Application of barnacle mucin in improvement of performance of silk and method of barnacle mucin

Abstract

The invention discloses application of barnacle mucin in improvement of silk performance and a method thereof, barnacle mucin is expressed in bombyx mori, the silk strength and Young modulus of an obtained bombyx mori strain are improved, the expression of foreign protein does not affect the growth and development of bombyx mori and the basic forming process of silk fibers, and the yield of the barnacle mucin is improved. Meanwhile, the mechanical property of the transgenic silk is improved, and a new thought is provided for genetic improvement of a silk material.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an application of barnacle mucin in improving silk properties and a method thereof. Background Art

[0002] Silk is synthesized and secreted by the silk gland of the silkworm, a silk-producing organ that synthesizes and secretes large quantities of silk protein. Silk is composed of fibroin and sericin. Fibroin, located in the interior and comprising approximately 70% of the silk, primarily provides load-bearing capacity; sericin, located on the surface of the single filament and comprising approximately 25%, acts as an adhesive. Silk is a multi-layered fiber with a primary structure consisting of an amino acid sequence. Secondary structures include β-sheets, α-helices, β-turns, and random coils. The tertiary structure is a β-nanocrystalline structure formed by further folding of the β-sheets, followed by a higher-level quaternary structure.

[0003] Silk fibers are widely used in the textile and beauty industries due to their softness, breathability, comfort, and moisture retention. With increasing understanding of silk's structure and properties and the continuous advancement of technology, silk fiber applications have gradually expanded to medicine, electronics, tissue engineering, and other fields. However, compared to spider silk, the mechanical properties of silk still have significant room for improvement. Therefore, many scientists are committed to improving the properties of silk to expand its applications.

[0004] The piggyBac-mediated transposon technology has successfully expressed exogenous spider silk proteins, a method for improving the mechanical properties of silk fibers. However, beyond spider silk proteins, scientists have also discovered proteins from other species with excellent properties and unique biological functions. Using other biological proteins to construct high-performance silk fibers has expanded the possibilities for the design and application of novel biomaterials.

[0005] Therefore, it is meaningful to use natural proteins to replace spider silk proteins to improve the properties of silk. Summary of the Invention

[0006] In view of this, one of the objects of the present invention is to provide an application of barnacle mucin in improving the performance of silk; the second object of the present invention is to provide a method for improving the performance of silk; and the third object of the present invention is to provide silk with improved performance by the method.

[0007] In order to achieve the above object, the present invention provides the following technical solutions: 1. Application of barnacle mucin in improving silk properties, the amino acid sequence of the barnacle mucin is shown in SEQ ID NO.1.

[0008] Preferably, the improvement of silk properties is to increase silk strength and Young's modulus.

[0009] 2. A method for improving silk performance, comprising recombinantly expressing barnacle mucin in silkworms to obtain silk with improved performance, wherein the amino acid sequence of the barnacle mucin is shown in SEQ ID NO.1.

[0010] Preferably, the recombinant expression of the barnacle mucin in silkworm is regulated by the Fib H promoter.

[0011] Preferably, the method for recombinantly expressing the barnacle mucin in silkworms is to link the sequence shown in SEQ ID NO.1 into a piggyBac vector, and then screen transgenic silkworms by microinjection, and the obtained silk has improved performance.

[0012] 3. The silk with improved properties by the method, wherein the properties are silk strength and Young's modulus.

[0013] The beneficial effects of the present invention are: the present invention provides a biological protein to improve the performance of silkworm silk, and a new silkworm strain is obtained through transgenic technology. The exogenous protein does not affect the growth and development of the silkworm and the basic formation process of silk fibers. At the same time, the mechanical properties of the transgenic silk are improved, which provides a new idea for the genetic improvement of silk materials. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] In order to make the purpose, technical solutions and beneficial effects of the present invention more clear, the present invention provides the following drawings for illustration: Figure 1 To screen positive individuals of transgenic silkworm; Figure 2 Western Blot detection for CP20K; Figure 3 To observe the growth and development of transgenic silkworms; Figure 4 This is the scanning electron microscopy observation of transgenic silkworm cocoons; Figure 5 Mechanical testing of genetically modified silkworm cocoons. DETAILED DESCRIPTION

[0015] The present invention will be further described below with reference to the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it. However, the embodiments are not intended to limit the present invention.

[0016] Example 1 To select a barnacle mucin fragment, we obtained the CP20K protein sequence from NCBI. The full-length protein contains 202 amino acids, of which amino acids 1-19 are a signal peptide, which we replaced with the Bombyx mori signal peptide. BamH I and Not I restriction sites were added to both ends of the sequence, respectively, and the sequence was optimized based on Bombyx mori codon preference. The designed sequence is shown in SEQ ID NO. 1.

