Escherichia coli engineering strain with high yield of L-norvaline as well as construction method and application of escherichia coli engineering strain

Abstract

The invention belongs to the technical field of microorganisms and fermentation engineering, and particularly relates to an escherichia coli engineering strain with high yield of L-norvaline as well as a construction method and application of the escherichia coli engineering strain. According to the invention, a common mode microorganism escherichia coli is used as an original strain, and the high yield of L-norvaline by the escherichia coli engineering strain is realized by modifying the metabolic pathway of the escherichia coli engineering strain. A series of metabolic engineering modifications on an original strain comprise knocking out a series of alcohol dehydrogenase and aldehyde dehydrogenase to weaken an endogenous propionaldehyde metabolic pathway of escherichia coli; then, the escherichia coli engineering strain for producing the L-norvaline is obtained by introducing a biosynthesis route of the L-norvaline, and the escherichia coli engineering strain can be used for efficiently producing the L-norvaline in a whole-cell catalysis manner by taking cheap propionaldehyde, glycine and sodium formate as substrates, so that the engineering strain has considerable application value and prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and fermentation engineering, and particularly relates to an engineered Escherichia coli strain with high L-norvaline production, a construction method thereof, and an application thereof. Background Art

[0002] The information disclosed in the background of the invention is only intended to enhance understanding of the overall background of the invention and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] L-norvaline is a non-protein amino acid first discovered as a component of a natural antimicrobial peptide from Bacillus subtilis. L-norvaline exhibits antifungal, antibacterial, anti-inflammatory, and herbicidal activities. L-norvaline is a well-known arginase inhibitor that increases arginine and nitric oxide levels in the body and is considered a potential new drug for the treatment of Alzheimer's disease. Furthermore, L-norvaline is an important pharmaceutical intermediate and a key precursor for the synthesis of perindopril, an angiotensin-converting enzyme inhibitor used primarily to treat hypertension and heart disease.

[0004] L-norvaline can be produced through methods such as chemical synthesis, microbial fermentation, and whole-cell catalysis. The chemical synthesis method of L-norvaline is complex, has harsh reaction conditions, high substrate costs, and low enantiomeric excess of the product. Microbial fermentation of L-norvaline has low yield and productivity. For example, prior art reports have publicly reported that using glucose as a substrate and engineered Enterobacteriaceae produced only 0.9 g / L of L-norvaline after 75 hours of fermentation. In addition, using a biocatalytic method, 44.5 g / L of L-norvaline was produced in 12 hours using 2-oxopentanoic acid as a substrate and whole-cell catalysis. At the same time, prior art also reports that 58.4 g / L of L-norvaline was obtained in 24 hours using a cascade enzyme system catalyzed using DL-norvaline as a substrate. The inventors have discovered that the substrates of the above-mentioned existing fermentation production methods are expensive, resulting in high production costs, which limits the large-scale production of L-norvaline. Summary of the Invention

[0005] In response to the problems existing in the prior art, the present invention aims to provide an engineered Escherichia coli strain that produces high L-norvaline yields, as well as its construction method and application. Specifically, the present invention utilizes wild-type Escherichia coli as a starting bacterium, undergoes a series of metabolic engineering modifications to the starting bacterium, and introduces an L-norvaline synthesis pathway. Ultimately, an engineered E. coli strain that produces high L-norvaline yields this strain. This strain utilizes whole-cell catalysis to produce L-norvaline from the inexpensive substrates propionaldehyde, glycine, and sodium formate. This strain is expected to be a viable engineering bacterium for industrialized L-norvaline production and practical application. Based on these research findings, the present invention has been completed.

[0006] Specifically, the technical solution of the present invention is as follows:

[0007] In a first aspect of the present invention, a high-L-norvaline-producing engineered Escherichia coli strain is provided. The engineered Escherichia coli strain is obtained by metabolically engineering a wild-type Escherichia coli strain, wherein the metabolic engineering comprises any one or both of the following:

[0008] (a1) weakening the endogenous propionaldehyde metabolic pathway of wild-type Escherichia coli;

[0009] (a2) Introducing a non-natural L-norvaline synthesis pathway.

[0010] In the above-mentioned (a1), weakening the endogenous propionaldehyde metabolic pathway of Escherichia coli specifically includes inhibiting the synthesis of n-propanol and propionic acid; further, one or more of the following coding genes in the starting bacteria can be knocked out: alcohol dehydrogenase genes yqhD, yjgB, fucO, adhP, adhE, eutG and aldehyde dehydrogenase genes ydcW, puuC, feaB, betB, aldA, aldB, sad.

[0011] In said (a2), the introduction of a non-natural L-norvaline synthesis pathway is specifically to overexpress L-threonine aldolase, L-amino acid dehydratase, amino acid dehydrogenase, formate dehydrogenase and active intermediate deaminase A in the starting bacteria or the base bacteria obtained after treatment with (a1).

[0012] The second aspect of the present invention provides the use of the above-mentioned engineered Escherichia coli strain in whole-cell catalytic production of L-norvaline.

[0013] The third aspect of the present invention provides a method for industrial production of L-norvaline, comprising: subjecting an engineered Escherichia coli strain to whole-cell catalysis to produce L-norvaline; and isolating and purifying the L-norvaline.

[0014] A fourth aspect of the present invention provides a method for constructing the aforementioned engineered E. coli strain, the method comprising: using wild-type E. coli as a starting bacterium, and subjecting the starting bacterium to the following metabolic engineering modifications (a1) and / or (a2):

[0015] (a1) weakening the endogenous propionaldehyde metabolic pathway of wild-type Escherichia coli;

[0016] (a2) Introducing a non-natural L-norvaline synthesis pathway.

[0017] The metabolic engineering methods (a1) and (a2) have been fully described in the Escherichia coli engineered strain of the first aspect above and will not be repeated here.

[0018] The fifth aspect of the present invention provides the use of the above-mentioned engineered E. coli strain or the industrial production of L-norvaline in various fields such as agriculture, food, chemical industry and pharmaceutical industry.

[0019] Beneficial technical effects of one or more of the above technical solutions:

[0020] The above technical solution uses the common model microorganism E. coli as the starting strain, and cheap propionaldehyde, glycine and sodium formate as substrates. By modifying its metabolic pathway and introducing the synthesis pathway of L-norvaline, the E. coli engineered strain can produce high L-norvaline through whole-cell catalysis.

[0021] The above technical solution knocks out genes related to propionaldehyde metabolism and overexpresses L-threonine aldolase, L-amino acid dehydratase, amino acid dehydrogenase, formate dehydrogenase and active intermediate deaminase A; finally, the accumulation of L-norvaline in the catalytic system is achieved through whole-cell catalysis, which can be used to efficiently produce L-norvaline. Calculated based on glycine, the highest yield is 99.1% and the highest production efficiency is 11.63g / L / h. Therefore, the above-mentioned engineered bacteria have considerable application value and prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] The accompanying drawings, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0023] Figure 1 The plasmid pACYCDuet-PpltaE constructed in the present invention D93H -EcilvA F352A / R362F and schematic diagram of the map of pETDuet-Opfdh-EcridA-Tvleudh. DETAILED DESCRIPTION

[0024] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention belongs.

[0025] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is intended to include the plural form. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, they indicate the presence of features, steps, operations, devices, components and / or combinations thereof.

[0026] As previously mentioned, the production of L-norvaline using 2-oxopentanoic acid or DL-norvaline as substrates is currently the most efficient method for achieving the highest concentrations of L-norvaline. However, the high cost of these substrates makes large-scale industrial production difficult. Propionaldehyde and glycine are inexpensive and readily available, making them suitable substrates for large-scale production. E. coli has a short growth cycle, high spatiotemporal yields, and a well-defined genetic background, making genetic modification relatively easy. The whole-cell catalytic method is simple to operate, operates under mild conditions, and is adaptable to diverse production environments.

