsa_circ_0008135, and Vector represents the OCI-AML3 cells transfected with Vector, which served as the control group.
[0083] Figure 6Statistical graph of the relative absorbance values of OCI-AML3 cells with hsa_circ_0008135 knockdown compared with the control group at 0, 1, 2, 3, and 4 days of culture. Groups 1 and 2 of OCI-AML3 cells with hsa_circ_0008135 knockdown are represented by shhsa_circ_0008135#1 and shhsa_circ_0008135#2, respectively, and the control group is represented by shNC.
[0084] Figure 7 Statistical graph of the relative absorbance values of OCI-AML3 cells overexpressing hsa_circ_0008135 compared with the control group at 0, 1, 2, 3, and 4 days of culture. The OCI-AML3 cell group overexpressing hsa_circ_0008135 is represented by hsa_circ_0008135, and the control group is represented by Vector.
[0085] Figure 8 After culturing for 3 hours, DAPI, EDU, and Merge staining photos of OCI-AML3 cells with hsa_circ_0008135 knockdown and control cells (left) and EDU + Statistical graph of the percentage of cells (right);
[0086] Figure 9 After culturing for 3 hours, DAPI, EDU, and Merge staining photos of OCI-AML3 cells overexpressing hsa_circ_0008135 and controls (left) and EDU + Statistical graph of the percentage of cells (right);
[0087] Figure 10 , Under an inverted microscope, the cell colony morphology (left) and colony formation rate statistics (right) of the OCI-AML3 cell group with hsa_circ_0008135 knockdown and the control group;
[0088] Figure 11 , Under an inverted microscope, the cell colony morphology (left) and colony formation rate statistics (right) of the OCI-AML3 cell group overexpressing hsa_circ_0008135 and the control group;
[0089] Figure 12 , Statistical graph of relative iron levels in OCI-AML3 cells with hsa_circ_0008135 knockdown;
[0090] Figure 13 , Statistical graph of relative iron levels in OCI-AML3 cells overexpressing hsa_circ_0008135;
[0091] Figure 14, Statistical graph of relative ROS levels in OCI-AML3 cells with hsa_circ_0008135 knockdown;
[0092] Figure 15 , Statistical graph of relative ROS levels in OCI-AML3 cells overexpressing hsa_circ_0008135;
[0093] Figure 16 , statistical graph of relative expression of SLC7A11 protein in OCI-AML3 cells with hsa_circ_0008135 knockdown;
[0094] Figure 17 , statistical graph of relative expression of SLC7A11 protein in OCI-AML3 cells overexpressing hsa_circ_0008135;
[0095] Figure 18 , Statistical graph of hsa_circ_0004277 expression levels in seven myeloid leukemia cells detected by qRT-PCR;
[0096] Figure 19 , qRT-PCR method detected the expression level of hsa_circ_00750 in 7 myeloid leukemia cells;
[0097] Figure 20 , Statistical graph of the relative absorbance values of OCI-AML3 cells with circ_ZBTB46 knockdown compared with the control at 0, 1, 2, 3, and 4 days of culture;
[0098] Figure 21 , Statistical graph of the relative absorbance values of OCI-AML3 cells overexpressing circ_ZBTB46 compared with the control on days 0, 1, 2, 3, and 4 of culture;
[0099] Figure 22 , Statistical graph of the relative absorbance values of OCI-AML3 cells with hsa_circ_0000370 knockdown compared with the control on days 0, 1, 2, 3, and 4 of culture;
[0100] Figure 23 , Statistical graph of the relative absorbance values of OCI-AML3 cells overexpressing hsa_circ_0000370 compared with the control on days 0, 1, 2, 3, and 4 of culture;
[0101] in Figure 1-Figure 23 middle,
[0102] *, **, *** and **** represent P < 0.05, P < 0.01, P < 0.001 and P < 0.0001, respectively, indicating that the difference between the two groups was statistically significant. DETAILED DESCRIPTION
[0103] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.
[0104] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.
[0105] Unless otherwise specified, all materials and reagents in the following examples can be obtained from commercial sources.
[0106] Biomaterials
[0107]
[0108] Reagents and materials
[0109]
[0110]
[0111] instrument
[0112]
[0113] Reagent preparation
[0114] 12% separating gel preparation (15 mL): 4.9 mL of ddH2O, 6.0 mL of 30% acrylamide, 3.8 mL of 1.0 M Tris-HCl (pH 8.8), 150 μL of 10% SDS, 150 μL of 10% AP, and 6 μL of TEMED, and mix well.
[0115] Preparation of 5% stacking gel (5 mL): 3.5 mL of ddH2O, 830 μL of 30% acrylamide, 630 μL of 1.0 M Tris-HCl (pH 6.8), 50 μL of 10% SDS, 50 μL of 10% AP and 5 μL of TEMED, and mix well.
[0116] Protein lysis buffer: Prepared with RIPA lysis buffer and protease inhibitor PMSF at a ratio of 100:1.
[0117] Transfer buffer: Dissolve 14.4 g of glycine, 3.05 g of Tris-base, and 200 mL of methanol in 800 mL of ddH2O and store at 4°C.
[0118] Example 1: Analysis of hsa_circ_0008135 expression in patients with NPM1-mutated AML
[0119] 1. Methods
[0120] The circRNA expression microarray data of AML patients with NPM1 mutation (3 cases), AML patients without NPM1 mutation (3 cases), and healthy controls (4 cases) were downloaded from GEO (GSE94591). The R package “limma” was used to identify differentially expressed circRNAs between patients with NPM1 mutation and AML without NPM1 mutation, and circRNAs between patients with NPM1 mutation and healthy controls, and the circRNAs were visualized using GraphPad Prism (Version 7.00) software.
