Application of loop-chain cordyceps GXU-8616 strain and fermentation product thereof in preparation of aquatic feed

Abstract

The invention relates to the technical field of microorganisms. The invention provides a loop-chain cordyceps GXU-8616 strain, the classification name of the loop-chain cordyceps GXU-8616 strain is Cordyceps cateniannata GXU-8616, the loop-chain cordyceps GXU-8616 strain is preserved in China Center for Type Culture Collection on May 7, 2025, the preservation address is Wuhan University, Wuhan, China, and the preservation number is CCTCC NO: M 2025989. A fermentation product obtained by utilizing the loop-chain cordyceps GXU-8616 strain can be used as a feed additive for preparing an aquatic feed, and can promote the growth and development of aquatic animals such as tilapia mossambica, improve the antioxidant capacity of livers of the aquatic animals, regulate the diversity of intestinal microorganisms, improve the health state of intestinal tracts and improve the immunity of the tilapia mossambica.

Description

Technical Field

[0001] The present invention relates to the field of microbial technology, and in particular to application of a GXU-8616 strain of Cordyceps militaris and a fermentation product thereof in preparing aquatic feed. Background Art

[0002] Cordyceps sensu lato is a general term for fungi of the order Hypocreales that parasitize invertebrates and a few plants. It belongs to the kingdom Fungi, phylum Ascomycota, class Sordariomycetes, and order Hypocreales. It encompasses four families, over 50 genera, and more than 1,400 species. The Cordycipitaceae and Ophiocordycipitaceae families are the most abundant groups within this group. With the taxonomic treatment of multiple groups and the publication of new genera, the Cordyceps family now includes more than 20 genera (including more than 300 species), such as Cordyceps, Akanthomyces, Ascopolyporus, Beauveria, Blackwellomyces, Engyodontium, Gibellula, Hyperdermium, Hevansia, Parengyodontium, and Simplicillium. These genera show great morphological and host diversity and can produce abundant secondary metabolites. The mycelium contains polysaccharides, mannitol, cordycepin, nucleoside compounds, proteins, amino acids and other bioactive ingredients and pharmacological effects, mainly including antioxidant, anti-tumor, anti-aging, immunomodulatory, antibacterial and anti-inflammatory, and hypoglycemic and lipid-lowering effects.

[0003] Cordyceps cateniannulata, also known as Isaria cateniannulata and Paecilomyces cateniannulatus, is a dominant entomogenous fungus in forest ecosystems. Due to its widespread distribution, high abundance, strong survival ability, abundant spores, and easy dispersal, it provides strong and sustained control over specific insects and is therefore often used in biological control measures. Furthermore, Cordyceps cateniannulata has a certain growth-promoting effect on plants, and its metabolites have certain anti-tumor activity. It has the potential to be used as a functional feed to improve health and prevent disease by optimizing its antimicrobial and insecticidal activities.

[0004] The current trend in aquaculture development is toward increasing the intensification and commercialization of aquatic production. As aquaculture expands, the potential for major disease problems increases. Diseases of aquatic animals caused by viruses, bacteria, fungi, parasites, and other undiagnosed and emerging pathogens are a growing concern. Furthermore, the widespread and frequent use of antibiotics in aquaculture has led to the development and spread of antibiotic resistance, a major constraint on the current aquaculture industry and hinders the economic and social development of many countries. Based on these considerations, the use of Cordyceps sensu lato as a feed additive in aquaculture may have potential applications. Summary of the Invention

[0005] The present invention aims to provide a GXU-8616 strain of Cordyceps militaris. The fermentation product obtained by using the GXU-8616 strain of Cordyceps militaris can be used as a feed additive for preparing aquatic feed, thereby promoting the growth and development of aquatic animals such as tilapia, improving the antioxidant capacity of their livers, regulating the diversity of intestinal microorganisms, improving intestinal health, and enhancing the immunity of tilapia.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides a Cordyceps sinensis GXU-8616 strain, the classification name of which is Cordyceps cateniannulata GXU-8616, which was deposited in the China Center for Type Culture Collection on May 7, 2025, with the deposit address being Wuhan University, Wuhan, China, and the deposit number being CCTCC NO: M 2025989.

[0008] The present invention provides a fermentation product of the Cordyceps militaris GXU-8616 strain, which is obtained by fermenting the Cordyceps militaris GXU-8616 strain.

[0009] The present invention provides application of the fermentation product in preparing aquatic feed.

[0010] The present invention provides an aquatic feed containing the fermentation product, wherein the addition amount of the fermentation product is 1-3 wt%.

[0011] The present invention provides application of the fermentation product or the aquatic feed in promoting the growth and development of aquatic animals.

[0012] The present invention provides application of the fermentation product or the aquatic feed in improving the antioxidant capacity of the liver of aquatic animals.

[0013] The present invention provides application of the fermentation product or the aquatic feed in improving the intestinal state of aquatic animals.