[0017] GGATCCATGAGAGTGAAAACGTTCGTGATTTTGTGCTGCGCCCTGCAATACGTGGCTTACACAAACGCCCACGAAGAAGATGGTGTTTGCAACAGCAACGTCGTGCTACCACTGCGACGCTAACGGAGAGAACTGCTCATGTAACTGCGAACTGTTCGACTG CGAAGCTAAGAAGCCAGACGGTTCATACGCTCACCCTTGTAGGAGATGCGACGCTAATAACATCTGCAAATGCAGTTGCACAGCTATCCCTTGCAACGAGGACCATCCTTGTCACCACTGCCACGAAGAAGATGATGGTGACACACACTGCCACTGCTCATGCGA ACACTCACACGACCACCACGACGACGACACACACGGAGAATGCACAAAGAAGGCTCCATGCTGGAGATGCGAATACAACGCTGACTTAAAACACGACGTCTGCGGTTGCGAATGCTCAAAACTCCCATGCAACGACGAACAACCCTTGCTACAGAAAAGAGGGAGG AGTGGTGTCATGCGACTGCAAAACAATCACATGTAACGAGGACCATCCTTGCTACCACTCATACGAAGAAGATGGTGTTACTAAATCAGACTGCGACTGTGAACACTCACCTGGTCCTTCTGAAGAACAAAAACTGATCTCAGAAGAAGACCTGTAAGCGGCCGC Example 2 The specific steps for obtaining transgenic silkworm strains are as follows: the synthesized sequence is connected to the HFRS by enzyme digestion and enzyme ligation. EXP The Fib H promoter was connected to Ser A in the vector, and DsRed was replaced by Mrcp20k. The resulting vector was abbreviated as pBac[Fib HP-Mrcp20k-Ser A-dsRed], in which HFRSEXP For more information about the vector, see Feng Wang, 2025, An Efficient Biosynthetic System for Developing Functional Silk Fibroin-Based Biomaterials, Advanced Materials. After extracting the ultrapure plasmid, the eggs of the silkworm strain D9L were microinjected, and positive individuals were screened by fluorescence. Silk protein from the transgenic silkworms was extracted, and successful expression of CP20K was detected by Western blotting.

[0018] Example 3 The specific steps for screening positive individuals are as follows: the extracted piggyBac overexpression plasmid and the auxiliary vector plasmid pHA3PIG (plasmid concentrations must be greater than 500 ng / µL) are mixed in a molar ratio of 1:1; freshly laid silkworm eggs (within 2 hours) are fixed on a glass slide; the mixed plasmids are injected into the silkworm eggs using an insect embryo microinjector, and the injection hole is sealed with a small amount of non-toxic glue; after the injected silkworm eggs (G0 generation) are accelerated to hatch, they are reared on fresh mulberry leaves until they are placed on the cocoon; G0 generation moths are mated with ordinary moths to lay eggs, obtaining G1 generation silkworm eggs; on the 6th-7th day, the G1 generation silkworm eggs are placed under a fluorescence microscope for screening, and those with red fluorescence in the eyes are positive individuals. Positive silkworm eggs are reared together on the cocoon, and their moths also maintain this characteristic. The screening results are as follows Figure 1 shown.

[0019] Example 4 The expression and identification of exogenous proteins were carried out as follows: a small amount of silk cocoons were chopped up and then soaked in 9 M LiBr solution; after the silk was fully dissolved, the solution was centrifuged at 12000 g for 10 min at 4 °C, and the supernatant was collected for Western Blot analysis. The WT cocoon solution was used as a control and Myc antibody was used for incubation. The results are shown in the figure. Figure 2 The results showed that CP20K had obvious specific bands, while WT had no bands, indicating that the recombinant CP20K protein was successfully expressed and secreted.

[0020] Example 5 Growth and development observation, observation and analysis of the silk glands of the fifth instar silkworms and the cocoons and pupae after they were put on the cocoon, the results are as follows Figure 3 The size of transgenic silkworms, silk glands, cocoon and pupa colors, morphology and size were not significantly different from those of wild-type silkworms, indicating that the expression of exogenous proteins did not affect the growth and development of silkworms.

[0021] Example 6 Scanning electron microscope observation, the specific steps are as follows: paste the cocoons at different angles on the conductive glue, use the gold plating equipment to plate gold, and then use the scanning electron microscope to observe and take pictures for analysis. Figure 4 Compared with WT, the silk density and cross-section of the outer and inner surfaces of transgenic silkworm cocoons did not change significantly, indicating that the expression of exogenous proteins did not affect the basic formation process of silk fibers.

[0022] Example 7 Mechanical testing was performed as follows: 5 cocoons were selected from each silkworm strain, and approximately 10 silk threads were taken from each cocoon for the experiment, ensuring that approximately 40 valid data points were obtained for each strain. The raw data were exported using TA Universal Analysis software, and then curves were drawn using Origin software to calculate mechanical properties, including elongation, strength, Young's modulus, and toughness. Tensile tests were performed on wild-type and transgenic silk, and two sets of stress-strain curves were obtained, as shown in Figure 2. Figure 5 Analysis of various mechanical properties revealed improvements in both strength and Young's modulus of CP20K, with strength increasing to 329.67 ± 33.46 MPa and Young's modulus to 6.27 ± 1.20 GPa.

[0023] The above embodiments are merely preferred embodiments for the purpose of fully illustrating the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are within the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims.

Claims

1. Application of barnacle mucin in improving silk properties, characterized by: The amino acid sequence of the barnacle mucin is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The improvement of silk properties is to increase silk strength and Young's modulus.

3. A method for improving silk properties, characterized in that: The barnacle mucin is recombinantly expressed in silkworms to obtain silk with improved properties. The amino acid sequence of the barnacle mucin is shown in SEQ ID NO.

2.

4. The method for improving silk properties according to claim 3, wherein: The recombinant expression of the barnacle mucin in silkworm is regulated by the Fib H promoter.

5. The method for improving silk properties according to claim 3, wherein: The method for recombinantly expressing the barnacle mucin in silkworms is to connect the sequence shown in SEQ ID NO.1 into a piggyBac vector, and then screen transgenic silkworms by microinjection, and the obtained silk has improved performance.

6. The silk with improved properties according to any one of claims 3 to 5, characterized in that: The properties are silk strength and Young's modulus.

Images