[0027] In view of this, in a typical embodiment of the present invention, an engineered Escherichia coli strain with high L-norvaline production is provided. The engineered Escherichia coli strain is obtained by metabolically engineering a wild-type Escherichia coli as a starting bacterium, wherein the metabolic engineering comprises any one or both of the following:

[0028] (a1) weakening the endogenous propionaldehyde metabolic pathway of wild-type Escherichia coli;

[0029] (a2) Introducing a non-natural L-norvaline synthesis pathway.

[0030] Wherein, the wild-type Escherichia coli may be Escherichia coli BL21 (DE3).

[0031] In the above-mentioned (a1), weakening the endogenous propionaldehyde metabolic pathway of Escherichia coli specifically includes inhibiting the synthesis of n-propanol and propionic acid; further, one or more of the following coding genes in the starting bacteria can be knocked out: alcohol dehydrogenase genes yqhD, yjgB, fucO, adhP, adhE, eutG and aldehyde dehydrogenase genes ydcW, puuC, feaB, betB, aldA, aldB, sad.

[0032] In said (a2), the introduction of a non-natural L-norvaline synthesis pathway is specifically to overexpress L-threonine aldolase, L-amino acid dehydratase, amino acid dehydrogenase, formate dehydrogenase and active intermediate deaminase A in the starting bacteria or the base bacteria obtained after treatment with (a1).

[0033] In another embodiment of the present invention, the L-threonine aldolase can be L-threonine aldolase PpLtaE derived from Pseudomonas putida KT2440 and its mutant PpLtaE D93H , L-threonine aldolase EcLtaE from E. coli MG1655 and its mutant EcLtaE H126F .

[0034] In another embodiment of the present invention, the L-amino acid dehydratase may be L-threonine dehydratase or L-phenylserine dehydratase; further, the L-threonine dehydratase may be L-threonine dehydratase EcIlvA derived from E. coli MG1655 and its mutant EcIlvA. F352A / R362F , L-threonine dehydratase EcTdcB from E.coli MG1655 and L-threonine dehydratase MsIlvA from Mycobacterium smegmatis; the L-phenylserine dehydratase can specifically be L-phenylserine dehydratase PxPSDH from Paraburkholderia xenovorans and L-phenylserine dehydratase RpPSDH from Ralstonia pickettii PS22.

[0035] In another specific embodiment of the present invention, the amino acid dehydrogenase may be leucine dehydrogenase, phenylalanine dehydrogenase or glutamate dehydrogenase; further, the leucine dehydrogenase may be leucine dehydrogenase TvLeuDH derived from Thermoactinomyces vulgaris or leucine dehydrogenase BsLeuDH derived from Bacillus subtilis 168, the phenylalanine dehydrogenase may be phenylalanine dehydrogenase NoPheDH derived from Nocardia sp. 239; the glutamate dehydrogenase may be glutamate dehydrogenase EcGDH derived from E. coli MG1655.

[0036] In another embodiment of the present invention, the formate dehydrogenase may be formate dehydrogenase OpFDH derived from Ogataeaparapolymorpha DL-1, formate dehydrogenase CbFDH derived from Candida boidinii and its mutant CbFDHA10C ; formate dehydrogenase RjFDH from Rhodococcus jostii and formate dehydrogenase PsFDH from Pseudomonas sp.101.

[0037] In another embodiment of the present invention, the active intermediate deaminase A may be the active intermediate deaminase A EcRidA derived from E. coli MG1655.

[0038] The present invention proves through experiments that the use of the above enzymes can ensure the smooth realization of the non-natural L-norvaline synthesis pathway.

[0039] In another specific embodiment of the present invention, the above enzyme encoding genes are connected to a vector to construct a recombinant expression vector, which is introduced into the starting bacteria or the base bacteria obtained after treatment (a1).

[0040] In the present invention, the coding genes of the above enzymes are shown in SEQ ID NO. 1-20.

[0041] In the present invention, the vector may be a plasmid vector, specifically pACYCDuet-1 and / or pETDuet-1.

[0042] In another specific embodiment of the present invention, there may be two or more recombinant expression vectors.

[0043] Among them, the first recombinant expression vector can be pACYCDuet-PpltaE D93H -EcilvA F352A / R362F , which can simultaneously express the L-threonine aldolase mutant PpLtaE D93H and the L-threonine dehydratase mutant EcIlvA F352A / R362F Gene PpltaE D93H and EcilvA F352A / R362F They are located in the multiple cloning site 1 (restriction sites are BamHI and HindIII) and multiple cloning site 2 (restriction sites are BglII and XhoI) of the vector pACYCDuet-1 respectively.

[0044] Furthermore, the L-threonine aldolase mutant PpLtaE D93H The nucleotide sequence of the coding gene is shown in SEQ ID NO.1; the L-threonine dehydratase mutant EcIlvA F352A / R362F The nucleotide sequence of the coding gene is shown in SEQ ID NO. 2. The plasmid pACYCDuet-PpltaE D93H -EcilvA F352A / R362F The spectrum is as follows Figure 1 shown.

[0045] The second recombinant expression vector can be pETDuet-Opfdh-EcridA-Tvleudh, which can simultaneously express formate dehydrogenase OpFDH, active intermediate deaminase A EcRidA, and leucine dehydrogenase TvLeuDH. The Opfdh, Tvleudh, and EcridA genes are located in the multiple cloning site 1 (with restriction enzymes BamHI and SalI), multiple cloning site 2 (with restriction enzymes BglII and XhoI), and between multiple cloning sites 1 and 2 (with restriction enzymes HindIII and NotI) of the pETDuet-1 vector, respectively.

[0046] Furthermore, the nucleotide sequence of the gene encoding formate dehydrogenase OpFDH is shown in SEQ ID NO.3; the nucleotide sequence of the gene encoding active intermediate deaminase AEcRidA is shown in SEQ ID NO.4; and the nucleotide sequence of the gene encoding leucine dehydrogenase TvLeuDH is shown in SEQ ID NO.5. The map of the plasmid pETDuet-Opfdh-EcridA-Tvleudh is shown in Figure 1 shown.

[0047] In another embodiment of the present invention, there is provided the use of the above-mentioned engineered Escherichia coli strain in whole-cell catalytic production of L-norvaline.

[0048] In another embodiment of the present invention, a method for industrial production of L-norvaline is provided, comprising: subjecting an engineered Escherichia coli strain to whole-cell catalysis to produce L-norvaline; and isolating and purifying the L-norvaline.

[0049] The specific conditions of the whole-cell catalysis include: the cell density is OD 600nm 60, the temperature is controlled at 28-40°C (preferably 37°C), the speed is controlled at 150-250rpm (preferably 200rpm), and the pH is neutral;

[0050] The initial substrate concentration can be 40-80 mM propionaldehyde, 200-600 mM glycine, 500-1000 mM sodium formate, 0.05-0.5 mM PLP and 1-10 mM EDTA, and the propionaldehyde feeding rate is 50-300 mM / h uniformly fed for 1-5 hours.

[0051] Experiments have shown that the L-norvaline yield of an engineered E. coli BL21 (DE3) strain introduced with an L-norvaline production plasmid is 35.3 g / L under the conditions of 50 mM propionaldehyde, 300 mM glycine, 600 mM sodium formate, 0.2 mM PLP and 5 mM EDTA, with a propionaldehyde feed rate of 100 mM / h and a uniform feed rate for 3.5 hours. The yield calculated based on glycine is 98.4%, and the production efficiency is 8.83 g / L / h.

[0052] The L-norvaline yield of the E. coli BL21(DE3) engineered strain introduced with an L-norvaline production plasmid was 46.5 g / L under the conditions of 50 mM propionaldehyde, 400 mM glycine, 800 mM sodium formate, 0.2 mM PLP and 5 mM EDTA, with a propionaldehyde feed rate of 150 mM / h and a uniform feed rate for 3 h. The yield calculated based on glycine was 99.1%, and the production efficiency was 11.63 g / L / h.

[0053] In another embodiment of the present invention, a method for constructing the above-mentioned engineered E. coli strain is provided, wherein the method comprises: using wild-type E. coli as a starting bacterium, and performing the following metabolic engineering modifications (a1) and / or (a2) on the starting bacterium:

[0054] (a1) weakening the endogenous propionaldehyde metabolic pathway of wild-type Escherichia coli;

[0055] (a2) Introducing a non-natural L-norvaline synthesis pathway.