[0014] By adopting the above technical solution, the present invention has the following beneficial effects:

[0015] 1. The present invention conducted morphological observation, physiological and biochemical research, and molecular identification on the entomogenous fungi screened out to determine their taxonomic status. The strain GXU-8616 was identified as Cordyceps cateniannulata.

[0016] 2. The present invention uses soybean meal, molasses, shrimp shell powder, tea oil shell and algae powder as single fermentation substrates for entomogenous fungal fermentation culture. The results show that the biomass and polysaccharide content in the fermentation matrix are very high, and the GXU-8616 strain has significant metabolic capacity in terms of carboxylic acid and derivatives, lysergic acid and derivatives, and flavonoids.

[0017] 3. The fermentation product obtained by using the Cordyceps militaris GXU-8616 strain of the present invention as an aquatic feed additive can promote the growth of tilapia; it is safe, does not cause antioxidant damage to tilapia, and also improves the antioxidant capacity and immune capacity of tilapia. Its multiple active ingredients have a positive effect on the antioxidant effect of tilapia and have a good protective effect on tilapia under stress; it can also accelerate the decomposition of fatty acids, prevent the formation of fatty liver in tilapia, and at the same time improve the synthesis and accumulation of amino acids, promote the intestinal absorption of food and nutrients, regulate the balance of intestinal flora, improve the health of the intestine, and enhance the immunity of tilapia.

[0018] Biological Deposit Description

[0019] The present invention relates to the GXU-8616 strain of Cordyceps cateniannulata, whose classification name is Cordyceps cateniannulata GXU-8616. It was deposited in the China Center for Type Culture Collection on May 7, 2025, with the deposit address being Wuhan University, Wuhan, China, and the deposit number being CCTCCNO: M 2025989. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The observation results of the asexual type of GXU-8616 strain ( Figure 1 A represents wild material, B represents the front side of PDA colony, C represents the back side of PDA colony, D represents the sporangium structure of the strain, E represents the phialide structure of the strain, and F represents conidia);

[0021] Figure 2 This is the phylogenetic tree of the GXU-8616 fungal ITS gene;

[0022] Figure 3 Effects of adding Cordyceps fermentation products to feed on serum parameters of tilapia ( Figure 3A represents ALT activity, B represents AST activity, C represents GLU activity, D represents TG activity, E represents CHO activity, and F represents HDL activity; different lowercase letters indicate significant differences (P < 0.05);

[0023] Figure 4 Effects of adding Cordyceps fermentation products to feed on the antioxidant capacity of tilapia liver ( Figure 4 A represents SOD, B represents CAT, C represents GSH-PX, D represents NO, E represents MDA, and F represents T-AOC; different lowercase letters indicate significant differences, P < 0.05);

[0024] Figure 5 Effects of adding Cordyceps fermentation products to feed on the intestinal structure of tilapia ( Figure 5 A represents the CK group, B represents the N1 group, C represents the N3 group, D represents the CSJ1 group, E represents the CSJ3 group, and F represents the CS3 group; the scale bar is 200 μm).

[0025] Figure 6 The effect of adding Cordyceps fermentation products to feed on the length of villi and thickness of muscle layer of tilapia (different lowercase letters indicate significant differences, P < 0.05);

[0026] Figure 7 Effects of adding Cordyceps fermentation products to feed on the liver structure of tilapia ( Figure 7 A represents the CK group, B represents the N1 group, C represents the N3 group, D represents the CSJ1 group, E represents the CSJ3 group, and F represents the CS3 group; the scale bar is 100 μm);

[0027] Figure 8 To study the effect of adding Cordyceps fermentation products to feed on the Beta diversity of intestinal flora of tilapia;

[0028] Figure 9 This is an analysis of the structural composition of tilapia intestinal flora at the phylum level;

[0029] Figure 10 This is an analysis of the structural composition of the intestinal flora of tilapia at the family level;

[0030] Figure 11 This is the structural composition analysis of the intestinal flora of tilapia at the genus level;

[0031] Figure 12 Heat map analysis for predicting gut microbial function in tilapia;

[0032] Figure 13 Correlation analysis between fermentation products and microbial communities;

[0033] Figure 14 Heat map analysis of fermentation products and microbial abundance;

[0034] Figure 15 Heat map analysis of the content of fermentation products, fatty acids and amino acid metabolites ( Figure 15 Where A represents a fatty acid compound, and B represents an amino acid compound);

[0035] Figure 16 Correlation analysis between liver fatty acid metabolites and microbial flora ( Figure 16 A in the figure represents the correlation analysis between fatty acid metabolites and microbial genus levels, and B represents the correlation heat map). DETAILED DESCRIPTION

[0036] The present invention provides a Cordyceps sinensis GXU-8616 strain, the classification name of which is Cordyceps cateniannulata GXU-8616, which was deposited in the China Center for Type Culture Collection on May 7, 2025, with the deposit address being Wuhan University, Wuhan, China, and the deposit number being CCTCC NO: M 2025989.

[0037] The present invention also provides a fermentation product of the GXU-8616 strain of Cordyceps sinensis, which is obtained by fermenting the GXU-8616 strain of Cordyceps sinensis.