[0121] 2. Results
[0122] like Figure 1 As shown in A, compared with the circRNAs of non-NPM1 mutant AML patients, there are four circRNAs that are significantly overexpressed in NPM1 mutant AML patients: hsa_circ_0008135, hsa_circ_0012717, hsa_circ_0082353, and hsa_circ_0027506;
[0123] like Figure 1 As shown in B, compared with the circRNAs of healthy controls, 137 circRNAs were significantly overexpressed in NPM1-mutated AML patients, including hsa_circ_0008135;
[0124] like Figure 1 As shown in C, hsa_circ_0008135 belongs to Figure 1 One of the four relatively highly expressed circRNAs in A also belongs to Figure 1 It was one of the 137 relatively highly expressed circRNAs in B, therefore, hsa_circ_0008135 was selected for subsequent experiments;
[0125] The structural diagram of hsa_circ_0008135 is as follows Figure 2 As shown, sequence:>hsa_circ_0008135|NM_001145722|HOMER3
[0126] GGGCCAAACCAGTGCTCCTGCCACCTCTCTGGCTGCCCCCTAGAGCCTGCCCATCCCAGCCTGACCAAGTTCCAGCCAGGGAGCAGCCAATCTTCAGCACACGGGGCGCACGTGTTCCAAATTGACCCAGCCACCAAGCGAAACTGGATCCCAGCGGGCAAGCACGCACTCACTGTCTCCTATTTC TACGATGCCACCCGCAATGTGTACCGCATCATCAGCATCGGAGGCGCCAAGGCCATCATCAACAGCACTGTCACTCCCAACATGACCTTCACCAAAACTTCCCAGAAGTTCGGGCAGTGGGCCGACAGTCGCCAACACAGTCTACGGCCTGGGCTTTGCCTCTGAACAGCATCTGACACAG(SEQ ID NO:1)
[0127] Structure Description: Hsa_circ_0008135 is located on chromosome 19p13.11 (chr19:19049161-19049858) and is an exonic circular RNA. The context of hsa_circ_0008135 is HOMER3, derived from back-splicing of the HOMER3 transcript (NM_001145722), with a sequence length of 370 bp.
[0128] Example 2: qRT-PCR detection of differences in hsa_circ_0008135 gene expression levels in clinical samples
[0129] To investigate the differential expression of hsa_circ_0008135 in NPM1-mutated AML and non-NPM1-mutated AML, qRT-PCR was used to detect the differential expression of hsa_circ_0008135 in the bone marrow clinical samples of patients with NPM1-mutated AML and those with non-NPM1-mutated AML.
[0130] 1. Methods
[0131] 1. Extract primary leukemia cells from patient bone marrow clinical samples
[0132] Clinical bone marrow samples from 23 patients with NPM1 mutation AML and 49 patients with non-NPM1 mutation AML were collected.
[0133] Take a 15mL centrifuge tube, add a volume of mononuclear cell separation solution equal to that of the bone marrow sample, then carefully draw the bone marrow sample with a pipette and add it to the liquid surface of the mononuclear cell separation solution, centrifuge at room temperature, 1000rpm×30min; carefully take out the tube after centrifugation, observe the centrifuge tube, and find that the bone marrow sample in the tube is clearly divided into four layers. Use a pipette to carefully draw down the milky white mononuclear cell layer from the second layer from the top to the bottom along the inner wall of the centrifuge tube, and transfer it to a new centrifuge tube; add 8mL of PBS solution, mix evenly, centrifuge at room temperature, 2000rpm×10min; discard the supernatant, repeat the above operation three times, and finally add 200μL of PBS to resuspend the cell pellet to obtain primary leukemia cell suspension.
[0134] 2. RNA Extraction
[0135] Collect leukemia cells in the logarithmic growth phase, centrifuge at 500 rpm for 5 minutes, remove the supernatant, wash three times with pre-cooled PBS, and centrifuge at 3,000 rpm for 3 minutes; then, discard the supernatant and add 1 mL of The RNA extraction reagent TRIzol was thoroughly vortexed and allowed to stand on ice for 10 minutes. Subsequently, 200 μL of chloroform was added and the tube was mixed by inversion several times. After standing on ice, the tube was centrifuged at 12,000 g for 15 minutes at 4°C. The supernatant was aspirated into a new pre-chilled enzyme-free EP tube, and an equal volume of isopropanol as the chloroform was added. The tube was mixed up and down, and after standing on ice, the tube was centrifuged at 12,000 g at 4°C for 10 minutes. The supernatant was discarded, and 1 mL of freshly prepared 75% ethanol solution was added to wash the precipitate. The precipitate was centrifuged at 12,000 g at 4°C for 15 minutes. The supernatant was discarded and the tube was allowed to stand for 3-5 minutes to allow the ethanol to evaporate completely. After that, an appropriate amount of RNase-free double-distilled water was added to dissolve the precipitate. Finally, the RNA concentration and purity were determined using a NanoDrop one ultramicro spectrophotometer.
[0136] 3. Reverse transcription
[0137] Prepare the reverse transcription system according to Table 1 and perform reverse transcription.
[0138] Table 1. Reverse transcription reaction system
[0139]
[0140] Reaction procedure: 37°C × 15 min, 85°C × 5 s, cooling at 4°C. cDNA was stored at -20°C.