[0056] in,

[0057] In (a1), weakening the endogenous propionaldehyde metabolic pathway of E. coli specifically includes inhibiting the synthesis of n-propanol and propionic acid; further, one or more of the following coding genes in the starting bacteria can be knocked out: alcohol dehydrogenase genes yqhD, yjgB, fucO, adhP, adhE, eutG, and aldehyde dehydrogenase genes ydcW, puuC, feaB, betB, aldA, aldB, sad. The knockout can be performed using any known gene knockout technology. In one embodiment of the present invention, CRISPR-Cas9 gene editing technology is used to knock out the above-mentioned coding genes.

[0058] In said (a2), the introduction of a non-natural L-norvaline synthesis pathway is specifically to overexpress L-threonine aldolase, L-amino acid dehydratase, amino acid dehydrogenase, formate dehydrogenase and active intermediate deaminase A in the starting bacteria or the base bacteria obtained after treatment with (a1).

[0059] Furthermore, the metabolic engineering methods (a1) and (a2) have been fully described in the above-mentioned Escherichia coli engineered strains and will not be repeated here.

[0060] In another embodiment of the present invention, the application of the above-mentioned engineered Escherichia coli strain or industrial production of L-norvaline in various fields such as agriculture, food, chemical industry and pharmaceutical industry is provided.

[0061] The present invention is further explained by the following examples, but is not intended to limit the present invention. It should be understood that these examples are only intended to illustrate the present invention and are not intended to limit the scope of the present invention.

[0062] The techniques not mentioned in the following examples are all conventional techniques in the art, and the strains, vectors pETDuet-1, pACYCDuet-1, DNA purification kits, plasmid extraction kits and other materials used are all commercial products. The CRISPR-Cas9 gene editing technology used in the present invention includes two knockout vectors, pEcCas and pEcgRNA.

[0063] The activation medium for E. coli and its derivatives was Luria-Bertani medium (LB): 5 g / L yeast extract, 10 g / L peptone, and 10 g / L NaCl. Solid medium was supplemented with 2% (wt / vol) agar powder. Culture conditions were 37°C and 180 rpm. During the construction of engineered E. coli strains, the following antibiotics were used at final concentrations, depending on the resistance requirements of the introduced plasmids: kanamycin 50 μg / mL, spectinomycin 50 μg / mL, ampicillin 100 μg / mL, and chloramphenicol 40 μg / mL.

[0064] 100 mM potassium phosphate buffer (pH 7.0): 14.04 g / L K2HPO4·3H2O, 5.24 g / L KH2PO4. If necessary, fine-tune the pH to 7.0 with dilute hydrochloric acid or potassium hydroxide solution.

[0065] TSB buffer: 10% (w / v) PEG8000, 10% (v / v) glycerol, 5% (v / v) DMSO, 20 mM MgSO4, dissolved in LB medium, adjusted to pH 6.1 with hydrochloric acid solution, and sterilized by high-pressure steam at 121°C for 20 min.

[0066] Electroporation buffer: 10% (v / v) glycerol, sterilized by high-pressure steam at 121°C for 20 min.

[0067] Determination of L-norvaline and its by-products

[0068] The pre-column treatment method for detecting L-norvaline is as follows: After removing the whole-cell catalytic sample, dilute the sample to an appropriate multiple and centrifuge at 14,000 rpm for 10 minutes. Take 0.4 mL of the supernatant and add 0.2 mL of a 1 M triethylamine-acetonitrile solution and 0.2 mL of a 0.1 M phenylisothiocyanate-acetonitrile solution. Mix thoroughly and let stand at room temperature in the dark for 1 hour. Then, add 0.8 mL of n-hexane and vortex for 1 minute. After the liquid layers separate, aspirate the lower layer with a syringe, filter through a 0.22 μm filter, and use for HPLC analysis. The specific detection method is as follows: HPLC model is Agilent 1100 (Agilent, USA), equipped with a diode array detector; chromatographic column model is ZORBAX SB-C18 (250×4.6 mm, Agilent, USA); 7.6% sodium acetate-7% acetonitrile aqueous solution (pH 6.5) is used as mobile phase A, and 80% acetonitrile-water solution is used as mobile phase B, and gradient elution is performed at a flow rate of 0.6 mL / min according to the following ratio: 0-11 min, component B increases from 0% to 7%; 11-13.9 min, component B increases from 7% to 12%; 13.9-14 min, component B increases from 12% to 15%; 14-29 min, component B increases from 15% to 34%; 29-37 min, component B increases to 100%; 37-45 min, component B decreases to 0%; detection wavelength is 254 nm; column temperature is 40°C; injection volume is 5 μL.

[0069] The pre-column treatment method for detecting byproducts was as follows: After removing the whole-cell catalytic sample, the sample was diluted to an appropriate multiple and then centrifuged at 14,000 rpm for 10 minutes. The supernatant was filtered through a 0.22 μm filter membrane and then used for HPLC analysis. The specific detection method was as follows: the HPLC model was LC-20AT (Shimadzu, Japan) equipped with a differential refractive index detector and a diode array detector; the ion exchange chromatography column model was Aminex HPX-87H (300 × 7.8 mm, Bio-Rad, USA); the mobile phase was 5 mM dilute sulfuric acid; the flow rate was 0.4 mL / min; the column temperature was 30°C; and the injection volume was 5 μL.

[0070] E. coli has a short growth cycle, high spatiotemporal yield, a clear genetic background, and is relatively easy to genetically modify.

[0071] Example 1: Construction of a chassis strain for producing L-norvaline using E. coli BL21 (DE3) as the starting strain

[0072] Endogenous alcohol dehydrogenase and aldehyde dehydrogenase in the E. coli BL21 (DE3) strain convert propionaldehyde into byproducts n-propanol and propionic acid, respectively, in a whole-cell catalytic system, resulting in the loss of the substrate propionaldehyde. The present invention reduces carbon loss by directly knocking out the genes encoding the relevant byproducts.

[0073] 1. Knockout of genes related to byproduct synthesis

[0074] The present invention uses CRISPR-Cas9 gene editing technology to edit the byproduct gene. Furthermore, the basic operation procedure of knocking out the byproduct gene yqhD is demonstrated using the construction of the strain E. coli BL21 (DE3)-ΔyqhD as an example.

[0075] 1.1 Knockout of the alcohol dehydrogenase gene yqhD

[0076] The basic procedures for constructing the E. coli BL21(DE3)-ΔyqhD strain are as follows:

[0077] Preparation of competent cells for transfection

[0078] The starting strain E. coli BL21 (DE3) was activated in LB for one generation, then transferred to new LB and cultured to an OD of 600nm was 0.5-0.6; then, 1 mL of bacterial solution was centrifuged at 4°C and 6000 rpm for 10 min; the supernatant was discarded and the bacteria were resuspended in 50 μL TSB solution to prepare competent cells for chemical transformation.

[0079] Introduction of pEcCas knockout vector

[0080] The knockout vector pEcCas was extracted according to the extraction procedure of the plasmid extraction kit, and then pEcCas was transformed into E. coli BL21 (DE3) competent cells using the heat shock method to obtain the E. coli BL21 (DE3)-pEcCas strain.

[0081] Preparation of dsDNA-N20-yqhD fragment

[0082] The N20 sequence of the yqhD gene was designed using the online website https: / / chopchop.cbu.uib.no / . The reverse complementary primers gRNA-yqhD-F and gRNA-yqhD-R were designed based on the screened N20 sequence. The two primers were annealed to form a dsDNA-N20-yqhD fragment.

[0083] Annealing system: 25 μL ddH2O, 5 μL T4 ligase buffer, 10 μL gRNA-yqhD-F, 10 μL gRNA-yqhD-R (primer concentration is 10 μM).

[0084] Annealing procedure: The annealing system was incubated at 95°C for 5 min, and then the reaction temperature was gradually reduced to 16°C by programmed cooling and maintained at 16°C for 10 min.

