Streptomyces albidogensis mutant strain goouC and application thereof

Abstract

The invention discloses a streptomyces albidogensis mutant strain goouC and application thereof, and belongs to the technical field of genetic engineering. The streptomyces albidogensis mutant strain goouC is obtained by overexpressing a goouC gene, and the nucleotide sequence of the goouC gene is as shown in SEQ ID NO.3. The invention further discloses a preparation method of the streptomyces albidogensis mutant strain goouC. The streptomyces albidus mutant strain goouC provided by the invention can be used for increasing the yield of the glutathione to 2.23 g / L. The invention also provides an application of the streptomyces albidoflavus mutant strain goouC in fermentation production of gougerotin, and in addition, a fermentation product of the streptomyces albidoflavus mutant strain goouC has remarkable bacteriostatic activity on rhodotorula, and is suitable for being applied to the fields of agriculture and medicine.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, in particular to a mutant strain gouC of Streptomyces parvum and applications thereof. Background Art

[0002] Gougerotins are a class of peptide nucleoside antibiotics with broad-spectrum bioactivity, exhibiting significant inhibitory effects against fungi, viruses, tumor cells, and mites, and possessing important applications in medicine and agriculture. Currently, known gougerotin-producing bacteria include Streptomyces gougerotii, Streptomyces toyocaensis var. Aspiculamyceticus, and Streptomyces nourise CK-15. The biosynthetic pathway of gougerotins can be divided into a nucleoside and a peptidyl component. The nucleoside component is formed by the coupling of cytosine with UDP-glucuronic acid to form a 4-amino-CGA glycoside, while the peptidyl component is formed by the condensation of D-serine and glycine after methylation. Studies have shown that the gouC and gouD genes play a key role in the synthesis of the sarcosine residue in the peptidyl component, and loss of these genes leads to disruption of gougerotin synthesis.

[0003] In the prior art, heterologous expression experiments in Streptomyces coelicolor have confirmed the functions of gouC and gouD, but research on genetic engineering modification of Streptomyces noursei (after the strain naming and reclassification on NCBI in 2024, Streptomyces albulus CK-15 was classified as Streptomyces noursei strain CK-15) is still relatively limited. At present, the production of goucin mainly relies on fermentation of wild-type strains, which has problems such as low yield (usually less than 1g / L) and long fermentation cycle. In addition, the traditional fermentation process lacks efficient gene regulation means, making it difficult to achieve a significant increase in yield. Although existing studies have attempted to increase yield by optimizing culture medium or fermentation conditions, the effect is limited, and no overexpression strategy of key genes is involved.

[0004] Therefore, developing a genetically engineered strain that can efficiently produce glutathione and optimizing its metabolic pathway through molecular means are the key to solving the bottleneck of existing technologies. Summary of the Invention

[0005] The present invention aims to provide a mutant strain of Streptomyces parvum, gouC, and its application to address the aforementioned problems of the prior art. By constructing a mutant strain of Streptomyces parvum that overexpresses the gouC gene, the present invention significantly increases the yield of glutathione, while optimizing the fermentation process, providing a new technical solution for industrial production.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a Streptomyces parvum mutant strain gouC, wherein the Streptomyces parvum mutant strain gouC is obtained by overexpressing the gouC gene in Streptomyces parvum, and the nucleotide sequence of the gouC gene is shown in SEQ ID NO.3.

[0008] The present invention also provides a method for preparing the Streptomyces parvum mutant strain gouC, comprising the step of introducing the gouC gene into Streptomyces parvum CK-15.

[0009] Furthermore, the Streptomyces parvum CK-15 is deposited in the General Microbiology Center of the China Culture Collection Administration of Microorganisms with a deposit number of CGMCC No. 31251.

[0010] The present invention also provides the use of the mutant strain gouC of Streptomyces parvum in the fermentation production of glutathione.

[0011] The present invention also provides a method for producing glutathione by fermentation, comprising the following steps: culturing the mutant strain gouC of Streptomyces parvum; fermenting in a culture medium containing corn flour, soybean cake powder and glucose; and extracting and purifying glutathione.

[0012] Furthermore, the fermentation conditions are 30° C., 220 rpm, and 72 hours.

[0013] The present invention also provides a glutathione product prepared by the method.

[0014] The present invention also provides a method for increasing the yield of goucin, comprising the step of overexpressing the gouC gene in Streptomyces parvum CK-15.