[0141] 4. qRT-PCR
[0142] Prepare the qRT-PCR reaction system according to Table 2, and perform real-time fluorescence quantitative PCR reaction.
[0143] Table 2. qRT-PCR reaction system
[0144]
[0145] Reaction procedure: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 10 s, 58℃ annealing for 30 s, 40 cycles in total, and 72℃ full extension for 10 s. –ΔΔCt Calculate the relative quantitative value results. The primers for each gene were synthesized by Shanghai Sangon Co., Ltd., and the sequences are shown in Table 3.
[0146] Table 3. qRT-PCR primer sequences
[0147]
[0148] 2. Results
[0149] like Figure 3 As shown in the results, the expression level of hsa_circ_0008135 in patients with NPM1 mutation acute myeloid leukemia (AML) (n=23) was significantly higher than that in patients with non-NPM1 mutation acute myeloid leukemia (AML) (n=49).
[0150] Example 3: Cultivation of 7 Myeloid Leukemia Cells
[0151] The culture medium required for the growth of OCI-AML3 and OCI-AML2 cells is composed of RPMI-1640 culture medium, Australian fetal bovine serum, and penicillin-streptomycin solution (100 U / mL) in a ratio of 100:10:1. The cells are cultured in a 37°C, 5% CO2 incubator. Cells are passaged every 2-3 days on average to maintain logarithmic growth.
[0152] The culture medium required for the growth of KG-1α cells, THP-1 cells, HL-60 cells, U937 cells, and NB4 cells is prepared with RPMI-1640 culture medium, South American fetal bovine serum, and penicillin-streptomycin solution (100 U / mL) in a ratio of 100:10:1. Cultures were placed in a 37°C, 5% CO2 incubator. Cells were passaged every 1-2 days on average to maintain logarithmic growth.
[0153] Example 4. Detection of the expression level of hsa_circ_0008135 in seven myeloid leukemia cell lines I. Method
[0154] The expression level of hsa_circ_0008135 in OCI-AML3, OCI-AML2, KG-1α, THP-1, HL-60, U937 and NB4 cell lines was detected according to the qRT-PCR method in Example 2.
[0155] 2. Results
[0156] like Figure 4As shown in the figure, hsa_circ_0008135 is expressed to varying degrees in leukemia cell lines. Compared with OCI-AML3 cells carrying NPM1-mA, hsa_circ_0008135 was significantly down-expressed in NB4, THP-1, HL-60, U937, OCI-AML2, and KG-1α cells, with P values of 0.001, 0.01, 0.01, 0.05, 0.01, and 0.01, respectively.
[0157] 3. Conclusion
[0158] Compared with six myeloid leukemia cell lines including NB4, hsa_circ_0008135 was relatively highly expressed in OCI-AML3, a leukemia cell line naturally carrying NPM1 gene mutation.
[0159] Example 5. Knockdown of hsa_circ_0008135 and Confirmation of the Effect
[0160] 1. Methods for knocking down hsa_circ_0008135
[0161] Lentiviral infection of OCI-AML3 cells and selection of cell lines stably infected with shhsa_circ_0008135: First, cells in the logarithmic growth phase were collected and seeded into new 24-well plates to ensure a density of 1×10 per well. 5 cells; then, 25-60 μL of 1×10 8 TU / mL of virus solution and 20 μL of HitransGP were added, and the cell suspension in each well was made up to 500 μL using cell culture medium and mixed thoroughly. After culturing in a 37°C, 5% CO2 incubator for 48-72 hours, the cell status and fluorescence intensity were observed, and the culture dish and fresh culture medium were replaced. Finally, when the infection efficiency reached 80%, 2 μg / mL of puromycin was added for selection for 7-14 days to obtain a stably transfected cell line, which was then expanded and used for subsequent experiments.
[0162] The control group consisted of OCI-AML3 cells infected with shNC, indicated by shNC in the accompanying figures;
[0163] The sample group was divided into two groups, namely OCI-AML3 cell group 1 and group 2 with hsa_circ_0008135 knockdown, represented by shcircRNA#1 and shcircRNA#2 in the figures, respectively;
[0164] The sequences of the lentivirus and shNC used to knock down hsa_circ_0008135 are as follows:
[0165]
[0166] 2. qRT-PCR confirmation of the effect of knockdown of hsa_circ_0008135
[0167] According to the method of Example 2, qRT-PCR was used to confirm the effect of knocking down hsa_circ_0008135.
[0168] 3. Results
[0169] like Figure 5 As shown on the left, compared with the control group, the relative expression of hsa_circ_0008135 in OCI-AML3 cell groups 1 and 2 with hsa_circ_0008135 knockdown was significantly decreased, and the P values were all less than 0.01.
[0170] Example 6: Overexpression of hsa_circ_0008135 and Confirmation of Effect
[0171] 1. Overexpression of hsa_circ_0008135
[0172] OCI-AML3 cells were seeded in 6-well plates to ensure that the cell volume was 10 6 / well; transfect the overexpression plasmid or its control vector into OCI-AML3 cells using Lipofectamine 2000, ensure that the transfection mixture and cell suspension are fully mixed, and then place the cells in a cell culture incubator for 12-72 hours for subsequent experiments.