[0085] Construction of knockout vector pEcgRNA-dsDNA-N20-yqhD

[0086] The knockout vector pEcgRNA was extracted according to the extraction procedure of the plasmid extraction kit, and the linear vector pEcgRNA was obtained after single enzyme digestion with BsaI; then it was ligated with the dsDNA-N20-yqhD fragment under the action of T4 DNA ligase to obtain pEcgRNA-dsDNA-N20-yqhD.

[0087] T4 DNA ligation system: 6 μL dsDNA-N20-yqhD fragment (diluted 200-fold), 1 μL linearized pEcgRNA vector, 1 μL T4 ligase buffer, 1 μL T4 DNA ligase, 1 μL ddH2O.

[0088] The T4 DNA ligation system was transformed into E. coli DH5α competent cells using the heat shock method. The cells were then plated onto a solid plate containing spectinomycin and inverted for culture. Finally, a single colony was picked from the plate and further cultured in LB (containing spectinomycin). After centrifugation, the plasmid pEcgRNA-dsDNAN20-yqhD was extracted according to the protocol of the plasmid extraction kit and stored frozen at -20°C.

[0089] Construction of donor fragment for yqhD gene knockout

[0090] Using the E. coli BL21 (DE3) genome as a template, uf-yqhD / ur-yqhD were used as primers to PCR amplify the upstream homology arm fragment of the gene yqhD; df-yqhD / dr-yqhD were used as primers to PCR amplify the downstream homology arm fragment of the gene yqhD.

[0091] Homology arm fragments; overlap PCR of the upstream homology arm and the downstream homology arm, and after gel recovery, the fusion fragment of the upstream and downstream homology arms of the yqhD gene is obtained, which is the donor fragment of the yqhD gene knockout. Among them, the primers for amplifying the yqhD gene knockout donor fragment are designed as follows:

[0092] uf-yqhD:TTATTCTCAATCCGTTTCAGCACGCG

[0093] ur-yqhD:TACTTGCTCCCTTTGCTGGGC

[0094] df-yqhD:CCCAGCAAAGGGAGCAAGTAGCTTTTTACGCCTCAAACTTTCGTTTTCG

[0095] dr-yqhD:CGATTTCGGGATCACCACCAGG

[0096] Preparation of E. coli BL21(DE3)-pEcCas electroporation competent cells

[0097] The E. coli BL21 (DE3)-pEcCas strain was activated in LB for 12 h and inoculated into a shake flask containing 50 mL LB (10 mM arabinose was used to induce the expression of λ Red recombinant protein) at a 1% inoculum volume. The shake flask was then cultured at 37°C and 180 rpm until the strain OD reached 0. 600nm When the p-value is 0.5-0.6, the shake flask is removed and placed in an ice bath for 10 minutes. The mixture is then centrifuged at 6000 rpm for 10 minutes at 4°C in a low-temperature high-speed centrifuge and the supernatant is discarded. The cells are washed twice with ddH2O in an ice bath and once with 10% (v / v) glycerol in an ice bath. Finally, 150 μL of 10% glycerol in an ice bath is added to resuspend the cells to obtain E. coli BL21(DE3)-pEcCas electroporation competent cells, which can be stored frozen at -80°C.

[0098] Construction of E. coli BL21(DE3)-ΔyqhD strain

[0099] The knockout vector pEcgRNA-dsDNA-N20-yqhD (about 200 ng) and the yqhD gene knockout donor fragment (about 400 ng) were mixed with the electroporation competent cells E. coli BL21 (DE3)-pEcCas; then they were transferred to a 2 mm electroporation cuvette and placed in an ice bath for 3 minutes; both were transferred to the competent cells E. coli BL21 (DE3)-pEcCas using an electroporator; after the electroporation was completed, 1 mL of The bacteria were resuspended in LB and transferred to a new 1.5 mL centrifuge tube and incubated at 37°C and 960 rpm for 1 h. Finally, the bacterial solution was centrifuged at 6000 rpm for 2 min, the supernatant was discarded, and all the remaining bacteria were streaked onto double-antibody LB solid screening medium (kanamycin + spectinomycin). After a single colony grew on the double-antibody plate, it was picked and cultured in a new LB medium, and the bacterial solution was verified by PCR using primers uf-yqhD / dr-yqhD.

[0100] The correct monoclonal clone verified by PCR was transferred to a new LB shake tube (10 mM rhamnose + kanamycin) and cultured at 37 ° C and 180 rpm for 12 to 16 hours; then, a sterile coating stick was used to divide it and streak it on a new LB solid plate (kanamycin) and cultured until a new monoclonal clone was formed; then, a sterile toothpick was used to pick the new monoclonal clone, and it was spotted on a new LB solid plate containing spectinomycin and an LB solid plate containing kanamycin in turn, and cultured inverted; finally, the monoclonal clone that grew on the kanamycin plate but could not grow on the spectinomycin plate was the strain that successfully eliminated pEcgRNA-dsDNA-N20-yqhD.

[0101] The above-mentioned single clone that successfully eliminated pEcgRNA-dsDNA-N20-yqhD was transferred to a new LB shake tube and cultured at 37°C and 180 rpm for 12 to 16 hours. It was then streaked onto an LB solid plate containing 10% sucrose using a sterile coating stick and cultured until a new single clone was formed. Similarly, a new single clone was picked up using a sterile toothpick and spotted onto a new kanamycin-containing LB solid plate and an antibiotic-free LB solid plate, and cultured inverted. Finally, the single clone that grew on the antibiotic-free LB solid plate but could not grow on the kanamycin plate was the strain that successfully eliminated pEcCas.

[0102] The monoclonal clone with both pEcgRNA-dsDNA-N20-yqhD and pEcCas eliminated was transferred to new LB medium, and its genome was extracted according to the operating procedures of the genome extraction kit, and the primers uf-yqhD / dr-yqhD were used for the final temperature gradient verification (the temperature gradient verification range was 50-70°C); the strain mutant E. coli BL21 (DE3)-ΔyqhD with the correct electrophoresis band size was transferred and stored in 15% glycerol.

[0103] 1.2 Knockout of the alcohol dehydrogenase gene yjgB

[0104] Similarly, the construction and knockout steps of the gene yjgB knockout vector can be completed by referring to the knockout procedure of the gene yqhD mentioned above. Among them, the primers for amplifying the gene yjgB knockout donor fragment are designed as follows:

[0105] uf-yjgB:CACTTTTTATTGGTGCCATGCCACT

[0106] ur-yjgB:TTTTTGGTCCTTCTCTGGTGTTGTTTGG

[0107] df-yjgB: CACCAGAGAAGGACCAAAAAAAAATCATTCGCAGCGCTGATCT

[0108] dr-yjgB:TGTGTTTTTCACTTGCATAAATTCCTCACTGG

[0109] 1.3 Knockout of the alcohol dehydrogenase gene fucO

[0110] Similarly, the construction and knockout steps of the fucO gene knockout vector can be completed by referring to the knockout procedure of the yqhD gene described above. The primers for amplifying the fucO gene knockout donor fragment are designed as follows:

[0111] uf-fucO:CGCACCAGAAAATCATTGATATGGCC

[0112] ur-fucO: GCATTATCACATCAGCGCATCCTTCTCCTTGTTGCTTTACGAAATTACTCT

[0113] df-fucO:GTAAAGCAACAAGGAGAAGGATGCGCTGATGTGATAATGCCG

[0114] dr-fucO:ATTTGCTTATTGTCGATGCACTGAATCTT

[0115] 1.4 Knockout of the alcohol dehydrogenase gene adhP

[0116] Similarly, the construction and knockout steps of the adhP gene knockout vector can be completed by referring to the above-mentioned yqhD gene knockout procedure. Among them, the primers for amplifying the adhP gene knockout donor fragment are designed as follows:

[0117] uf-adhP:GATGCCGAACCTGCTGCC

[0118] ur-adhP:GCAGTCCGCAGCAAAGGCCTCAGTTCCTCCTTTTCGGATGATGTTCT

[0119] df-adhP: TCATCCGAAAAGGAGGAACTGAGGCCTTTGCTGCGACT

[0120] dr-adhP: TCATCCTGATCCACGCCATCC

[0121] 1.5 Knockout of the alcohol dehydrogenase gene adhE

[0122] Similarly, the construction and knockout steps of the adhE gene knockout vector can be completed by referring to the above-mentioned yqhD gene knockout procedure. Among them, the primers for amplifying the adhE gene knockout donor fragment are designed as follows:

[0123] uf-adhE: TTCTTGCTTGTTCTGTTTATCCTCGCC

[0124] ur-adhE: AGACAGCGCTACTGAAATGCTCTCCTGATAATGTTAAACTTTTTTAGTAAATCATCT

[0125] df-adhE: AGTTTAACATTATCAGGAGAGCATTTCAGTAGCGCTGTCTGGCAATATAAACG

[0126] dr-adhE: TGATGATCGCTTTGGTGCCGG

[0127] 1.6 Knockout of the alcohol dehydrogenase gene eutG

[0128] Similarly, the construction and knockout steps of the eutG gene knockout vector can be completed by referring to the above-mentioned yqhD gene knockout procedure. Among them, the primers for amplifying the eutG gene knockout donor fragment are designed as follows:

[0129] uf-eutG:CCCACGTCTGCAAACGGC

[0130] ur-eutG: GCAAGCGTCGCATCCGGCATATAGCCCCTCCGCTTTCTCT

[0131] df-eutG:AGAGAAAGCGGAGGGGCTATATGCCGGATGCGACGCTTGCCGCAT

[0132] dr-eutG: TGCCCGCCAGCACGCCGAGCG

[0133] 1.7 Knockout of the aldehyde dehydrogenase gene puuC

[0134] Similarly, the construction and knockout steps of the gene puuC knockout vector can be completed by referring to the knockout procedure of the gene yqhD mentioned above. Among them, the primers for amplifying the gene puuC knockout donor fragment are designed as follows:

[0135] uf-puuC:CTTGTCGGAAATCCGCCAGC

[0136] ur-puuC:TATGACTCCTGTTTCACGTCTATCAGATATATGC

[0137] df-puuC:GACGTGAAACAGGAGTCATAAATGACCGAACATACCAGCAGTTACT

[0138] dr-puuC:AATCTCCGACAGCCGCTCG

[0139] 1.8 Knockout of the aldehyde dehydrogenase gene ydcW

[0140] Similarly, the construction and knockout steps of the ydcW gene knockout vector can be completed by referring to the above-mentioned yqhD gene knockout procedure. Among them, the primers for amplifying the ydcW gene knockout donor fragment are designed as follows:

[0141] uf-ydcW:CACCGTTTTCCTCAAACTGGCG

[0142] ur-ydcW:TACGATCTGCAATATTATCCAGCATATTCCTGTATCAGTGGTTATTGACC

[0143] df-ydcW:CACTGATACAGGAATATGCTGGATAATATTGCAGATCGTAAGAGTATGAGATGATCTT

[0144] dr-ydcW:CGTGATGGGCGATCGCT

[0145] 1.9 Knockout of the aldehyde dehydrogenase gene feaB

[0146] Similarly, the construction and knockout steps of the feaB gene knockout vector can be completed by referring to the above-mentioned yqhD gene knockout procedure. Among them, the primers for amplifying the feaB gene knockout donor fragment are designed as follows:

[0147] uf-feaB:ATTCCCGCTGATGAAGTACCGG

[0148] ur-feaB:TTACTTATGAGCGAACAAGACACTTTTCCTTTATTTACCCAGTGTGATTTCAGT

[0149] df-feaB:GTAAAATAATAAGGAAAAGTGTCTTGTTCGCTCATAAGTAAAAAACGGCG

[0150] dr-feaB:CATCGATGCCGGTGCTACG

[0151] 1.10 Knockout of the aldehyde dehydrogenase gene betB

[0152] Similarly, the construction and knockout steps of the gene betB knockout vector can be completed by referring to the knockout procedure of the gene yqhD mentioned above. Among them, the primers for amplifying the gene betB knockout donor fragment are designed as follows:

[0153] uf-betB:AGTCCGGCGGAGGTGTAAA

[0154] ur-betB:ATTGCAAATAAACCTCCTGGCACGTCTCCTCGGTTAATCGGT

[0155] df-betB:CGATTAACCGAGGAGACGTGCCAGGAGGTTTATTTGCAATTTGACTACATC

[0156] dr-betB:AGGCAATCGCGCCTGC

[0157] 1.11 Knockout of the aldehyde dehydrogenase gene aldA

[0158] Similarly, the construction and knockout steps of the aldA gene knockout vector can be completed by referring to the above-mentioned yqhD gene knockout procedure. Among them, the primers for amplifying the aldA gene knockout donor fragment are designed as follows:

[0159] uf-aldA:GATTAGTGGTGGTATCGGTCACTCG

[0160] ur-aldA:ACCTCCGCCTCTTTTACTCAGGGCGACTCCTGTGATTTATATGTTTTGT

[0161] df-aldA:ATAAATCACAGGAGTCGCCCTGAGTAAAAGAGGCGGAGGTTTTTTCC

[0162] dr-aldA:AATATTCCGTGGAAAGCGAAAGGTG

[0163] 1.12 Knockout of the aldehyde dehydrogenase gene aldB

[0164] Similarly, the construction and knockout steps of the aldB gene knockout vector can be completed by referring to the above-mentioned yqhD gene knockout procedure. Among them, the primers for amplifying the aldB gene knockout donor fragment are designed as follows:

[0165] uf-aldB:TCCTGTCAATGACTCCTCGCTGATG

[0166] ur-aldB:AATGCGACCAGCTTCTTATAGATCGTCTCCTTGCGGTGTGA

[0167] df-aldB:CACACCGCAAGGAGACGATCTATAAGAAGCTGGTCGCATTGGGTATTCA

[0168] dr-aldB:GCATAACGGATGAATCATGGCTTTGC

[0169] 1.13 Knockout of the aldehyde dehydrogenase gene sad

[0170] Similarly, the construction and knockout steps of the gene sad knockout vector can be completed by referring to the above-mentioned gene yqhD knockout procedure. Among them, the primers for amplifying the gene sad knockout donor fragment are designed as follows:

[0171] uf-sad:TAAGCGCAATGCCTGCTCCTG

[0172] ur-sad:TCAGAGCTGAATATGTCGCGCGGGGTATCTCCTTTATGAGTCATGG

[0173] df-sad:CTCATAAAGGAGATACCCCGCGCGACATATTCAGCTCTGATATACTCG

[0174] dr-sad:GTTCTGGTACATACCACTGGTCGC

[0175] Finally, the genotype of the Escherichia coli mutant strain in which the relevant by-product genes were correctly knocked out was E. coli BL21(DE3)-ΔyqhD-ΔyjgB-ΔfucO-ΔadhP-ΔadhE-ΔeutG-ΔpuuC-ΔydcW-ΔfeaB-ΔbetB-ΔaldA-ΔaldB-Δsad.

[0176] Example 2: Introduction of the biosynthetic pathway of L-norvaline into chassis strains

[0177] Construction of a plasmid-based engineered strain for L-norvaline production.

[0178] In this embodiment, the coding gene of the L-threonine aldolase, PpltaE D93H and L-threonine dehydratase encoding gene EcilvA F352A / R362FThe promoters used in both the multiple cloning sites 1 (BamHI and HindIII) and 2 (BglII and XhoI) of the commercial vector pACYCDuet-1 are P T7 promoter.

[0179] The formate dehydrogenase encoding gene Opfdh, the active intermediate deaminase A encoding gene EcridA and the leucine dehydrogenase encoding gene Tvleudh are located in the commercial vector pETDuet-1 multiple cloning site 1 (restriction sites are BamHI and SalI), multiple cloning site 2 (restriction sites are BglII and XhoI) and between multiple cloning sites 1 and 2 (restriction sites are HindIII and NotI), respectively. Opfdh and EcridA share the P on the multiple cloning site 1. T7 The promoter initiates transcription, and Tvleudh uses the P T7 The promoter initiates transcription.