[0038] In the present invention, the fermentation substrate includes one or more of soybean meal, molasses, shrimp shell powder, oil tea shell, algae powder, and wheat bran.

[0039] The present invention also provides application of the fermentation product in preparing aquatic feed.

[0040] The present invention provides an aquatic feed containing the fermentation product, wherein the addition amount of the fermentation product is 1-3 wt%.

[0041] The present invention provides application of the fermentation product or the aquatic feed in promoting the growth and development of aquatic animals.

[0042] The present invention provides application of the fermentation product or the aquatic feed in improving the antioxidant capacity of the liver of aquatic animals.

[0043] The present invention provides application of the fermentation product or the aquatic feed in improving the intestinal state of aquatic animals.

[0044] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0045] Example 1 Isolation and identification of strains

[0046] (1) Isolation, purification and preservation of strains

[0047] Materials were collected from the wild in Maoer Mountain, Guangxi (altitude 1500m). A small amount of spores was directly picked with tweezers and streaked onto PDA culture medium. The culture dish was sealed with parafilm and incubated at 25°C for seven days. A single colony was selected for further purification. After purification, a small amount of hyphae from the upper edge of the colony was inoculated onto a PDA slant. Once the colony on the slant matured, it was transferred to a refrigerator at 4°C for storage.

[0048] PDA medium: 2% potato starch, 2% glucose, 1% peptone, 1.5% agar powder, pH = 7, add deionized water to 1 L, and sterilize at 121°C for 20 min.

[0049] PDA slant medium: 2% potato starch, 2% glucose, 1% peptone, 1.5% agar powder, pH = 7, add deionized water to 1 L, and sterilize at 121°C for 20 min.

[0050] Seed culture medium: 2% potato flour, 2% glucose, 1% peptone, 0.2% KH2PO4, 0.0005% MgSO4·7H2O, pH = 7, add deionized water to 1 L, and sterilize at 121℃ for 20 min.

[0051] (2) Colony morphology observation and identification

[0052] When observing the morphology of asexual colonies, use a 3-5mm sterilized puncher to punch out circular colonies on completely purified and clean colonies and transfer them to the center of a new PDA culture medium. Culture at 25°C for 3-7 days and then take pictures. The macroscopic morphology of the colonies mainly includes the color, size, and texture of the front and back sides. Cut the mycelium into a piece of white transparent tape of appropriate size (note that there should be no creases or impurities when cutting the tape), and gently dip it in the mycelium on the purified colony. Be careful not to dip too much. Drop a drop of lactic acid carbolic acid cotton blue dye in the center of the slide, then place the tape with the mycelium dipped back up into the dye solution, cover with a coverslip, stain for 2 minutes, use sterile absorbent paper to absorb the excess dye on one side of the coverslip, observe under a microscope, and take pictures and record. The macroscopic morphology mainly includes characteristics such as mycelium, conidia, and phialodes.

[0053] The results showed that the host of the strain is the silkworm pupa of Lepidoptera. The spore stalks grow from the head of the insect body. They are white to off-white, 2-2.5cm long, with many branches, and the spore mass is rod-shaped ( Figure 1 A in the figure). Inoculated into PDA medium and cultured at 25℃ for 7 days, the growth rate is fast, the mycelium is cotton-like, the back of the colony is off-white, and the colony diameter is 5-6cm ( Figure 1B and C in the figure). Conidiophores grow from the hyphae and are 12-15um long. Phialoids are 7-9.5um long. Spores are 2-2.5um in diameter and have an elliptical or nearly spherical base. Conidia are single-celled, transparent, smooth, and peanut-shaped. Figure 1 ).

[0054] (III) Molecular phylogenetic analysis

[0055] The strain DNA was extracted using a fungal DNA kit (purchased from Sangon Biotech (Shanghai) Co., Ltd.), and the gene fragment was then PCR amplified using the ITS universal primers ITS4 and ITS5. A 1% agarose gel was prepared, and 4 μl of the PCR product sample was aspirated and placed into the electrophoresis tank. 1× TAE buffer was added for electrophoresis detection. The agarose gel after electrophoresis was then placed into a gel imaging system for observation to check for the appearance of a bright main band. The presence of a main band indicates successful PCR amplification and the presence of the target DNA fragment. The amplified product was sent to Shanghai Sangon Biotech Co., Ltd. or other relevant institutions for sequencing to determine the sequence information of the amplified gene fragment.

[0056] The subsequent sequencing results were spliced ​​using Seqman software, and high-quality FASTA files were generated after removing unwanted peaks. The FASTA files were then loaded into NCBI for BLAST comparison. Homologous sequences were analyzed to identify sequences from closely related species, and the sequences were downloaded. A phylogenetic tree was constructed using MEGAX software.

[0057] The sequence of the primer ITS4 is shown in SEQ ID NO. 1, and the specific sequence is TCCTCCGCTTATTGATATGC; the sequence of the primer ITS5 is shown in SEQ ID NO. 2, and the specific sequence is GGAAGTAAAAGTCGTAACAAGG.