[0173] The control group consisted of OCI-AML3 cells transfected with Vector, which is represented by Vector in the accompanying figures;
[0174] The sample group consisted of OCI-AML3 cells transfected with an overexpression plasmid, represented by circRNA in the accompanying figures. The sequences of the hsa_circ_0008135 overexpression plasmid and vector are shown in the following table:
[0175]
[0176] 2. qRT-PCR confirmation of the effect of overexpression of hsa_circ_0008135
[0177] According to the method of Example 2, qRT-PCR was used to confirm the effect of overexpressing hsa_circ_0008135.
[0178] 3. Results
[0179] like Figure 5 As shown on the right, the relative expression of hsa_circ_0008135 in OCI-AML3 cells overexpressing hsa_circ_0008135 was significantly increased compared with the control group, P < 0.001.
[0180] Example 7: CCK8 detection of the effect of knockdown of hsa_circ_0008135 on the proliferation of OCI-AML3 cells
[0181] 1. Methods
[0182] The relative absorbance value of OCI-AML3 cells with hsa_circ_0008135 knockdown was detected according to the CCK8 kit instructions.
[0183] In a 96-well plate, 3 The control group, hsa_circ_0008135 knockdown OCI-AML3 cell group 1, and group 2 were inoculated with 100 μL of cell suspension per well, and 6 replicate wells were set for each sample. The cells were cultured in a cell culture incubator (37°C, 5% CO2). On the 0th, 1st, 2nd, 3rd, and 4th day of culture, the cell plates were removed, and 10 μL of CCK8 reagent was added to each well in the dark. After gently tapping to mix, the cells were placed in a cell culture incubator for another 3 hours. The absorbance of each well at a wavelength of 450 nm was detected, and the corresponding cell proliferation curve was drawn.
[0184] The method for obtaining hsa_circ_0008135 knockdown OCI-AML3 cells was the same as in Example 5; the control group was OCI-AML3 cells stably infected with shNC.
[0185] 2. Results
[0186] like Figure 6 As shown in the figure, after 4 days of culture, the relative absorbance values of hsa_circ_0008135 knockdown OCI-AML3 cell groups 1 and 2 were significantly decreased compared with the control group, and the P values were all less than 0.001.
[0187] 3. Conclusion
[0188] CCK8 detection results confirmed that the proliferation of OCI-AML3 cells with hsa_circ_0008135 knockdown was significantly inhibited.
[0189] Example 8: CCK8 detection of the effect of overexpression of hsa_circ_0008135 on the proliferation of OCI-AML3 cells
[0190] 1. Methods
[0191] CCK8 was used to detect the proliferation of OCI-AML3 cells overexpressing hsa_circ_0008135, using the same method as in Example 7. The method for obtaining OCI-AML3 cells overexpressing hsa_circ_0008135 was the same as in Example 6. The control group was OCI-AML3 cells transfected with Vector.
[0192] 2. Results
[0193] like Figure 7 As shown in Figure 3, on day 4 of culture, the relative absorbance value of OCI-AML3 cells overexpressing hsa_circ_0008135 was significantly increased compared with the control group (P < 0.01).
[0194] 3. Conclusion
[0195] CCK8 detection results confirmed that the proliferation of OCI-AML3 cells overexpressing hsa_circ_0008135 was significantly increased.
[0196] Example 9: EdU detection of the effect of knockdown of hsa_circ_0008135 on the proliferation of OCI-AML3 cells
[0197] EdU was detected in OCI-AML3 cells with hsa_circ_0008135 knockdown according to the EdU kit instructions. + Cell percentage.
[0198] 1. Methods
[0199] The control group cells, the hsa_circ_0008135 knockdown OCI-AML3 cell #1 group, and the hsa_circ_0008135 knockdown OCI-AML3 cell #2 group were respectively 6 / well of cells were inoculated into a 6-well plate, and the cell suspension in each well was prepared to 2 mL using cell culture medium; 2 mL of pre-prepared 2×EdU working solution of equal volume to the cell suspension was added, and the cells were placed in a 37°C, 5% CO2 incubator and cultured for 3 hours; the cells were collected and centrifuged at room temperature, 800 rpm×5 min; the cells were washed 3 times with pre-cooled 1×PBS, 2000 rpm×3 min; 200 μL of PBS was added to resuspend the cell pellet, mixed thoroughly, and evenly spread on the glass slide placed in the six-well plate, and dried at room temperature; immunostaining fixative was added dropwise, and the slides were placed at room temperature for 15 minutes; 1 mL of pre-cooled PBS was added to wash the slides, and the wash was performed 3 times, 5 minutes each time; the residual PBS on the slides was carefully aspirated, 200 μL of PBS-Triton X-100 was added dropwise, and the slides were permeabilized at room temperature for 20 minutes; the residual PBS on the slides was carefully aspirated, 600 μL of Click reaction solution was added dropwise, and the slides were incubated at room temperature for 30 minutes in the dark;
[0200] Aspirate the residual Click reaction solution on the slide in the dark, add 1 mL of PBS solution, and let it stand for 5 minutes; discard the residual PBS on the slide, add 500 μL of nuclear dye DAPI staining solution, and stain at room temperature in the dark for 15 minutes; seal the slide with blocking solution, observe and photograph under a fluorescence microscope, and store at 4°C in the dark.
[0201] The method for obtaining hsa_circ_0008135 knockdown OCI-AML3 cells is shown in Example 5; the control group was OCI-AML3 cells infected with shNC.
[0202] 2. Results
[0203] like Figure 8 As shown, compared with the control group, the EdU + The percentage of cells was significantly decreased, and the P values were all less than 0.01.
[0204] 3. Conclusion
[0205] EDU detection results confirmed that the proliferation of OCI-AML3 cells was significantly inhibited by knockdown of hsa_circ_0008135.