[0015] Furthermore, the Streptomyces parvum CK-15 is deposited in the General Microbiology Center of the China Culture Collection Administration of Microorganisms with a deposit number of CGMCC No. 31251.

[0016] The present invention also provides the use of the Streptomyces parvum mutant strain gouC or the goutamectin product in the preparation of antifungal, antitumor or antiviral drugs.

[0017] The present invention discloses the following technical effects:

[0018] The present invention solves the problem of low glutamic acid production in wild-type strains by constructing a mutant strain of Streptomyces parvum that overexpresses the gouC gene. The fermentation yield is increased to 2.36 g / L, and the mycelial growth rate and spore production rate are significantly better than those of the wild type. The fermentation product of the mutant strain is verified for purity by LC-MS, and the activity can be confirmed by red yeast antibacterial experiments, providing an efficient technical solution for the large-scale production of glutamic acid and its antifungal and antitumor applications. The present invention also provides a fermentation medium (containing corn flour, soybean cake powder and glucose) and a detection method (LC-MS). The mutant strain gouC of Streptomyces parvum has a fast growth rate and high spore production efficiency. Its fermentation product has strong antibacterial activity against red yeast and can be widely used in the development of antifungal and antitumor drugs. The present invention solves the problem of low yield of wild-type strains and provides reliable technical support for the industrial production of glutamic acid. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0020] Figure 1 This is the amplification map of the gouA-gouM target fragment, where M: DL5000 marker;

[0021] Figure 2 The double enzyme digestion map of pLQ646 plasmid; M1: DL5000 marker; M2: DL15000 marker; 1-5: pLQ646 linearized fragment; 6: negative control pLQ646 plasmid;

[0022] Figure 3 Overexpression verification diagram; M: DL5000 marker; 1-3 are overexpression strains; 4 is CK-15 strain; A: gouA overexpression strain; B: gouB overexpression strain; C: gouC overexpression strain; D: gouD overexpression strain; E: gouE overexpression strain; F: gouF overexpression strain; G: gouG overexpression strain; H: gouH overexpression strain; I: gouI overexpression strain; J: gouJ overexpression strain; K: gouK overexpression strain; L: gouL overexpression strain; M: gouM overexpression strain;

[0023] Figure 4 is the growth phenotype of each overexpression strain;

[0024] Figure 5Statistics of glutathione production in overexpression strains gouC, gouD and CK-15 (A) and production determination of gouA-gouM and CK-15 overexpression strains (B);

[0025] Figure 6 Comparison of the yield of each overexpression strain;

[0026] Figure 7 The curves of mycelial dry weight changes of overexpression strains gouC and CK-15 at different time periods;

[0027] Figure 8 To determine the antibacterial activity of fermentation broth of overexpressing strains gouC and CK-15 against red yeast. DETAILED DESCRIPTION

[0028] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0029] Unless otherwise specified, the experimental methods involved in the following examples are all conventional experimental methods in the art; the materials or reagents involved can be purchased from conventional channels unless otherwise specified.

[0030] High-fidelity enzyme Phanta Max Super-Fidelity DNA Polymerase P505-d2 was purchased from Nanjing Novozymes Biotechnology Co., Ltd., and DNAMaker DL5000 and DNAMaker DL15000 were purchased from TaKaRa, Japan.

[0031] For details of Streptomyces albulus CK-15, please refer to patent CN118995552A; the deposit information of Streptomyces albulus CK-15 is as follows: it was deposited in the General Microbiology Center of China Culture Collection Administration on July 10, 2024, with the deposit number CGMCC No. 31251, and the deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with a postal code of 100101.

[0032] Example 1 Construction of overexpression mutants

[0033] 1. Amplification of target fragments

[0034] Based on the glutathionin gene cluster reported in Streptomyces graminearum on NCBI, BLAST was used to find the target genes gouA-gouM with high similarity from the genome of the above-mentioned Streptomyces parvum CK-15 strain (Genebank No. NZ_CP026094.1). The nucleotide sequences of gouA-gouM are shown below:

[0035] The nucleotide sequence of gouA is:

[0036]

[0037] The nucleotide sequence of gouB is:

[0038]

[0039] The nucleotide sequence of gouC is:

[0040]

[0041] The nucleotide sequence of gouD is:

[0042] ATGACCGAGCACGCCCGGCCGCCGGCCACCGAGCACCGCCCCGTCGACGTCAGCGTCATCATCCCCGCCTACAACGCGCGCGCCACGCTGGAGGCGTGCCTGCTGTCGCTGACGCACCAACGACCGCAAGGAAACGGGTCGTTCGAGGTGCTCGTCATCGACGACGGCTCCACGGACGGCACCGGCCCGATGGTCGACTCCTTCGCCTCCCGCCTGGACCTGCGCTACGTCCACGAGCCCCGTACCCCGGCATCGGGACGCGCCCGGGCGCGCAACATCGGACTGGCCCTGGCCACCGGCAGCCTGGTCGTGACGCTCGACGCCGACCAGGTCGTGGGCCCCGACTTCCTGGCGGAGCACGTCCGCGCGCACGGCACCGCCGACGACCTGCTGGTCGTCGGCCGGCGCCACCAACTGGGGGAGGGCACGTTCGACCTGGCGCGCCTGGCCCGCGGGTTCAGCCTCGGGGCGCTGCCGGAGGTGGTGCGCGGCGACGAACGCGAACCGGTCCTCGCGGCGCTGGGCGGCGAGCTGAGCGATCTGCGCACCGCCTGGCACTACCTGTGGACCTGCAACGCCTCGGTGCGGCGCGACCGACTGGCCGCCGTCGGGGGCTTCGACGAGGAGTTCCACGGCTGGGGCCTGGAGGACGCCGAGTTGGGGTACCGGCTCGTTCAGGACGGCGTCCGGATGCGCTACAGCACCCGAGCCGCCGTCTACCACGAGCACCGCTCCCCGGTCTCCGCGTCGATGTACCGCGAATGGCGCGCGAACCTCGCCCACTTCGCCGGCAAGCACCCCGACCCCGTGGTCCGGCTCCAGGAGATGTTCGCGCCCGCCATCGATCCGGCCGCACCGGCGGCGGAGGCGTGGGTGGACACCGCCGTGCGGTTCGAGCACCGCGCCCGGGCACTGGCCGGCGTCCCGCAGCCGGCCCACCACGGGTGA(SEQ ID NO.4);

[0043] The nucleotide sequence of gouE is as follows:

[0044] ATGACCGAACCGACCACGGCACGCACCCGATCCGCCCTCCTCACCACCCTGCACTCGCTCGCCGGCGAGGTTGACGGGGCACGGAAGTGGAGTCAGACCTCCCGGACCATGGCACCGGCGCGCGTCGCCACGGTGTTCGGCTCGGCCCGCACCGAACGGGACGAACCTGCCTACCAGATGGCCAGGGAACTGGGCGCCGCCCTCGCCGCCCGGCGCTGGACGACCGTGACCGGCGGCGGCCCCGGGATCATGCAGGCCGTCCGGGACGGCAGCGGCACCACGCTGTCCCGGGCGGTGCGCATCGAGATCCCCGGCGAAGTGCCCGACACGGTGCTCGACGAGGACCGTTCGCTCACCGTCGGCACCTTCGCGCTGCGCAAGCTGCTCCTCACCCACGACATCGACGCGCTGTTCGTCTTCCCCGGCGGGGTGGGCACGTTCGACGAGCTCTTCGAGGTCCTGGTCCACCACGACACCGACCGGCTCGACCGCTTCCCCGTGGTGCTCGTCCAACCCGAAGGCACCGGCCTGTGGCAGGCGTTCGTGCAGTTCGTCCAAGCACACCTGGTCGACGCCGGGCTCGCCAGTCCCACGGTGGTCAAGGAACTCGTCGTCGCCGAGTCGGTGGAGGCGGCGCTGGCGGCCGTGGGGGCGCACCCACCGGCCACCGTCCCGCAGCCGGGGACCGCCACCGCGCCGGACGCCACCGCAGACCTCGGCACGGAACGGCGGACGGCATGA(SEQ IDNO.5); The nucleotide sequence of gouF is:

[0045]

[0046] The nucleotide sequence of gouG is:

[0047]

[0048] The nucleotide sequence of gouH is:

[0049]

[0050] The nucleotide sequence of gouI is:

[0051] ATGCCTTCGACTGACCCGGTGGTGGACGCCGCGGTCCGGGACCTGCTGGACCGTTGGGGGCAGCCCGCCGCGGCGTTCTGCGCCTCCGGCGGCGCGGCGCTCGAAGCGGCCCTGGAAGTGCTGGAGGTGGGCTCGGGCGCCGAGGTCGTGGTGCCCGACGTCGGCTGCCACTCCGTCGCCGCGGCCGTCGTCCGCGTCGGCGCGGTGCCGGTGTTCGTCGGCGTCGGCGAGGGCTTGACCCTGCACCCGCCGGACGTGGCGGCGGCGTGCTCCGCACGGACCCGCGCGGTCATCGCGGTGCACCAGTACGGGCTGCCGTGCGACGTGCCCGGCATCGTCGCGGCCGTCCCGCGCGGCGTGGCGGTCATCGAGGACGTGGCCCAGACCTGGGGCTCGACGACCCGGGGCGTGCCGGCCGGCTCCACCGGCACGCTCACCGTCACCTCGTTCGGGCCGTCCAAACCGGTGGCATTGGGCGCCGGCGGTGCGCTCCTCGGCCCGGCAGACCTGGTGTCCGGTGCCGTCGCACGGGGCGACACGTCGGACCGGCACCGGCCGCGTCCCCCGTCACCCGCGCGCTTCCCGGCGCCCCTGTACCCCCTGCTCCCGGCCGCCGTCGCCGAGGCGGACCGCCAACTCGCCAGTCGTAGGGCGGCGGTTGAGCGCTTCACCGGCGGTGACTTGGCCAGGCACTTCCGCCTCCCCGGCCTGCTGCCCGGCTCCAGCGCCGGTTGGACCCGCGTGCCGCTCTACCCGGCAAGGTCCGCAACGCCCCGCCACCTCGCGCAGCTGACGGACGCCCTGGGGGCCGCCCAACGGATGCATCCGCGCCCGCCGTCCGCCCTGCCGATGTTCCGGGGCCGGGACACCCGCGTGGTGACCGGCACCCGGCGGCCCGTGGAACCCCTTCTCGTCAAGATTGGACGACCCTCATGA(SEQ ID NO.9);

[0052] The nucleotide sequence of gouJ is as follows:

[0053]

[0054] The gouK nucleotide sequence is as follows:

[0055] ATGCACACTGACACCGTTTCCCCCGACGAGCTCGACAAGGCCGTCGCCGGCCTGCCCGTGCAGGTGTGGAACGCGCCGACGGCGGCCGAACTCTACGGACAGACCCTCAACCTCGTCTGCCGGACCCGCGGCGGCCGCACGGCGGGCGCCTGGGTGGTCCCCCTGGACGACGACGGAACGGCCGCCCGCCGTCCCTTCCGACTCCTGCCCTACGCCTCACCATGGGTGGACCCGGAACTGCACCCCGTCGACCGCCACCGGGCGGTCCTGTCGATGACCCAGGCACTCATGGACCGGGTGGAGTCGGCGGAGATCCCGATGGACCCGCGCTTCGGAGAGGCGGCCGCCCTGGCCGAAGCGGGGGCCGAACTCCTCTGCCGGCACACCCGCGTCCTGGAACTGCACGCCGACCGCGATCCCCGCACGGGGTACGTGGCCACTGCCCGGAACCACATCAGGGCCGCGGCCCGGGAGCACACCGTGCGGACCGCCCCGCTCGACGCGTTCGACTTCTCCCGCGCGGTCGTCGGCCAACCGGCGGACGCCGTCGCCGCGCGGCGCAGGTCGGGGCTGCGCGTCGGCGGTGTCGAGCCGGCGCTGTGCCTCGCCGCGACGGACCCCGACGGGACCTGCCGGGGCCAGGTGTTCGTCCTGCTCTGCGACGGCGCCGCGGTCCTCATGCACTCGTGGTTCGACCGGGCGGGCGCCCGCGGGGTGCCGAGCCTGCTGGTGGACGAGGCGATCGCGTGGGCGGGCCGGCAGCCCGGCACCGACGTGTTCGACTTCGAGGGCAGCGTGCTGCCCGGCGTCGACCGCTTCATGACCGGATTCGGCGCCCGTGCCTGCGCCTACCCGCAACTGCGGTGGCGCCGCTCGACCGAACCGGGCGCGGGAGCGGGGGAGTTCGGATGA(SEQ ID NO.11);

[0056] The nucleotide sequence of gouL is as follows:

[0057] GTGGCCAACCTTGCCTTGTACGGTCTCGGCGAAATGGGCGCGGACATCGCGCGGTGCCTGGTGTCCCGCGGTGTCGCACTGCACGCGTACGACCCGGTGTCCGACGTGACGTTGGCGGCGGGGAACTTCCACCGCTGCTCGACGGCGGCGGAGGCGGCCCGTGCGGCCGCGGTCCACCTCGTCGTCGTGAAGCGGCCGGACGACGTGCGCGCCCTGCTCTTCGGCGCCGACGGGCTGTGCGCCGCGGCGCCCGCCGGCTCCCACGTGGTGCTGCACACCACCCTCACCCCGCAGACCGTCCGCGAACTGGCCGAGGAGGTGCGGCGGCAGGGGCACGTCCTGCTGGACGCCGCCCTCAGTCGGCGCAACGGTCTGATCCGCGAGGGTTCGCTGTCCCTGTTCGTGGGCGGGACGGCCGAGGAGGTCGCCGCCGTGGGGCCCGTCCTGGACCGCTACGCCGACAACGTGGTCCACGCCGGGCCCACCGGTGCCGGGATGACCGTCAAGCTCTGCAACAACTGGCTCCTCTACAGCAACCGGCACGCCGCGCTCCAGGCGCTCGGCACCGGACGGGCGCTCGGCGTCGACCCCGACGTCCTGCGCGGCGCACTGGCCTCGTCGACCGGTTCCAGTTGGGCACTCGCGCACTACTCGGACCTCGACGAGGCGATCGTCACCGGCCAGGGCGCCCCGGCCGTGGTGCGCGACCGGACCACGTCCGAACTGCGGATGGCCCGGGACATGGCCGCCACCAACGGCCAGGTGCCCACCAGCCTCCAGGAGACCTTCGCGCTGCTCGACGCGATGTGA(SEQ ID NO.12);

[0058] The nucleotide sequence of gouM is as follows:

[0059]

[0060] 2. The sequences of the primers used to amplify the gouA-gouM target sequences are shown in Table 1. Primers were designed using the Primer3Plus-Pick Primers website.

[0061] Table 1 Primer sequences

[0062]

[0063]

[0064]

[0065] PCR reaction system: 13 μL ddH₂O; 25 μL 2*Phanta MAX Buffer; 1 μL dNTP mix; 2 μL upstream primer; 2 μL downstream primer; 1 μL Phanta Max Super-Fidelity DNA Polymerase P505-d2; 1 μL DNA; 5 μL 50% DMSO. PCR reaction conditions: Initial denaturation: 95°C for 10 min; Denaturation: 95°C for 30 sec for 31 cycles; Annealing: 65°C for 30 sec for 31 cycles; Extension: 72°C for 30-60 sec / kb for 31 cycles; Complete extension: 72°C for 10 min.

[0066] The PCR products were detected by electrophoresis in 1% agarose gel, and the electrophoresis detection results were consistent with the target fragment size. The synthetic genes gouA-gouM (nucleotide sequences are shown in SEQ ID NO.1-SEQ ID NO.13) in the glutathione gene cluster were amplified by PCR, and the PCR products were detected by electrophoresis in 1% agarose gel, and the electrophoresis detection results were consistent with the target fragment size. The sizes of the target fragments were: gouA: 1041 bp; gouB: 1788 bp; gouC: 1302 bp; gouD: 948 bp; gouE: 741 bp; gouF: 1194 bp; gouG: 1167 bp; gouH: 1161 bp; gouI: 936 bp; gouJ: 1119 bp; gouK: 912 bp; gouL: 810 bp; gouM: 1503 bp ( Figure 1 )

[0067] The gouA-M gene fragment (SEQ ID NO.1-SEQ ID NO.13) was cloned according to the designed primers (Table 1), and the plasmid pLQ646 was double-digested with Fast Digest EcoRI (FD0274) and Fast Digest NdeI (FD0584) from Thermo Scientific. After enzyme digestion, the enzyme digestion results were confirmed by gel running, and the enzyme-digested fragments were recovered from the gel. The linearized fragments after double enzyme digestion ( Figure 2 1-6) were subjected to agarose gel electrophoresis detection, and the results were as follows Figure 2 As shown, the fragment size is consistent with the expected value. The double enzyme digestion system is: 1 μg DNA; 2 μL 10x Fast Digest Green Buffer; 1 μL Fast Digest EcoRI (FD0274); 1 μL Fast Digest NdeI (FD0584); and 20 μL Nuclease-free water. Reaction conditions: 37°C, 40 min.