[0058] Table 1 PCR amplification system

[0059] Element Dosage Buffer 10 μl dNTP 5.0 μl <![CDATA[mgcl2]]> 5.0 μl ITS4F 4.0 μl ITS5R 4.0 μl Taq 0.5 μl DMSO 2.5 μl DNA 4.0 μl <![CDATA[ddH2O]]> 15.0μl

[0060] Table 2 PCR amplification program

[0061]

[0062] The ITS gene sequence of GXU-8616 obtained by sequencing is 587 bp in length, as shown in SEQ ID NO.3. The specific sequence is: Figure 2 As shown, GXU-8616 and Cordyceps cateniannulata (MW718291) were clustered into one clade. Therefore, based on morphological observation and combined with ITS gene sequence comparison, GXU-8616 was identified as Cordyceps cateniannulata.

[0063] Example 2

[0064] The optimal culture conditions of GXU-8616 were further optimized, and based on the culture medium components of this strain's high polysaccharide production, the effects of fermentation products on tilapia growth, liver metabolism and intestinal flora were evaluated.

[0065] Tilapia fry for this experiment were purchased from the Mowujiao Fish Fry Market in Tingzi, Jiangnan District, Nanning, Guangxi. The recirculating aquaculture system was disinfected prior to the experiment. The aquarium dimensions were 50 cm × 30 cm × 40 cm. Twenty-five fish were housed in each treatment group, with three replicates per group. Each treatment group was fed a basal diet for two weeks to allow the fish to acclimate to the aquaculture environment. After the two-week period, the fish were fed the experimental group diet for an additional eight weeks. The water temperature was maintained at 28 ± 2°C throughout the experiment.

[0066] The circulating water aquaculture system is a fish aquaculture system described in a patent with the invention name of "Vertical High-Efficiency Circulating Water Fish Aquaculture System" and the application publication number of CN212629579U.

[0067] After 8 weeks of feeding, five fish were randomly selected from each replicate group and anesthetized with eugenol. Sampling was performed after complete anesthesia. Blood samples were drawn from the tail vein using a 1ml sterile syringe and placed in a 2ml centrifuge tube. The samples were allowed to stand at 4°C and then centrifuged at 4°C, 2500 rpm, and stored at -80°C for further use. Sterilized forceps and scissors were disinfected by soaking in 75% alcohol. The experimental fish were placed on ice for dissection, and the organs were weighed and separated. The liver and midgut were obtained. Part of the liver and midgut were fixed in paraformaldehyde solution for sectioning. The remaining liver and intestinal lysate were placed in a 2ml centrifuge tube, snap-frozen in liquid nitrogen, and stored at -80°C for determination of liver tissue enzyme activity and metabolites and intestinal microbial flora analysis.

[0068] The feed was prepared according to the principle of equal lipid and nitrogen content. A conventional feed control group (CK), a fermentation substrate negative control group (added with 1% fermentation substrate (N1) and 3% fermentation substrate (N3)), a pure mycelium positive control group (added with 3% GXU-8616 mycelium cultured in seed culture medium (CS3)), and a treatment group with GXU-8616 fermentation products (CSJ1 (1%) and CSJ3 (3%)) were set up. Each sample was accurately weighed and thoroughly mixed with conventional feed ingredients. Deionized water was added and the mixture was thoroughly stirred. The mixture was then formed into uniformly sized granules using a feed machine. The granules were dried in a dryer at 60°C and sealed and stored in a refrigerator at 4°C for later use.

[0069] The conventional feed is the feed described in the patent with the invention name of "a strain of yellow silk algae and its cultivation method and preparation of functional feed" and the application publication number of CN116218679A.

[0070] The GXU-8616 strain was inoculated into a seed culture medium and cultured for a period of time, and then the selected cells were inoculated into a fermentation culture medium for fermentation culture. The fermentation culture was performed for 15 days to obtain a GXU-8616 fermentation product. The fermentation culture medium consisted of 2g / L KH2PO4, 0.5g / LMgSO4·7H2O, 10g / L peptone, 20g / L soybean meal, 60g / L molasses, 20g / L shrimp shell powder, 10g / L oil tea shell, 60g / L protein nucleus chlorella powder and 80g / L wheat bran. The fermentation substrate consisted of 20g / L soybean meal, 60g / L molasses, 20g / L shrimp shell powder, 10g / L oil tea shell, 60g / L algae powder and 80g / L wheat bran.