[0206] Example 10: EdU detection of the effect of overexpression of hsa_circ_0008135 on the proliferation of OCI-AML3 cells
[0207] 1. Methods
[0208] EdU detection of OCI-AML3 cells overexpressing hsa_circ_0008135. The EdU detection method is shown in Example 9. The method for obtaining OCI-AML3 cells overexpressing hsa_circ_0008135 is shown in Example 6.
[0209] 2. Results
[0210] like Figure 9 As shown, compared with the control group, the EdU + The percentage of cells increased significantly.
[0211] 3. Conclusion
[0212] EDU detection results confirmed that the proliferation of OCI-AML3 cells overexpressing hsa_circ_0008135 was significantly increased.
[0213] Example 11: Clone formation assay: Effect of knockdown of hsa_circ_0008135 on OCI-AML3 cell proliferation
[0214] 1. Methods
[0215] Control cells, hsa_circ_0008135 knockdown OCI-AML3 cell group 1, and hsa_circ_0008135 knockdown OCI-AML3 cell group 2 were seeded at 300 cells / well in 24-well plates. The culture volume was supplemented with RPMI 1640 containing 20% FBS to 750 μL, and three to five replicates were performed for each group. 750 μL of pre-prepared 2.7% methylcellulose (sterile) was added to each well, mixed with a sterile pipette tip, and cultured in a conventional cell culture incubator for 7 to 14 days. Cell growth was observed. After colonies formed, colony morphology was observed under an inverted microscope, the number of clones was counted, and the cloning efficiency was calculated.
[0216] Clone formation rate = number of clones formed / number of cells seeded × 100%.
[0217] 2. Results
[0218] like Figure 10 As shown in the figure, compared with the control group, the cell colonies of OCI-AML3 cell groups 1 and 2 with hsa_circ_0008135 knockdown became smaller, and the colony formation rate was significantly reduced, with P values less than 0.01.
[0219] 3. Conclusion
[0220] The results of clone formation assay confirmed that the proliferation of OCI-AML3 cells with hsa_circ_0008135 knockdown was significantly inhibited.
[0221] Example 12: Clone formation assay: Effect of overexpression of hsa_circ_0008135 on the proliferation of OCI-AML3 cells
[0222] 1. Methods
[0223] The proliferation of OCI-AML3 cells overexpressing hsa_circ_0008135 was detected by cloning. The cloning detection method is shown in Example 11. The method for obtaining OCI-AML3 cells overexpressing hsa_circ_0008135 is shown in Example 6.
[0224] 2. Results
[0225] like Figure 11 As shown in the results, compared with the control group, the colonies of OCI-AML3 cells overexpressing hsa_circ_0008135 became larger and the colony formation rate was significantly increased, with P values less than 0.01.
[0226] 3. Conclusion
[0227] The results of clone formation assay confirmed that the proliferation of OCI-AML3 cells overexpressing hsa_circ_0008135 was significantly increased.
[0228] Based on the results of Examples 7-12: Knockdown of hsa_circ_0008135 inhibited the proliferation of OCI-AML3 cells; overexpression of hsa_circ_0008135 promoted the proliferation of OCI-AML3 cells.
[0229] Example 13. Effect of knockdown of hsa_circ_0008135 on iron levels in OCI-AML3 cells
[0230] The iron level of OCI-AML3 cells with hsa_circ_0008135 knockdown was detected according to the instructions of the iron assay kit.
[0231] 1. Methods
[0232] OCI-AML3 cells with hsa_circ_0008135 knockdown and control group cells (OCI-AML3 cells stably infected with shNC) in the logarithmic phase were taken and inoculated into six-well plates for cell culture. When the cells showed logarithmic growth, the cell suspension was transferred to a 1.5 mL EP tube and centrifuged at 1000 rpm in a centrifuge for 5 minutes. The supernatant was discarded, and iron assay buffer was added to the EP tube and centrifuged at 16000 rpm for 10 minutes. The supernatant was aspirated and placed in a new 1.5 mL EP tube and allowed to stand on ice. The supernatant and the prepared standard were added to a 96-well plate, 5 μL of iron reducing agent was added to each well, incubated at 37°C for 30 minutes, and then 100 μL of iron detection reagent was added to each well and incubated at 37°C for 60 minutes. The 96-well plate was placed in a multifunctional microplate reader to measure the absorbance of each group at a wavelength of 590 nm, and the iron content of each group was determined according to the standard curve.
[0233] The methods for obtaining hsa_circ_0008135 knockdown OCI-AML3 cells and control group cells are shown in Example 5.
[0234] 2. Results
[0235] like Figure 12 As shown in the figure, compared with the control group, the relative iron levels in OCI-AML3 cell groups 1 and 2 with hsa_circ_0008135 knockdown were significantly increased, and the P values were all less than 0.001.
[0236] 3. Conclusion
[0237] Knockdown of hsa_circ_0008135 significantly increased the relative iron level in OCI-AML3 cells.
[0238] Example 14. Effect of overexpression of hsa_circ_0008135 on iron levels in OCI-AML3 cells
[0239] The iron level of OCI-AML3 cells overexpressing hsa_circ_0008135 was detected according to the instructions of the iron assay kit.
[0240] 1. Methods
[0241] OCI-AML3 cells overexpressing hsa_circ_0008135 and control group cells (OCI-AML3 cells transfected with Vector) were seeded into six-well plates for cell culture. The method for detecting the iron level of OCI-AML3 cells is detailed in Example 13.