[0068] The overexpression vector was constructed using the pLQ646 plasmid, which was previously published in the literature (Elucidation of genes enhancing natural product biosynthesis through co-evolution analysis) (DOI:10.1038 / s42255-024-01024-9). The gouA-M fragment amplification product and the double-enzyme-digested pLQ646 plasmid were assembled using the Gibson Assembly method in a single step isothermal process. After sequencing confirmed the fragment, the overexpression recombinant plasmid was obtained and designated pLQ646-gouA-M (where gouA-M stands for gouA-gouM). The overexpression recombinant plasmid pLQ646-gouA-M was chemically transformed into Ecoli.DH5α competent cells. Single colonies were confirmed positive by colony PCR and sent to a company for sequencing. The sequencing results provided by the company were aligned with the target gene sequence, indicating a consistent overexpression of the gouA-M gene.

[0069] Extract the recombinant plasmid that was successfully constructed and transformed into Ecoli.DH5α, and also use the chemical transformation method to transform into Ecoli.ET12567 (PUZ8002) competent cells. Pick 3-4 transformed single clones for colony or bacterial liquid PCR verification. After the positive clones are confirmed, the PCR products are sent to Sangon Biotech for sequencing again. The sequencing results are also compared with the constructed vector sequence. The comparison results are consistent, further indicating that the overexpression vector was successfully constructed and successfully transformed into Ecoli.ET12567 (PUZ8002) ( Figure 3 ).

[0070] Example 2 Conjugation and transfer of overexpression strains and CK-15 wild-type strains

[0071] (1) On the afternoon before the conjugation transfer, ET12567 carrying the target plasmid (the target plasmid is the gouA-M gene overexpression recombinant plasmid pLQ646-gouA-M) was inoculated into LB medium and cultured at 37°C to obtain ETZ bacterial solution. 600 When it reaches 0.4-0.6, the junction transfer experiment can be started.

[0072] (2) Spread CK-15 wild-type strain spores evenly on SFM solid medium and incubate at 30°C for 3 to 5 days until the surface of the medium is covered with gray-black spores. Subsequently, collect the spores with a cotton swab and suspend them in TES solution for direct conjugation transfer; or dissolve them in 20% glycerol and store them at -80°C for long-term storage.

[0073] (3) Add 1 mL of LB medium to each EP tube, mix thoroughly, and centrifuge at 12,000 rpm for 1 minute to collect ETZ bacteria. Repeat this step three times. Finally, resuspend the cells in 100 μL of medium (equivalent to 10 times concentration) to ensure that the cells are evenly mixed and set aside.

[0074] (4) Take an appropriate amount of spores and add 1 mL of TEES solution. Mix thoroughly and centrifuge at 12,000 rpm for 1 minute. Repeat this procedure twice. Mix thoroughly with 1 mL of TEES and centrifuge for 1 minute. After washing twice, resuspend the spores in 500 μL of TEES and mix thoroughly.

[0075] (5) Heat shock the resuspended Streptomyces spores in a 50°C water bath for 10 minutes, then add 2 times the concentration of spore pre-germination solution and 20 μL of 0.5 M calcium chloride and mix thoroughly.

[0076] (6) The heat-shocked CK-15 wild-type strain spores and Escherichia coli ET12567 cells were mixed in a ratio of 10:1 and spread on a plate containing 10 mM Mg 2+After the plates were dried naturally in a clean bench, they were placed in a 30°C incubator for 16 hours.

[0077] (7) After 16 hours of incubation, evenly cover each plate with 1.5 mL of a mixture (40 μL of Apramycin and 40 μL of Nalidixic acid in ddH2O). After the liquid is blown dry, continue incubating the plate in a 30°C incubator for 3 to 5 days until zygote formation is observed.

[0078] (8) After the zygotes were picked, they were streaked onto SFM solid medium containing a final concentration of 0.1% apramycin and 0.1% nalidixic acid and cultured for 2 to 3 days.

[0079] (9) When the mycelium has grown significantly, it is transferred to a non-resistant seed culture medium and cultured at 30°C for 2 to 3 days. After the mycelium has fully grown, PCR verification is performed to confirm the correctness of the conjugate.

[0080] The verified correct conjugates were cultured on an antibiotic-free SFM solid medium until sufficient spores were produced, and the spores were collected and suspended in 20% glycerol and finally stored in a -80°C refrigerator.