[0180] The L-norvaline production plasmid pACYCDuet-PpltaE was converted into D93H -EcilvA F352A / R362F The chassis strain E. coli BL21(DE3)-ΔyqhD-ΔyjgB-ΔfucO-ΔadhP-ΔadhE-ΔeutG-ΔpuuC-ΔydcW-ΔfeaB-ΔbetB-ΔaldA-ΔaldB-Δsad that had undergone a series of metabolic engineering modifications was simultaneously introduced with pETDuet-Opfdh-EcridA-Tvleudh to obtain an engineered E. coli strain that can produce L-norvaline using the plasmid.

[0181] Example 3: Catalytic production of L-norvaline using whole cells of an engineered Escherichia coli strain

[0182] 3.1 Plate activation: Take an appropriate amount of E. coli BL21(DE3)-ΔyqhD-ΔyjgB-ΔfucO-ΔadhP-ΔadhE-ΔeutG-ΔpuuC-ΔydcW-ΔfeaB-ΔbetB-ΔaldA-ΔaldB-Δsad(pACYCDuet-PpltaE D93H -EcilvA F352A / R362F The bacterial suspension of the product was streaked onto new ampicillin + chloramphenicol solid plates using a sterile spreader stick and cultured at 37°C until a single colony was formed on the plate.

[0183] 3.2 Shake tube activation: Pick a single colony from the above ampicillin + chloramphenicol solid plate, transfer it to an LB shake tube, and culture it at 37°C and 180 rpm for 12 hours.

[0184] 3.3 Shake flask activation: The seed liquid activated in the shake tube was transferred to a shake flask containing 100 mL of LB medium at a 1% inoculum volume and the activation culture was continued at 37°C and 180 rpm for 12 h.

[0185] 3.4 Cultivation of engineered strains: Inoculate the activated seed solution into a shake flask containing 1 LLB medium at a 2% (v / v) inoculation volume and culture at 37°C and 180 rpm until the OD 600nm 0.6-0.8, add inducer IPTG (working concentration 0.5 mM) to induce the expression of key proteins, and induce at 30°C and 160 rpm for 15 h.

[0186] 3.5 Preparation of Resting Cells: Collect the bacterial suspension 15 hours after induction and centrifuge at 6000 rpm for 10 minutes at 4°C in a low-temperature high-speed centrifuge. Discard the supernatant. Resuspend the cells in 30 mL of 0.85% saline, transfer the suspension to a 50 mL centrifuge tube, and centrifuge again at 6000 rpm for 10 minutes at 4°C in a low-temperature high-speed centrifuge. Discard the supernatant. Repeat this process once. Refrigerate the collected bacterial slurry at 4°C until needed.

[0187] 3.6 Whole-cell catalysis: The conditions for whole-cell catalysis are as follows: the catalytic system is 20 mL, the cell density is OD 600nm 60, the temperature was controlled at 37°C, the speed was controlled at 200 rpm, the buffer used was 100 mM potassium phosphate buffer with pH 7.0, the initial substrate concentration could be 50 mM propionaldehyde, 300 mM glycine, 600 mM sodium formate, 0.2 mM PLP and 5 mM EDTA, and the propionaldehyde feeding rate was 100 mM / h for 3.5 h; the initial substrate concentration could also be 50 mM propionaldehyde, 400 mM glycine, 800 mM sodium formate, 0.2 mM PLP and 5 mM EDTA, and the propionaldehyde feeding rate was 150 mM / h for 3 h.

[0188] The whole cell catalysis results showed that the engineered strain E. coli BL21 (DE3)-ΔyqhD-ΔyjgB-ΔfucO-ΔadhP-ΔadhE-ΔeutG-ΔpuuC-ΔydcW-ΔfeaB-ΔbetB-ΔaldA-ΔaldB-Δsad (pACYCDuet-PpltaE D93H -EcilvA F352A / R362F+pETDuet-Opfdh-EcridA-Tvleudh) whole cells catalyzed the production of L-norvaline, with an initial glycine concentration of 300 mM of 35.3 g / L, a yield of 98.4% calculated as glycine, and a production efficiency of 8.83 g / L / h; and an initial glycine concentration of 400 mM of 46.5 g / L, a yield of 99.1% calculated as glycine, and a production efficiency of 11.63 g / L / h.

[0189] Example 4: Introduction of the biosynthetic pathway of L-norvaline into chassis strains

[0190] Construction of a plasmid-based engineered strain for L-norvaline production.

[0191] In this embodiment, the L-threonine aldolase encoding gene PpltaE and the L-threonine dehydratase encoding gene EcilvA are located in the multiple cloning site 1 (restriction sites are BamHI and HindIII) and multiple cloning site 2 (restriction sites are BglII and XhoI) of the commercial vector pACYCDuet-1, respectively, and the promoters used in both are P T7 promoter.

[0192] The formate dehydrogenase encoding gene Cbfdh, the active intermediate deaminase A encoding gene EcridA and the leucine dehydrogenase encoding gene Bsleudh are respectively located in the multiple cloning site 1 (restriction sites are BamHI and SalI), the multiple cloning site 2 (restriction sites are BglII and XhoI) and between the multiple cloning sites 1 and 2 (restriction sites are HindIII and NotI) of the commercial vector pETDuet-1. Cbfdh and EcridA share the P on the multiple cloning site 1. T7 The promoter initiates transcription, and Bsleudh uses the P T7 The promoter initiates transcription.

[0193] Through TSB chemical transformation, the L-norvaline production plasmids pACYCDuet-PpltaE-EcilvA and pETDuet-Cbfdh-EcridA-Bsleudh were simultaneously introduced into the chassis strain E. coli BL21 (DE3)-ΔyqhD-ΔyjgB-ΔfucO-ΔadhP-ΔadhE-ΔeutG-ΔpuuC-ΔydcW-ΔfeaB-ΔbetB-ΔaldA-ΔaldB-Δsad after a series of metabolic engineering modifications to obtain an E. coli engineered strain that can produce L-norvaline using the plasmids.

[0194] Example 5: Catalytic production of L-norvaline using whole cells of an engineered Escherichia coli strain

[0195] For relevant steps, please refer to Example 3 of the present invention.

[0196] The whole-cell catalytic results showed that the yield of L-norvaline produced by whole-cell catalysis of the engineered strain E. coli BL21(DE3)-ΔyqhD-ΔyjgB-ΔfucO-ΔadhP-ΔadhE-ΔeutG-ΔpuuC-ΔydcW-ΔfeaB-ΔbetB-ΔaldA-ΔaldB-Δsad (pACYCDuet-PpltaE-EcilvA+pETDuet-Cbfdh-EcridA-Bsleudh) was 26.7 g / L when the initial glycine concentration was 300 mM, the yield calculated as glycine was 76.0%, and the production efficiency was 6.68 g / L / h.

[0197] Example 6: Introduction of the biosynthetic pathway of L-norvaline into chassis strains

[0198] Construction of a plasmid-based engineered strain for L-norvaline production.

[0199] In this example, the L-threonine aldolase encoding gene EcltaE and the L-threonine dehydratase encoding gene EctdcB are located in the multiple cloning site 1 (restriction sites are BamHI and HindIII) and multiple cloning site 2 (restriction sites are BglII and XhoI) of the commercial vector pACYCDuet-1, respectively. The promoters used in both are P T7 promoter.

[0200] The formate dehydrogenase encoding gene Cbfdh A10C The gene encoding the active intermediate deaminase A, EcridA, and the gene encoding the phenylalanine dehydrogenase, Nophedh, are located in the multiple cloning site 1 (with restriction enzymes BamHI and SalI), the multiple cloning site 2 (with restriction enzymes BglII and XhoI), and between the multiple cloning sites 1 and 2 (with restriction enzymes HindIII and NotI) of the commercial vector pETDuet-1, respectively. A10C and EcridA share the P at the multiple cloning site 1 T7 The promoter initiates transcription, and Nophedh uses the P T7 The promoter initiates transcription.