[0242] The methods for obtaining OCI-AML3 cells overexpressing hsa_circ_0008135 and control group cells are shown in Example 6.
[0243] 2. Results
[0244] like Figure 13 As shown, the relative iron level of the OCI-AML3 cell group overexpressing hsa_circ_0008135 was decreased compared with the control group.
[0245] 3. Conclusion
[0246] Overexpression of hsa_circ_0008135 can reduce the relative iron level in OCI-AML3 cells.
[0247] Example 15. Effect of knockdown of hsa_circ_0008135 on ROS levels in OCI-AML3 cells
[0248] The ROS level of OCI-AML3 cells with hsa_circ_0008135 knockdown was detected according to the ROS kit instructions.
[0249] 1. Methods
[0250] Take the logarithmic phase of OCI-AML3 cells with hsa_circ_0008135 knockdown and the control group cells (OCI-AML3 cells infected with shNC), pipette and mix, transfer to 24-well plates, and place in a 37°C constant temperature incubator for incubation for 12 hours. The final concentration of DCFH-DA is configured to be 10umol / l. Remove the 24-well plate, centrifuge the cell suspension, discard the supernatant, add an appropriate volume of diluted DCFH-DA, pipette and mix, and place in a constant temperature incubator incubated in the dark. Flow cytometry is used for detection, using an excitation wavelength of 488nm and an emission wavelength of 525nm. The FITC parameter setting is used to detect DCF. The average fluorescence intensity of each group of cells reflects the level of ROS in the cells.
[0251] The methods for obtaining hsa_circ_0008135 knockdown OCI-AML3 cells and control group cells are shown in Example 5.
[0252] 2. Results
[0253] like Figure 14 As shown in the figure, compared with the control group, the ROS levels in OCI-AML3 cell groups 1 and 2 with hsa_circ_0008135 knockdown were significantly increased, and the P values were all less than 0.01.
[0254] 3. Conclusion
[0255] Knockdown of hsa_circ_0008135 promoted ROS expression in OCI-AML3 cells.
[0256] Example 16. Effect of overexpression of hsa_circ_0008135 on ROS levels in OCI-AML3 cells
[0257] The ROS level in OCI-AML3 cells overexpressing hsa_circ_0008135 was detected according to the ROS kit instructions.
[0258] 1. Methods
[0259] OCI-AML3 cells overexpressing hsa_circ_0008135 and control group cells (OCI-AML3 cells transfected with Vector) were seeded into six-well plates for cell culture. The detection of ROS levels in OCI-AML3 cells is detailed in Example 15; the method for obtaining OCI-AML3 cells overexpressing hsa_circ_0008135 and control group cells is detailed in Example 6.
[0260] 2. Results
[0261] like Figure 15As shown in Figure 3, the ROS level in OCI-AML3 cells overexpressing hsa_circ_0008135 was significantly decreased compared with the control group, with a P value less than 0.01.
[0262] 3. Conclusion
[0263] Overexpression of hsa_circ_0008135 reduced ROS expression in OCI-AML3 cells.
[0264] Example 17: Effect of knockdown of hsa_circ_0008135 on SLC7A11 protein levels in OCI-AML3 cells
[0265] SLC7A11 protein level is a key molecule in ferroptosis. Western blotting was used to detect the SLC7A11 protein level in OCI-AML3 cells.
[0266] 1. Methods
[0267] 1. Protein extraction: Collect an appropriate amount of hsa_circ_0008135 knockdown OCI-AML3 cells and control cells (shNC-infected OCI-AML3 cells) in good logarithmic phase growth using centrifuge tubes, centrifuge at 1,000 rpm × 5 min to remove the supernatant, resuspend in 1 mL of pre-chilled PBS, centrifuge at 4,000 rpm × 5 min to remove the supernatant, repeat washing three times, retain the cell pellet, add about 2-3 times the volume of the pellet to protein lysis buffer (RIPA lysis buffer and protease inhibitor PMSF prepared at 100:1), and mix thoroughly by pipetting; lyse the cells on ice for 30 min, vortex every 5 min, repeat 6 times, and centrifuge at 4°C 12,000 rpm for 30 min; aspirate the supernatant solution into a pre-chilled new EP tube, which is the required total protein solution. The protein concentration is determined by BCA method. The remaining protein sample is added to 5× loading buffer, denatured by boiling, and stored at -80°C;
[0268] The methods for obtaining hsa_circ_0008135 knockdown OCI-AML3 cells and control group cells are shown in Example 5.
[0269] 2. SDS-PAGE gel electrophoresis: Prepare 12% separation gel and 5% stacking gel. After slowly and evenly pouring the gel, slowly add an appropriate amount of anhydrous ethanol to the surface of the gel and let it stand at 37°C for 30 minutes. Discard the anhydrous ethanol and pour the prepared 5% stacking gel on the upper layer of the completely solidified separation gel. Insert a tooth comb and let it stand at 37°C for 30 minutes. Carefully remove the tooth comb and add 1× SDS running buffer to cover the sample wells. Add 50μg of denatured protein sample to the sample wells and add protein markers to the wells on both sides of the sample as a molecular weight reference. After filling the glass plate with running buffer, separate the proteins by two-step electrophoresis: first step, voltage 80V, current 150mA, 30 minutes; second step, electrophoresis 120V, current 200mA, 60-90 minutes.