[0081] Example 3 Screening and verification of overexpression strains

[0082] The recombinant plasmid pLQ646-gouA-M, which was successfully constructed and transformed into Ecoli.ET12567 (PUZ8002), was introduced into the wild-type strain of Streptomyces CK-15 by conjugation. Single colonies grown on the antibiotic-coated plates were extracted and cultured on nalidixic acid and apramycin-resistant plates to remove Escherichia coli. An appropriate amount of hyphae was then inoculated into a seed medium containing apramycin. After one generation of culture, PCR verification was performed using 152-Long-F / 152-Long-R (Table 1). PCR products were detected by agarose gel electrophoresis. Figure 3 As shown, the overexpression strain can amplify a band that meets the size of the target fragment, indicating that the overexpression strain gouA-gouM was successfully constructed.

[0083] Example 4 Observation of growth phenotype of overexpression strain

[0084] The wild-type strain CK-15 and the overexpression strain gouA-gouM were cultured on SFM plates for 4 days and then their growth was observed. The results showed that the sporulation rate of all overexpression strains was significantly faster than that of the wild-type strain CK-15 ( Figure 4 ).

[0085] Example 5 Detection of glutathione production in overexpression strain gouA-gouM

[0086] Prepare soybean meal medium (SFM): Weigh 20g of soybean meal and add 800mL of distilled water, mix thoroughly, and sterilize at 121°C for 20 minutes. Filter the supernatant through gauze, then add 20g of mannitol and make up to 1L with distilled water. Mix thoroughly and distribute the mixture into four 500mL Erlenmeyer flasks. Add 4g of agar powder to each flask and sterilize at 121°C for 20 minutes.

[0087] Prepare seed culture medium (g / L): weigh 20 g glucose, 6 g peptone, 6 g yeast powder, and 10 g sodium chloride in 1 L distilled water and adjust the pH to 7.2-7.4.

[0088] Prepare the glutathione fermentation medium (g / L): corn flour: 30g; soybean meal: 20g; glucose: 20g; ammonium sulfate: 4g; calcium carbonate: 3g in 1L of distilled water.

[0089] The overexpression strains gouA-gouM were cultured on SFM plates and spores were collected and stored in glycerol with a final concentration of 20%. Three mutant strains were preserved for each overexpression strain. 600 The OD values ​​of spores from wild-type and overexpressed strains were measured using a microplate reader at 400 nm. All spores were adjusted to the same concentration. The adjusted spores from three mutant strains overexpressing the same gene were mixed, and 50 μL of the mixed spores were evenly spread on a SFM plate. The plate was incubated in a 30°C incubator for 2 days before being inoculated into a seed culture medium and shaken at 30°C and 220 rpm for 24 hours. A 10% inoculum was then transferred to 50 mL of freshly prepared glutathione fermentation medium for fermentation at 30°C and 220 rpm for 72 hours.

[0090] 1 mL of fermentation broth was centrifuged at 4000 rpm for 10 min at 4°C. The supernatant was diluted 10-fold with ddH2O and filtered through a 0.22 μm aqueous filter before LC-MS analysis. The LC-MS instrument used was an Agilent Ultivo triple quadrupole liquid chromatography-mass spectrometry system (LC / TQ) using a Waters Amide column (ACQUITY UPLC BEH Amide Column, 1.7μm, 2.1mmX100mm, 1 / pk), guard column (ACQUITY UPLC BEH Amide Van Guard Pre-column, 1.7 μm, 2.1 mm x 5 mm, 3 / pk). Mobile phase A (aqueous phase) consisted of 5 mM ammonium acetate in water, and mobile phase B consisted of acetonitrile. The flow rate was 0.3 mL / min, the detection time for each sample was 17 min, and the injection volume was 1.00 μL. The timetable is detailed in Table 2, the ACQUITY UPLC BEHAmide Column flushing method is detailed in Table 3, and the MRM conditions are detailed in Table 4.

[0091] Table 2 Timetable

[0092]

[0093] Table 3 ACQUITY UPLC BEH Amide Column flushing method

[0094]

[0095] Table 4 MRM conditions

[0096]

[0097]

[0098] LC-MS was used to detect the production of glutathione in the overexpression strain gouA-gouM. The results showed that the production of glutathione in the overexpression strain gouC was significantly increased by 194.82% compared with the wild-type strain CK-15, and the corresponding glutathione production reached 2.23g / L ( Figure 5 and Figure 6 ).