[0071] (1) Effect on the growth performance of tilapia

[0072] After 2 weeks of feeding with the basic diet and 8 weeks of feeding, the initial average weight (IBW), final average weight (FBW), weight gain rate (WGR), specific growth rate (SGR), feed conversion ratio (FCR), feed intake (FI), body mass index (VSI), and survival rate (SR) of the fish were weighed. The specific calculation formulas are as follows:

[0073] Weight gain rate (WGR%) = 100 × (final mean – initial mean) / initial body weight

[0074] Specific growth rate (SGR) = 100 × (Ln (mean final body weight) – Ln (mean initial body weight)) / number of days of culture

[0075] Feed conversion ratio (FCR) = feed consumption / (final fish weight – initial fish weight)

[0076] Feed intake (FI) = 100 × total feed intake / [(final fish weight + initial fish weight) / 2 × number of days of culture]

[0077] Survival rate (SR%) = 100 × number of fish remaining at the end of the experiment / number of fish at the beginning of the experiment

[0078] Table 4 Effects of adding Cordyceps fermentation products to feed on the growth performance of tilapia

[0079]

[0080]

[0081] Note: Different lowercase letters indicate significant differences (P<0.05).

[0082] The results of the effects of adding Cordyceps fermentation products to the feed on the growth performance of tilapia are shown in Table 4. After 8 weeks of feeding, the initial average weight was approximately 7 grams, with no significant difference. The final average weight of the CSJ1 and CSJ3 groups was significantly higher than that of the CK group and the negative control group (P < 0.05), with the highest in the CSJ3 group. The positive control group, CS3, which was supplemented with 3% GXU-C8616 pure mycelium, was significantly lower than that of the other groups (P < 0.05). The WGR and SGR of the CSJ group were significantly higher than those of the CK, negative, and positive controls (P < 0.05), with the highest WGR in the CSJ3 group. The FCR of each group was lower than that of the CK group. There was no significant difference in SR among the treatment groups, indicating that the addition of GXU-8616 Cordyceps fermentation products promoted the growth of tilapia, while the addition of pure bacteria inhibited growth.

[0083] (2) Effects on tilapia serum indicators

[0084] After thawing, serum samples were assayed for biochemical parameters, including alanine aminotransferase (ALT) activity, aspartate aminotransferase (AST) activity, triglyceride (TG) content, cholesterol (CHO) content, high-density lipoprotein cholesterol (HDL-C) content, and glucose (GLU) content. The assays were performed according to the kit instructions, and the assays were performed using a spectrophotometer. All kits were purchased from Nanjing Jiancheng Bioengineering Institute.

[0085] Effects of adding Cordyceps fermentation products to feed on serum parameters of tilapia Figure 3 As shown in the results, compared with the CK group and the negative control group, the AST, ALT activities and GLU and TG contents in the serum of tilapia in the CSJ3 group were significantly reduced (P < 0.05), and there was no significant difference compared with the positive control group; in terms of CHO content, there was no significant difference among the treatment groups; in terms of HDL content, the CSJ3 group was lower than the CK group, but the difference was not significant, and there was no significant difference between the other groups.

[0086] (3) Effects on the antioxidant capacity of tilapia liver

[0087] After thawing, the liver tissue was added with physiological saline at a ratio of 1:9 (w / v) and ground with a grinder to prepare a 10% tissue homogenate. The tissue was centrifuged at 3500 rpm for 10 min at 4°C, and the supernatant was used to determine antioxidant enzyme activity. Superoxide dismutase (SOD) activity, malondialdehyde (MDA) content, glutathione peroxidase (GSH-Px) activity, catalase (CAT) activity, nitric oxide (NO) concentration, and total antioxidant capacity (T-AOC) activity were measured. All assay methods and procedures were strictly followed according to the instructions of the corresponding kits (purchased from Nanjing Jiancheng Bioengineering Institute).

[0088] Effects of adding Cordyceps fermentation products to feed on the antioxidant capacity of tilapia liver Figure 4 The results showed that compared with the CK group and the negative control group, SOD activity increased in all treatment groups, with the CSJ3 group showing a significant increase (P < 0.05), with no significant difference compared to the positive control group. CAT activity significantly increased in the CSJ1 group (P < 0.05). GSH-PX activity significantly increased in the CS3 group (P < 0.05), indicating that the addition of pure mycelium was beneficial for enhancing GSH-PX activity. MDA content increased in the CSJ1 group, but there was no significant difference. T-AOC activity showed no significant difference among the groups. Therefore, the addition of GXU-8616 fermentation products improved the antioxidant capacity of tilapia liver to a certain extent.

[0089] (IV) Effects on the intestinal and liver structure of tilapia

[0090] Liver and intestinal tissue samples were removed from paraformaldehyde fixative and dehydrated in 30%-70% ethanol to obtain transparent tissue. The tissue was then fixed in paraffin and cut into 5-μm sections using a microtome. The sections were stained with hematoxylin-eosin, observed under a microscope, and photographed for documentation. Five randomly selected tissue images were used to measure intestinal villus length and muscle thickness using ImageJ, and the average values ​​were used for statistical analysis.