[0270] 3. Transfer: After electrophoresis, first cut the appropriate gel and cut the corresponding PVDF membrane according to the molecular weight of the protein to be tested. Soak the cut gel in pre-cooled wet transfer buffer. Soak the cut PVDF membrane in methanol for 15 seconds and wash with distilled water for 2 minutes. Then soak the PVDF membrane and filter paper in pre-cooled wet transfer buffer. Finally, place the sponge, filter paper, PVDF membrane and gel in the order from positive to negative pole, and transfer the membrane at a constant current of 210mA.
[0271] 4. Blocking: After transfer, place the polyvinylidene fluoride membrane in 5% protein blocking solution and block at room temperature for 2 hours;
[0272] 5. Antibody incubation: First, wash the remaining blocking solution on the membrane with TBST; after absorbing the remaining liquid on the membrane with qualitative filter paper, place the membrane on a wax plate, add pre-diluted primary antibody working solution to evenly cover the polyvinylidene fluoride membrane, and incubate at 4°C overnight; after recovering the primary antibody working solution, place the polyvinylidene fluoride membrane in TBST and wash it three times, each time for 10 minutes; finally, add pre-diluted horseradish peroxidase-labeled secondary antibody to the polyvinylidene fluoride membrane, incubate at room temperature for 1 hour, and wash it three times with TBST, each time for 10 minutes;
[0273] 6. Color development: In a dark room, place the polyvinylidene fluoride film on a chemiluminescent plate, then add a pre-configured chemiluminescent reagent to evenly cover the polyvinylidene fluoride film, and display the image on an imaging system.
[0274] 2. Results
[0275] like Figure 16 As shown in Figure 3, SLC7A11 protein was significantly decreased in both OCI-AML3 cell groups 1 and 2 with hsa_circ_0008135 knockdown compared with the control group.
[0276] 3. Conclusion
[0277] Knockdown of hsa_circ_0008135 inhibited SLC7A11 protein expression in OCI-AML3 cells.
[0278] Example 18. Effect of overexpression of hsa_circ_0008135 on SLC7A11 protein levels in OCI-AML3 cells
[0279] 1. Methods
[0280] The samples were OCI-AML3 cells overexpressing hsa_circ_0008135 and control cells (OCI-AML3 cells transfected with Vector). The SLC7A11 protein level detection in OCI-AML3 cells is detailed in Example 17; the method for obtaining OCI-AML3 cells overexpressing hsa_circ_0008135 and control cells is detailed in Example 6.
[0281] 2. Results
[0282] like Figure 17 As shown in Figure 3, the SLC7A11 protein level in the OCI-AML3 cell group overexpressing hsa_circ_0008135 was significantly increased compared with the control group.
[0283] 3. Conclusion
[0284] Overexpression of hsa_circ_0008135 promoted the level of SLC7A11 protein in OCI-AML3 cells.
[0285] The results of Examples 13-18 showed that knockdown of hsa_circ_0008135 promoted ferroptosis in OCI-AML3 cells; overexpression of hsa_circ_0008135 inhibited ferroptosis in OCI-AML3 cells.
[0286] Comparative Example 1: Detection of the expression levels of hsa_circ_0004277 and hsa_circ_00750 disclosed in reference [1] in 7 myeloid leukemia cell lines
[0287] 1. Methods
[0288] The expression levels of hsa_circ_0004277 and hsa_circ_00750 in OCI-AML3, OCI-AML2, KG-1α, THP-1, HL-60, U937 and NB4 cell lines were detected according to the qRT-PCR method in Example 2.
[0289] 2. Results
[0290] like Figure 18As shown in the figure, hsa_circ_0004277 is expressed to varying degrees in all leukemia cell lines. Compared with OCI-AML3 cells carrying NPM1-mA, there is no difference in the expression of hsa_circ_0004277 in NB4, THP-1, HL-60, U937, OCI-AML2, and KG-1α cells.
[0291] like Figure 19 As shown in the figure, hsa_circ_00750 is expressed to varying degrees in all leukemia cell lines. Compared with OCI-AML3 cells carrying NPM1-mA, there is no difference in the expression of hsa_circ_00750 in NB4, THP-1, HL-60, U937, OCI-AML2, and KG-1α cells.
[0292] 3. Conclusion
[0293] The two circRNAs hsa_circ_0004277 and hsa_circ_00750 mentioned in reference [1] showed no significant expression difference in the seven myeloid leukemia cell lines. In addition, there was no statistical difference in the expression of hsa_circ_0004277 and hsa_circ_00750 in NPM1-mutated acute myeloid leukemia and non-NPM1-mutated acute myeloid leukemia, indicating that hsa_circ_0004277 and hsa_circ_00750 are not specifically expressed in NPM1-mutated leukemia, so no further study is needed.
[0294] Comparative Example 2: Effect of knockdown of circ_ZBTB46 (described in reference [4]) by CCK8 on the proliferation of OCI-AML3 cells
[0295] 1. Methods
[0296] CCK8 was used to detect the proliferation of OCI-AML3 cells with circ_ZBTB46 knockdown, and the method was referred to Example 7; the method for obtaining OCI-AML3 cells with circ_ZBTB46 knockdown was referred to Example 5; the control group was OCI-AML3 cells infected with siNC.
[0297] 2. Results
[0298] like Figure 20 As shown, there was no significant difference in the relative absorbance values of OCI-AML3 cells with circ_ZBTB46 knockdown compared with the control group at 0, 1, 2, 3, and 4 days of culture.
[0299] 3. Conclusion
[0300] CCK8 detection results confirmed that knockdown of circ_ZBTB46 had no effect on the proliferation of OCI-AML3 cells.