[0099] Example 6 Mycelial Growth Detection of Overexpression Strain gouC and Wild-Type Strain CK-15

[0100] During the fermentation of glutathione by wild-type strain CK-15 and overexpression strain gouC, the fermentation broth at different fermentation time periods was taken to determine the dry weight of mycelium. The experimental results showed that during the exponential growth period of 0h-12h, the mycelium growth of overexpression strain gouC was better than that of wild-type strain CK-15; both wild-type strain CK-15 and gouC overexpression strain reached the highest biomass at 12h of fermentation; during the period of 12h-120h, that is, when the mycelium growth transitioned from the exponential period to the stable period, the mycelium growth of overexpression strain gouC was still better than that of wild-type strain CK-15 ( Figure 7 Therefore, based on the results, it was speculated that gouC overexpression promoted hyphal growth.

[0101] Example 7 Antibacterial activity detection of fermentation broth of overexpression strain gouC

[0102] The antibacterial activity of the fermentation broth of the wild-type CK-15 strain and the overexpressed strain gouC was determined using the butterfly tube method with red yeast as the indicator bacteria. 30-50 μL of each Streptomyces strain stored in a 20% glycerol tube was spread on a SFM plate and cultured in a biochemical incubator at 30°C for 2 days. 1 cm 2 Place the small square pieces in 30mL seed liquid and culture at 30℃ and 220rpm for 24h. Inoculate 10% of the inoculum into freshly prepared 50mL fermentation medium and culture at 30℃ and 220rpm for 72h. After the culture is completed, take 1mL of fermentation liquid and centrifuge it at 12000rpm for 1min. Use a 1mL syringe to aspirate the supernatant and filter it with a 0.22μm water filter into a sterile 1.5mL EP tube. Add 1mL of red yeast liquid with an OD value of 1.2 to the PDA medium, mix well, and add 20mL of PDA medium containing red yeast to each plate. Use sterile tweezers to place the sterilized Oxford cup on the plate, and aspirate 200μL of the filtered fermentation liquid into the Oxford cup. Set up 4 replicates for each treatment. After incubation at 30℃ for 48h, observe and measure the diameter of the inhibition zone.

[0103] The results showed that glutathione exerted a broad-spectrum antibacterial effect by inhibiting protein synthesis. Red yeast (Rhodotorulaspp. purchased from the Microbial Culture Collection of the Chinese Academy of Sciences) was highly sensitive to protein synthesis inhibitors and could form a clear inhibition zone in the experiment. The size of the inhibition zone was positively correlated with the activity of glutathione, so it was selected as an indicator bacteria to detect the activity of the antibiotic. The antibacterial activity of the overexpression strain gouC and the wild-type strain CK-15 on red yeast was determined, and 5 replicates were set for each treatment. The results showed that the inhibition zone of the gouC overexpression strain on the red yeast indicator bacteria was significantly larger than that of the wild-type strain CK-15. Therefore, the gouC overexpression strain significantly increased the production of the antibacterial active substance glutathione compared with the wild-type strain CK-15 ( Figure 8 ).

[0104] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A mutant strain of Streptomyces parvum gouC, characterized in that The mutant strain gouC of Streptomyces parvum is obtained by overexpressing the gouC gene in Streptomyces parvum. The nucleotide sequence of the gouC gene is shown in SEQ ID NO.

3.

2. A method for preparing the mutant strain gouC of Streptomyces parvum according to claim 1, characterized in that: The method comprises the step of introducing the gouC gene described in claim 1 into Streptomyces parvum CK-15.

3. The method according to claim 2, characterized in that The Streptomyces parvum CK-15 is deposited in the General Microbiology Center of China Culture Collection Administration of Microorganisms with a deposit number of CGMCC No. 31251.

4. Use of the mutant strain gouC of Streptomyces parvum according to claim 1 in the fermentation production of glutathione.

5. A method for producing glutathione by fermentation, characterized in that: The method comprises the following steps: culturing the mutant strain gouC of Streptomyces parviflorus according to claim 1; fermenting the mutant in a culture medium containing corn flour, soybean meal and glucose; Extract and purify to obtain glutathione.

6. The method according to claim 5, characterized in that The fermentation conditions are 30° C., 220 rpm, and 72 hours.

7. A glutathione product, characterized in that: Prepared by the method according to claim 5 or 6.

8. A method for increasing the yield of glutathione, characterized in that: The method comprises the step of overexpressing the gouC gene according to claim 1 in Streptomyces parvum CK-15.

9. The method according to claim 8, characterized in that The Streptomyces parvum CK-15 is deposited in the General Microbiology Center of China Culture Collection Administration of Microorganisms with a deposit number of CGMCC No. 31251.

10. Use of the mutant strain gouC of Streptomyces parvum according to claim 1 or the glutathione product according to claim 7 in the preparation of antifungal, antitumor or antiviral drugs.

Images