[0091] Intestinal sections of each treatment group Figure 5 As shown in the figure, no obvious pathological changes were found after 8 weeks of feeding. The length of the small intestinal villi in the CK group was significantly shorter, while the length of the small intestinal villi in the CSJ group was longer and thinner than that in the CK group, with obvious braid and cup shapes, high and thick, and no top melting phenomenon. The muscle layer was thicker and had a more obvious health status. Figure 6As shown, except for the CS3 group, villus length in all treatment groups was significantly different compared to the CK group and the negative control group (P < 0.05), with the CSJ3 group showing the highest villus length. The muscle layer thickness in the CSJ group was also highly significantly different compared to the CK group, the negative control group, and the positive control group (P < 0.05). This suggests that supplementing tilapia with fermented Cordyceps sinensis products can promote intestinal nutrient absorption and improve intestinal health in tilapia.

[0092] Liver tissue sections Figure 7 As shown, the CK group showed significant pathological changes, with severe fat vacuoles and significant fat accumulation, which predisposes to the development of fatty liver. The remaining treatment groups showed significantly fewer fat vacuoles compared to the CK group, particularly the CSJ1 group, which also maintained a healthier state than the other groups. This suggests that the addition of GXU-8616 fermentation products improved the health of tilapia, reduced liver damage, and prevented the development of fatty liver.

[0093] Example 3

[0094] Tilapia intestinal microbial DNA was extracted according to the instructions of the DNA extraction kit. The 16rDNA V3-V4 region of the intestinal contents was amplified using primers 341F and 806R. The sequence of primer 341F is shown in SEQ ID NO. 4, and the specific sequence is 5'-CCTACGGGNGGCWGCAG-3'; the sequence of primer 806R is shown in SEQ ID NO. 5, and the specific sequence is 5'-GGACTACHVGGGTATCTAAT-3'. Subsequently, high-throughput sequencing analysis was performed, and the obtained sequences were filtered, double-end spliced, and optimized sequences (Tags) were obtained. OTU cluster analysis was performed to obtain species classification results. Based on the classification results, the samples were classified and bioinformatics analyzed to explore the structure and composition of the intestinal biological community of tilapia.

[0095] (1) Alpha diversity of tilapia intestinal flora

[0096] After eight weeks of rearing, the tilapia gut microbiota was sequenced using high-throughput sequencing, and the results were analyzed for alpha diversity. Key metrics included Sobs, Chao1, Ace, Shannon, and Simpson. Sobs represents the number of OTUs in the gut microbiota, while Chao1 represents the number of predicted OTUs. Shannon and Simpson values ​​increased in the treated groups, indicating increased gut microbial richness and high microbial diversity.

[0097] Table 5 Effects of adding Cordyceps fermentation products to feed on the Alpha diversity of intestinal flora of tilapia

[0098] Group Sobs Chao1 Ace Shannon Simpson CK 140 154.53 163.28 1.61 0.47 N1 127 170.16 183.54 1.16 0.29 N3 126 175.04 183.85 1.31 0.51 CSJ1 149 171.88 182.10 2.66 0.63 CSJ3 224 250.90 249.45 2.17 0.50 CS3 114 143.06 142.50 1.53 0.43

[0099] The results for each group are shown in Table 5. The number of OTUs in the CSJ1 and CSJ3 groups was higher than in the CK group, while the remaining treatment groups were lower than the CK group. According to the Shannon and Simpson results, the species diversity and species richness in the CSJ group were significantly higher than those in the CK, negative, and positive control groups. This indicates that supplementing the CSJ group with Cordyceps fermentation products can increase the diversity of the intestinal microbiota in tilapia. The species diversity in the remaining treatment groups was lower than that in the CK group, indicating minimal impact on tilapia species diversity.

[0100] (2) Beta diversity of tilapia intestinal flora

[0101] Beta diversity refers to the diversity difference between samples. It judges the similarity and difference of species composition between samples from the perspective of the overall bacterial community structure. The calculation of beta diversity between communities is mainly related to the presence and abundance of species. Based on principal coordinate analysis (PCoA), the grouping characteristics are presented in the form of Figure 8 As shown, on the first principal coordinate (PCo1), the CSJ1 group and the CSJ3 group were far away from the CK group.

[0102] (3) Composition of tilapia intestinal microbial communities

[0103] From the door level (such as Figure 9 ), the dominant phylum in CK was Proteobacteria; the dominant phylum in N1, CSJ1, and CSJ3 groups was Fusobacteriota, followed by Proteobacteria; the dominant phylum in N3 and CS3 groups was Proteobacteria, followed by Fusobacteria. Compared with the CK group, the abundance of Proteobacteria decreased significantly in all treatment groups except the CS3 group, while the abundance of Fusobacteria increased significantly. In the negative control group, the abundance of Fusobacteria decreased and the abundance of Proteobacteria increased with the increase of the supplementation amount; in the CSJ group, the abundance of Fusobacteria increased and the abundance of Proteobacteria decreased with the increase of the supplementation amount.

[0104] From the perspective of science level (such as Figure 10 ). In the CK group, the dominant family was Pseudomonadaceae, followed by Burkholderiaceae. The dominant family in the N1, CSJ1, and CSJ3 groups was Fusobacteriaceae, with no significant difference between the CSJ1 and CSJ3 groups. Burkholderiaceae was the second most dominant family. In the N3 and CS3 groups, Enterobacteriaceae was the dominant family, followed by Fusobacteriaceae.