[0301] Comparative Example 3: Effect of overexpression of circ_ZBTB46 (described in reference [4]) on the proliferation of OCI-AML3 cells detected by CCK8
[0302] 1. Methods
[0303] CCK8 was used to detect the proliferation of OCI-AML3 cells overexpressing circ_ZBTB46, and the method was referred to Example 8. The method for obtaining OCI-AML3 cells overexpressing circ_ZBTB46 was referred to Example 6. The control group was OCI-AML3 cells transfected with Vector.
[0304] 2. Results
[0305] like Figure 21 As shown, at 0, 1, 2, 3, and 4 days of culture, the relative absorbance values of OCI-AML3 cells overexpressing circ_ZBTB46 had no significant differences compared with the control group.
[0306] 3. Conclusion
[0307] CCK8 detection results confirmed that overexpression of circ_ZBTB46 had no effect on the proliferation of OCI-AML3 cells.
[0308] The results of comparative examples 2 and 3 showed that circ_ZBTB46 had no effect on the proliferation of OCI-AML3 cells.
[0309] Comparative Example 4: Effect of knockdown of hsa_circ_0000370 (described in reference [4]) by CCK8 on the proliferation of OCI-AML3 cells
[0310] 1. Methods
[0311] CCK8 was used to detect the proliferation of OCI-AML3 cells with hsa_circ_0000370 knockdown, and the method was referred to Example 7. The method for obtaining OCI-AML3 cells with hsa_circ_0000370 knockdown was referred to Example 5. The control group was OCI-AML3 cells infected with siNC.
[0312] 2. Results
[0313] like Figure 22 As shown, there was no significant difference in the relative absorbance values of OCI-AML3 cells with hsa_circ_0000370 knockdown compared with the control group at 0, 1, 2, 3, and 4 days of culture.
[0314] 3. Conclusion
[0315] CCK8 detection results confirmed that knockdown of hsa_circ_0000370 had no effect on the proliferation of OCI-AML3 cells.
[0316] Comparative Example 5: Effect of overexpression of hsa_circ_0000370 (described in reference [6]) on the proliferation of OCI-AML3 cells detected by CCK8
[0317] 1. Methods
[0318] CCK8 was used to detect the proliferation of OCI-AML3 cells overexpressing hsa_circ_0000370, as described in Example 8. The method for obtaining OCI-AML3 cells overexpressing hsa_circ_0000370 was described in Example 6. The control group consisted of OCI-AML3 cells transfected with Vector.
[0319] 2. Results
[0320] like Figure 23 As shown in the figure, there was no significant difference in the relative absorbance values of OCI-AML3 cells overexpressing hsa_circ_0000370 compared with the control group at 0, 1, 2, 3, and 4 days of culture.
[0321] 3. Conclusion
[0322] CCK8 detection results confirmed that overexpression of hsa_circ_0000370 had no effect on the proliferation of OCI-AML3 cells.
[0323] The results of comparative examples 4 and 5 showed that circ_ZBTB46 had no effect on the proliferation of OCI-AML3 cells.
[0324] Statistical analysis of the data in the above examples was performed using GraphPad Prism 8.0.2. To meet statistical requirements, all data were expressed as mean ± standard deviation. One-way analysis of variance (ANOVA) and multiple-count tests were used to analyze the significance of differences between groups, and t-tests were used for comparisons between two groups. A P value of < 0.05 indicated a statistically significant difference.
[0325] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to be within the scope of protection claimed herein.
Claims
1. Use of a reagent for knocking down the expression level of hsa_circ_0008135 in the preparation of a product for acute myeloid leukemia with NPM1 mutation, characterized in that: The reagent is a lentivirus, and the RNA sequence of the lentivirus is shown as SEQ ID NO.6 or SEQ ID NO.
7.
2. The use according to claim 1, characterized in that Compared with patients with non-NPM1 mutated acute myeloid leukemia, the expression of hsa_circ_0008135 was significantly increased in patients with NPM1 mutated acute myeloid leukemia.
3. The use according to claim 1, characterized in that Compared with healthy controls, the expression of hsa_circ_0008135 was significantly increased in patients with acute myeloid leukemia with NPM1 mutations.
4. The use according to claim 1, wherein Compared with the control, the reagent for knocking down the expression level of hsa_circ_0008135 significantly inhibited the proliferation of OCI-AML3 cells.
5. The use according to claim 1, characterized in that Compared with the control, the reagent that knocked down the expression level of hsa_circ_0008135 significantly promoted ferroptosis in OCI-AML3 cells.
6. Use of an agent overexpressing hsa_circ_0008135 in a product for promoting NPM1-mutated acute myeloid leukemia, characterized in that: The application is for non-disease diagnosis and treatment purposes, the reagent is a plasmid overexpressing hsa_circ_0008135, and the RNA sequence of the plasmid overexpressing hsa_circ_0008135 is shown in SEQ ID NO.
9.
7. The use according to claim 6, characterized in that The reagent overexpressing hsa_circ_0008135 significantly promoted the proliferation of OCI-AML3 cells.
8. The use according to claim 6, characterized in that The reagent overexpressing hsa_circ_0008135 significantly inhibited ferroptosis in OCI-AML3 cells.
Citation Information
Patent Citations
Acute myelogenous leukemia biomarker, acute myelogenous leukemia classification model and risk factor prediction method
CN118745467A
Circular rnas for the diagnosis and treatment of brain disorders
US20210079474A1