[0201] The L-norvaline production plasmids pACYCDuet-EcltaE-EctdcB and pETDuet-Cbfdh were converted into A10C-EcridA-Nophedh were simultaneously introduced into the chassis strain E.coliBL21(DE3)-ΔyqhD-ΔyjgB-ΔfucO-ΔadhP-ΔadhE-ΔeutG-ΔpuuC-ΔydcW-ΔfeaB-ΔbetB-ΔaldA-ΔaldB-Δsad which had undergone a series of metabolic engineering modifications to obtain an Escherichia coli engineered strain that could produce L-norvaline using the plasmid.

[0202] Example 7: Catalytic production of L-norvaline using whole cells of an engineered Escherichia coli strain

[0203] For relevant steps, please refer to Example 3 of the present invention.

[0204] The whole cell catalysis results showed that the engineered strain E. coli BL21 (DE3)-ΔyqhD-ΔyjgB-ΔfucO-ΔadhP-ΔadhE-ΔeutG-ΔpuuC-ΔydcW-ΔfeaB-ΔbetB-ΔaldA-ΔaldB-Δsad (pACYCDuet-EcltaE-EctdcB+pETDuet-Cbfdh A10C The yield of L-norvaline produced by the whole cells of EcridA-Nophedh was 12.4 g / L when the initial glycine concentration was 300 mM, the yield calculated based on glycine was 35.3%, and the production efficiency was 3.1 g / L / h.

[0205] Example 8: Introduction of the biosynthetic pathway of L-norvaline into chassis strains

[0206] Construction of a plasmid-based engineered strain for L-norvaline production.

[0207] In this embodiment, the coding gene of the L-threonine aldolase EcltaE H126F The gene encoding L-threonine dehydratase, MsilvA, and the gene encoding L-threonine dehydratase, MsilvA, are located in the multiple cloning site 1 (with restriction enzyme sites of BamHI and HindIII) and the multiple cloning site 2 (with restriction enzyme sites of BglII and XhoI) of the commercial vector pACYCDuet-1, respectively. The promoters used in both are P T7 promoter.

[0208] The formate dehydrogenase encoding gene Rjfdh, the active intermediate deaminase A encoding gene EcridA and the glutamate dehydrogenase encoding gene Ecgdh are located in the commercial vector pETDuet-1 multiple cloning site 1 (restriction sites are BamHI and SalI), multiple cloning site 2 (restriction sites are BglII and XhoI) and between multiple cloning sites 1 and 2 (restriction sites are HindIII and NotI), respectively. Rjfdh and EcridA share the P on multiple cloning site 1.T7 The promoter initiates transcription, and Ecgdh uses the P T7 The promoter initiates transcription.

[0209] The L-norvaline production plasmid pACYCDuet-EcltaE was converted into H126F -MsilvA and pETDuet-Rjfdh-EcridA-Ecgdh were simultaneously introduced into the chassis strain E. coli BL21 (DE3)-ΔyqhD-ΔyjgB-ΔfucO-ΔadhP-ΔadhE-ΔeutG-ΔpuuC-ΔydcW-ΔfeaB-ΔbetB-ΔaldA-ΔaldB-Δsad that had undergone a series of metabolic engineering modifications to obtain an E. coli engineered strain that can produce L-norvaline using the plasmid.

[0210] Example 9: Catalytic production of L-norvaline using whole cells of an engineered Escherichia coli strain

[0211] For relevant steps, please refer to Example 3 of the present invention.

[0212] The whole cell catalysis results showed that the engineered strain E. coli BL21 (DE3)-ΔyqhD-ΔyjgB-ΔfucO-ΔadhP-ΔadhE-ΔeutG-ΔpuuC-ΔydcW-ΔfeaB-ΔbetB-ΔaldA-ΔaldB-Δsad (pACYCDuet-EcltaE H126F -MsilvA+pETDuet-Rjfdh-EcridA-Ecgdh) whole cells catalyzed the production of L-norvaline, with an initial glycine concentration of 300 mM and a yield of 59.2% calculated based on glycine, and a production efficiency of 5.2 g / L / h.

[0213] Example 10: Introduction of the biosynthetic pathway of L-norvaline into chassis strains

[0214] Construction of a plasmid-based engineered strain for L-norvaline production.

[0215] In this embodiment, the coding gene of the L-threonine aldolase, PpltaE D93H The genes encoding L-phenylserine dehydratase, Pxpsdh, and Pxpsdh are located in the multiple cloning site 1 (with restriction enzyme sites of BamHI and HindIII) and multiple cloning site 2 (with restriction enzyme sites of BglII and XhoI) of the commercial vector pACYCDuet-1, respectively. The promoters used in both are P T7 promoter.

[0216] The formate dehydrogenase encoding gene Psfdh, the active intermediate deaminase A encoding gene EcridA and the leucine dehydrogenase encoding gene Tvleudh are respectively located in the multiple cloning site 1 (restriction sites are BamHI and SalI), the multiple cloning site 2 (restriction sites are BglII and XhoI) and between the multiple cloning sites 1 and 2 (restriction sites are HindIII and NotI) of the commercial vector pETDuet-1. Psfdh and EcridA share the P on the multiple cloning site 1. T7 The promoter initiates transcription, and Tvleudh uses the P T7 The promoter initiates transcription.

[0217] The L-norvaline production plasmid pACYCDuet-PpltaE was converted into D93H -Pxpsdh and pETDuet-Psfdh-EcridA-Tvleudh were simultaneously introduced into the chassis strain E.coliBL21(DE3)-ΔyqhD-ΔyjgB-ΔfucO-ΔadhP-ΔadhE-ΔeutG-ΔpuuC-ΔydcW-ΔfeaB-ΔbetB-ΔaldA-ΔaldB-Δsad that had undergone a series of metabolic engineering modifications to obtain an Escherichia coli engineered strain that can produce L-norvaline using plasmids.

[0218] Example 11: Catalytic production of L-norvaline using whole cells of an engineered Escherichia coli strain

[0219] For relevant steps, please refer to Example 3 of the present invention.

[0220] The whole cell catalysis results showed that the engineered strain E. coli BL21 (DE3)-ΔyqhD-ΔyjgB-ΔfucO-ΔadhP-ΔadhE-ΔeutG-ΔpuuC-ΔydcW-ΔfeaB-ΔbetB-ΔaldA-ΔaldB-Δsad (pACYCDuet-PpltaE D93H -Pxpsdh+pETDuet-Psfdh-EcridA-Tvleudh) whole cells catalyzed the production of L-norvaline, with an initial glycine concentration of 300 mM and a yield of 67.2% calculated based on glycine, and a production efficiency of 5.9 g / L / h.

[0221] Example 12: Introduction of the biosynthetic pathway of L-norvaline into chassis strains

[0222] Construction of a plasmid-based engineered strain for L-norvaline production.

[0223] In this embodiment, the coding gene of the L-threonine aldolase, PpltaE D93H The gene encoding L-phenylserine dehydratase, Rppsdh, and the gene encoding L-phenylserine dehydratase, Rppsdh, are located in the multiple cloning site 1 (with restriction enzyme sites of BamHI and HindIII) and the multiple cloning site 2 (with restriction enzyme sites of BglII and XhoI) of the commercial vector pACYCDuet-1, respectively. The promoters used in both are P T7 promoter.

[0224] The formate dehydrogenase encoding gene Psfdh, the active intermediate deaminase A encoding gene EcridA and the leucine dehydrogenase encoding gene Tvleudh are respectively located in the multiple cloning site 1 (restriction sites are BamHI and SalI), the multiple cloning site 2 (restriction sites are BglII and XhoI) and between the multiple cloning sites 1 and 2 (restriction sites are HindIII and NotI) of the commercial vector pETDuet-1. Psfdh and EcridA share the P on the multiple cloning site 1. T7 The promoter initiates transcription, and Tvleudh uses the P T7 The promoter initiates transcription.

[0225] The L-norvaline production plasmid pACYCDuet-PpltaE was converted into D93H -Rppsdh and pETDuet-Psfdh-EcridA-Tvleudh were simultaneously introduced into the chassis strain E.coliBL21(DE3)-ΔyqhD-ΔyjgB-ΔfucO-ΔadhP-ΔadhE-ΔeutG-ΔpuuC-ΔydcW-ΔfeaB-ΔbetB-ΔaldA-ΔaldB-Δsad that had undergone a series of metabolic engineering modifications to obtain an Escherichia coli engineered strain that can produce L-norvaline using plasmids.