[0105] From the subordinate level (such as Figure 11), the dominant bacterial genera in the CK group were Pseudomonas and Ralstonia, while the dominant bacterial genera in the N1, CSJ1, and CSJ3 groups were Cetobacterium and Ralstonia. The dominant bacterial genera in the N3 and CS3 groups were Cetobacterium and Plesiomonas. In the negative control group, Cetobacterium significantly decreased, while Plesiomonas significantly increased, with increasing dosage of supplementation. In the CSJ group, Cetobacterium significantly increased with increasing dosage of supplementation.

[0106] (IV) Prediction of intestinal microbial function in tilapia

[0107] Based on PICRUSt analysis, KEGG prediction of tilapia intestinal microbial genus level was performed. Figure 12 As shown in the figure, heat map analysis of the top 20 metabolic pathways. Overall, the expression levels of metabolic pathways in the tilapia intestinal flora in all treatment groups were significantly higher than those in the CK group. These pathways mainly included ansamycin biosynthesis, lipopolysaccharide biosynthesis, pentose phosphate pathway, peptidoglycan biosynthesis, and D-alanine metabolism. It is worth noting that the CSJ3-added group had more highly expressed metabolic pathways compared to the CK group and the negative control group, mainly concentrated in the synthesis of amino acids (Valine leucine and isoleucine biosynthesis), fatty acid biosynthesis (Fatty acid biosynthesis), C5-branched dibasic acid synthesis (C5-branched dibasic acid), pantothenate and acetyl coenzyme A synthesis (Pantothenate and CoA), pyruvate metabolism (Pyruvate metabolism), and synthesis and degradation of ketone bodies (Synthesis and degradation of ketone bodies). This shows that Cordyceps fermentation products as feed additives can increase the expression of intestinal microbial metabolic pathways in tilapia, contribute to the accumulation of beneficial metabolites, and promote the growth and development of tilapia.

[0108] (V) Correlation analysis between fermentation products and microbial flora

[0109] At the genus level, a correlation network diagram was created based on the abundance of intestinal microorganisms and fermentation products. Figure 13As shown in the figure, dashed and solid lines represent negative and positive correlations, respectively, and thick lines represent the strength of the correlation. The main positive correlation with the negative control group was with Aeromonas, a common pathogenic and antibiotic-resistant bacteria in aquatic life that affects the health of tilapia. Negative correlations were mainly with Clostridium_sensu_stricto_1 and Lactobacillus. Lactobacillus is a lactobacillus species known as a probiotic intestinal bacteria that can enhance the immunity of aquatic animals. It is speculated that the negative control group, as a feed additive, did not significantly improve the intestinal function of tilapia. The CSJ group was positively correlated with Clostridium_sensu_stricto_1 (Bacillus), Gemmobacter (Bacillus), Bifidobacter (Bifidobacterium), Escherichia-Shigella (Shigella), Cutibacterium (Enterohepatic bacteria), Blautia (anaerobic bacteria), Phycicoccus (Pediococcus), and Leptotrichia (Leptotrichia). Bifidobacterium, a member of the genus Bifidobacterium, has multiple probiotic functions, including inhibiting pathogen invasion, enhancing antioxidant capacity, improving the intestinal immune system and protein metabolism, and promoting intestinal nutrient absorption. Blautia, an anaerobic bacterium with beneficial bacteria properties, can produce bacteriocins to inhibit pathogen reproduction and upregulate T cell production to achieve anti-inflammatory properties. Aeromonas, on the other hand, was negatively correlated, indicating that the addition of GXU-C8616 fermentation products can promote the reproduction of probiotics in the intestine, inhibit pathogen colonization, enhance antioxidant capacity, and regulate immunity. It can also reduce the level of inflammatory factors in the intestine, playing a protective role. A comprehensive analysis of the negative control group and the CSJ group showed that the matrix fermented by the entomogenous fungus is more likely to promote the reproduction of probiotics, indicating that Cordyceps sinensis has a significant regulatory effect on the bioactive components formed by the conversion of fermentation substrates, improving the diversity of intestinal microorganisms and protecting the intestinal health of tilapia.

[0110] Furthermore, the abundance of highly correlated strains of all bacterial genera in each treatment group was analyzed. Figure 14 As shown; the results showed that the abundance of all bacterial genera in the CSJ group was positively correlated with that in the other treatment groups, which was significantly higher. Among them, the abundance of the beneficial bacterial genera Bifidobacter and Blautia was significantly increased compared with the other treatment groups, and most of the bacterial genera were enriched in the CSJ1 group, indicating that the addition of 1% GXU-C8616 fermentation products was more conducive to the reproduction of beneficial bacterial genera.

[0111] Example 4 Effects on Tilapia Liver Metabolites

[0112] Metabolite Extraction: A sample of cryopreserved liver material was removed and freeze-dried under vacuum. The dried sample was ground using a grinder at 30 Hz for 1.5 minutes. 100 mg of the powder was weighed and extracted with 1.0 mL of 70% methanol containing 0.1 mg / L lidocaine as an internal standard at 4°C overnight, vortexing three times to ensure complete extraction. The sample was centrifuged for 10 minutes, and the supernatant was aspirated and filtered through a microporous filter (0.22 μm pore size). The sample was stored in an injection vial for subsequent LC-MS analysis.

[0113] Sample determination: Samples were separated using an Agilent 1290 Infinity LC ultra-high performance liquid chromatography system (UHPLC) HILIC column; column temperature 25°C; flow rate 0.5 mL / min; injection volume 2 μL; mobile phase composition A: water + 25 mM ammonium acetate + 25 mM ammonia, B: acetonitrile; samples were placed in an autosampler at 4°C throughout the analysis process.

[0114] (1) Effects on fatty acid and amino acid metabolites in tilapia liver

[0115] Through data analysis, a total of 2214 liver metabolites were obtained, including 91 fatty acid compounds and 385 amino acid compounds. Figure 15 The heat map analysis of the contents of the top 20 fatty acid and amino acid metabolites and fermentation products showed that compared with the CK group, the abundance of behenic acid, trans-2,3-dimethylacrylic acid, 16-hydroxypalmitic acid, and 12s-hydroxy-5z,8e,10e-heptadecatrienoic acid (17-carbon hydroxy fatty acid) in the CSJ3 group was significantly reduced, indicating that the addition of 3% GXU-8616 fermentation products is more helpful in reducing the accumulation of fatty acids and preventing the formation of fatty liver in tilapia. As shown in the figure, almost all amino acid metabolites with higher abundance are concentrated in the CSJ group and the CS3 group and the content is significantly higher than that in other groups, mainly including Trp-Asp (WD-repeat protein), Gln-gln (glutamine), Trp-Lys (L-lysine), Thr-Lys (L-lysine), Pro-Gly (L-prolylglycine), etc., indicating that the addition of 3% GXU-8616 fermentation products is beneficial to the accumulation of amino acid metabolites and helps to improve the protein and amino acid content of tilapia meat.

[0116] (II) Correlation analysis between tilapia liver metabolites and microbial flora

[0117] Speraman analysis was used to conduct correlation analysis between the first 20 fatty acid metabolites in tilapia liver and the intestinal microbial genus level, such as Figure 16 As shown in the data, the genera with strong positive correlations mainly include Alloprevotella, Hydrogenophaga, Staphylococcus, and Bradyrhizobium; the genera with strong negative correlations mainly include Acidovorax, Escherichia-Shigella, Bifidobacterium, and Cetobacterium. Escherichia-Shigella, Bifidobacterium, and Cetobacterium are beneficial intestinal bacteria that promote the metabolism of fatty acid compounds, alleviate fat accumulation in tilapia, and are not conducive to the formation of fatty liver. Correlation analysis between these bacterial genera and fermentation products was performed as shown in the figure. The beneficial bacterial genera Escherichia-Shigella, Bifidobacterium, and Cetobacterium were mainly enriched in the CSJ1 group and the CSJ3 group, indicating that the addition of 3% GXU-8616 fermentation products was beneficial to the reproduction of these bacterial genera and significantly improved the decomposition of fatty acids, which was consistent with the previous liver section results, reducing fat vacuoles.

[0118] In summary, the GXU-8616 Cordyceps fungus fermentation product described in this invention significantly improved the growth performance of tilapia, enhanced the liver's antioxidant capacity, reduced liver damage, enhanced the digestion and absorption capacity of the tilapia intestine, and strengthened the liver's metabolic capacity. These results also provide a theoretical basis for the use of Cordyceps fungus fermentation products as aquatic feed additives, providing important reference value for antibiotic-free aquaculture and growth and health regulation of aquatic animals.

[0119] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A GXU-8616 strain of Cordyceps militaris, characterized in that: The taxonomic name is Cordyceps cateniannulataGXU-8616, and it was deposited in the China Center for Type Culture Collection on May 7, 2025, with the deposit address being Wuhan University, Wuhan, China, and the deposit number being CCTCC NO:M 2025989.

2. A fermentation product of the Cordyceps militaris GXU-8616 strain according to claim 1, characterized in that: The product is obtained by fermenting the GXU-8616 strain of Cordyceps militaris according to claim 1.

3. Use of the fermentation product according to claim 2 in preparing aquatic feed.

4. An aquatic feed containing the fermentation product according to claim 2, characterized in that: The added amount of the fermentation product is 1-3 wt%.

5. Use of the fermentation product according to claim 2 or the aquatic feed according to claim 4 in promoting the growth and development of aquatic animals.

6. Use of the fermentation product according to claim 2 or the aquatic feed according to claim 4 for improving the antioxidant capacity of the liver of aquatic animals.

7. Use of the fermentation product according to claim 2 or the aquatic feed according to claim 4 in improving the intestinal state of aquatic animals.

Images