[0226] Example 13: Catalytic production of L-norvaline using whole cells of an engineered Escherichia coli strain

[0227] For relevant steps, please refer to Example 3 of the present invention.

[0228] The whole cell catalysis results showed that the engineered strain E. coli BL21 (DE3)-ΔyqhD-ΔyjgB-ΔfucO-ΔadhP-ΔadhE-ΔeutG-ΔpuuC-ΔydcW-ΔfeaB-ΔbetB-ΔaldA-ΔaldB-Δsad (pACYCDuet-PpltaE D93H-Rppsdh+pETDuet-Psfdh-EcridA-Tvleudh) whole cells catalyzed the production of L-norvaline, with an initial glycine concentration of 300 mM and a yield of 62.0% calculated based on glycine, and a production efficiency of 5.45 g / L / h.

[0229] Matters not covered by the present invention are known technologies.

[0230] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention shall be included within the scope of protection of the present invention.

Claims

1. An engineered strain of Escherichia coli that produces high levels of L-norvaline, characterized in that: The engineered Escherichia coli is obtained by metabolically engineering a wild-type Escherichia coli as a starting bacterium, wherein the metabolic engineering includes any one or both of the following: (a1) weakening the endogenous propionaldehyde metabolic pathway of wild-type Escherichia coli; (a2) Introducing a non-natural L-norvaline synthesis pathway.

2. The engineered Escherichia coli strain according to claim 1, wherein The wild-type Escherichia coli is Escherichia coli BL21 (DE3).

3. The engineered Escherichia coli strain according to claim 1, wherein In the above-mentioned (a1), weakening the endogenous propionaldehyde metabolic pathway of Escherichia coli specifically includes inhibiting the synthesis of n-propanol and propionic acid; further, knocking out one or more of the following coding genes in the starting bacteria: alcohol dehydrogenase genes yqhD, yjgB, fucO, adhP, adhE, eutG and aldehyde dehydrogenase genes ydcW, puuC, feaB, betB, aldA, aldB, sad.

4. The engineered Escherichia coli strain according to claim 1, wherein In said (a2), the introduction of a non-natural L-norvaline synthesis pathway is specifically to overexpress L-threonine aldolase, L-amino acid dehydratase, amino acid dehydrogenase, formate dehydrogenase and active intermediate deaminase A in the starting bacteria or the base bacteria obtained after treatment with (a1).

5. The engineered Escherichia coli strain according to claim 4, wherein The L-threonine aldolase is specifically the L-threonine aldolase PpLtaE derived from Pseudomonas putida KT2440 and its mutant PpLtaE D93H , L-threonine aldolase EcLtaE from E. coli MG1655 and its mutant EcLtaE H126F ; The L-amino acid dehydratase is L-threonine dehydratase or L-phenylserine dehydratase; further, the L-threonine dehydratase is specifically the L-threonine dehydratase EcIlvA derived from E. coli MG1655 and its mutant EcIlvA F352A / R362F , L-threonine dehydratase EcTdcB from E. coli MG1655 and L-threonine dehydratase MsIlvA from Mycobacterium smegmatis; the L-phenylserine dehydratase is specifically L-phenylserine dehydratase PxPSDH from Paraburkholderia xenovorans and L-phenylserine dehydratase RpPSDH from Ralstonia pickettii PS22; The amino acid dehydrogenase is leucine dehydrogenase, phenylalanine dehydrogenase or glutamate dehydrogenase; further, the leucine dehydrogenase is leucine dehydrogenase TvLeuDH derived from Thermoactinomyces vulgaris or leucine dehydrogenase BsLeuDH derived from Bacillus subtilis 168, the phenylalanine dehydrogenase is phenylalanine dehydrogenase NoPheDH derived from Nocardia sp. 239; the glutamate dehydrogenase is glutamate dehydrogenase EcGDH derived from E. coli MG1655; The formate dehydrogenase is the formate dehydrogenase OpFDH from Ogataea parapolymorpha DL-1, the formate dehydrogenase CbFDH from Candida boidinii and its mutant CbFDH. A10C ; Formate dehydrogenase RjFDH from Rhodococcus jostii and formate dehydrogenase PsFDH from Pseudomonas sp.101; The active intermediate deaminase A may be the active intermediate deaminase A EcRidA derived from E. coli MG1655.

6. The engineered Escherichia coli strain according to claim 4, wherein This is achieved by connecting the coding genes of each enzyme to a vector to construct a recombinant expression vector and introducing it into the starting bacteria or the base bacteria obtained after treatment (a1); Furthermore, the encoding genes of each enzyme are shown in SEQ ID NO. 1-20; Furthermore, the vector is a plasmid vector, specifically pACYCDuet-1 and / or pETDuet-1; Furthermore, there are two or more recombinant expression vectors; Among them, the first recombinant expression vector is pACYCDuet-PpltaE D93H -EcilvA F352A / R362F ; The second recombinant expression vector is pETDuet-Opfdh-EcridA-Tvleudh; Furthermore, the L-threonine aldolase mutant PpLtaE D93H The nucleotide sequence of the coding gene is shown in SEQ ID NO.1; the L-threonine dehydratase mutant EcIlvA F352A / R362F The nucleotide sequence of the coding gene is shown in SEQ ID NO. 2; Furthermore, the nucleotide sequence of the formate dehydrogenase OpFDH encoding gene is shown in SEQ ID NO.3; the nucleotide sequence of the active intermediate deaminase A EcRidA encoding gene is shown in SEQ ID NO.4; and the nucleotide sequence of the leucine dehydrogenase TvLeuDH encoding gene is shown in SEQ ID NO.

5.

7. Use of the engineered Escherichia coli strain according to any one of claims 1 to 6 in whole-cell catalytic production of L-norvaline.

8. A method for industrial production of L-norvaline, characterized in that: The method comprises: subjecting the engineered Escherichia coli strain according to any one of claims 1 to 6 to whole-cell catalysis to produce L-norvaline; and separating and purifying the L-norvaline; Furthermore, the specific conditions of the whole cell catalysis include: the cell density is OD 600nm 60, the temperature is controlled at 28-40°C (preferably 37°C), the speed is controlled at 150-250rpm (preferably 200rpm), and the pH is neutral; Furthermore, the initial substrate concentration is 40-80 mM propionaldehyde, 200-600 mM glycine, 500-1000 mM sodium formate, 0.05-0.5 mM PLP and 1-10 mM EDTA, and the propionaldehyde feeding rate is 50-300 mM / h uniformly fed for 1-5 hours.

9. The method for constructing the engineered Escherichia coli strain according to any one of claims 1 to 6, characterized in that: The construction method comprises: using wild-type Escherichia coli as a starting bacterium, and performing the following metabolic engineering transformations (a1) and / or (a2) on the starting bacterium: (a1) weakening the endogenous propionaldehyde metabolic pathway of wild-type Escherichia coli; (a2) introducing a non-natural L-norvaline synthesis pathway; Furthermore, in (a1), weakening the endogenous propionaldehyde metabolic pathway of Escherichia coli specifically includes inhibiting the synthesis of n-propanol and propionic acid; further, one or more of the following coding genes in the starting bacteria can be knocked out: alcohol dehydrogenase genes yqhD, yjgB, fucO, adhP, adhE, eutG and aldehyde dehydrogenase genes ydcW, puuC, feaB, betB, aldA, aldB, sad; In said (a2), the introduction of a non-natural L-norvaline synthesis pathway is specifically to overexpress L-threonine aldolase, L-amino acid dehydratase, amino acid dehydrogenase, formate dehydrogenase and active intermediate deaminase A in the starting bacteria or the base bacteria obtained after treatment with (a1).

10. Use of the engineered Escherichia coli strain according to any one of claims 1 to 6 or the industrial production of L-norvaline according to claim 8 in the fields of agriculture, food, chemical industry and pharmaceutical industry.

Images