Streptomyces microflavus mutant gouC and application thereof

By overexpressing the gouC gene in Streptomyces simulans, constructing mutant strains, and optimizing the fermentation process, the problem of low oryzanol yield was solved, achieving efficient oryzanol production and providing technical support for antifungal and antitumor drugs.

CN120648634BActive Publication Date: 2026-05-29INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-13
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing technologies for the production of oryzanol from Streptomyces albus are characterized by low yields and long fermentation cycles, and lack efficient gene regulation methods, making it difficult to significantly increase yields through genetic engineering.

Method used

A mutant strain of Streptomyces leucocele overexpressing the gouC gene was constructed. The fermentation process was optimized by overexpressing the gouC gene in Streptomyces leucocele CK-15. Fermentation was carried out using a medium containing corn flour, soybean meal, and glucose. Oryzicin was extracted and purified.

Benefits of technology

It significantly increased the fermentation yield of oryzanol to 2.36 g/L, with mycelial growth rate and sporulation rate superior to the wild type, providing an efficient industrial production solution. The purity and activity of the fermentation product were also verified, making it suitable for the development of antifungal and antitumor drugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120648634B_ABST
    Figure CN120648634B_ABST
Patent Text Reader

Abstract

The application discloses a Streptomyces globisporus mutant gouC and an application thereof, and belongs to the technical field of genetic engineering. The Streptomyces globisporus mutant gouC is obtained by overexpressing a gouC gene, and the nucleotide sequence of the gouC gene is shown as SEQ ID NO. 3. The Streptomyces globisporus mutant gouC provided in the application can increase the production of gougerotin to 2.23 g / L. The application also provides an application of the Streptomyces globisporus mutant gouC in fermentation production of gougerotin. In addition, the fermentation product of the Streptomyces globisporus mutant gouC has significant bacteriostatic activity on Rhodotorula, and is suitable for application in the fields of agriculture and medicine.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a mutant strain of Streptomyces simonii called gouC and its applications. Background Technology

[0002] Gougerotin is a broad-spectrum peptide-nucleoside antibiotic that exhibits significant inhibitory effects against fungi, viruses, tumor cells, and mites, making it valuable in both pharmaceutical and agricultural applications. Currently known gougerotin-producing bacteria include *Streptomyces gougerotii*, *Streptomyces toyocaensis* var. *Aspiculamyceticus*, and *Streptomyces nourise* CK-15. The biosynthetic pathway of gougerotin can be divided into a nucleoside moiety and a peptide moiety: the nucleoside moiety is formed by the coupling of cytosine and UDP-glucuronic acid to form a 4-amino-CGA glycoside, while the peptide moiety is formed by the condensation of D-serine and glycine after methylation modification. Studies have shown that the goucC and goudD genes play a crucial role in the synthesis of sarcosine residues in the peptide moiety; the deletion of these genes leads to the interruption of gougerotin synthesis.

[0003] In existing technologies, heterologous expression experiments of *Streptomyces coelicolor* have confirmed the functions of gouC and gouD. However, research on genetic engineering modification of *Streptomyces noursei* (after the 2024 NCBI classification and nomenclature of the strain, *Streptomyces albulus* CK-15 was reclassified as *Streptomyces noursei* strain CK-15) remains limited. Currently, the production of oryzanol mainly relies on fermentation of wild-type strains, which suffers from low yields (usually below 1 g / L) and long fermentation cycles. Furthermore, traditional fermentation processes lack efficient gene regulation methods, making it difficult to achieve significant yield increases. Although some studies have attempted to improve yields by optimizing culture media or fermentation conditions, the effects have been limited, and no overexpression strategies for key genes have been explored.

[0004] Therefore, developing a genetically engineered strain capable of efficiently producing oryzanol and optimizing its metabolic pathway through molecular means is key to overcoming existing technological bottlenecks. Summary of the Invention

[0005] The purpose of this invention is to provide a *Streptomyces oryzae* mutant strain gouC and its applications to solve the problems existing in the prior art. This invention significantly increases the yield of oryzaein by constructing a *Streptomyces oryzae* mutant strain overexpressing the gouC gene, while optimizing the fermentation process, providing a new technical solution for industrial production.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides a Streptomyces leucocephala mutant strain gouC, which is obtained by overexpressing the gouC gene in Streptomyces leucocephala. The nucleotide sequence of the gouC gene is shown in SEQ ID NO.3.

[0008] The present invention also provides a method for preparing the *Streptomyces leucocephala* mutant strain gouC, comprising the step of introducing the gouC gene into *Streptomyces leucocephala* CK-15.

[0009] Furthermore, the Streptomyces CK-15 is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 31251.

[0010] The present invention also provides the application of the *Streptomyces leucocephala* mutant strain gouC in the fermentation production of oryzanol.

[0011] The present invention also provides a method for producing oryzanol by fermentation, comprising the following steps: culturing the *Streptomyces leucocephala* mutant strain gouC; fermenting in a culture medium containing corn flour, soybean meal, and glucose; and extracting and purifying oryzanol.

[0012] Furthermore, the fermentation conditions are 30°C, 220 rpm, and 72 hours.

[0013] The present invention also provides a oryzanol product prepared by the method described above.

[0014] The present invention also provides a method for increasing the yield of glutamine, comprising the step of overexpressing the gouC gene in Streptomyces CK-15.

[0015] Furthermore, the Streptomyces CK-15 is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 31251.

[0016] The present invention also provides the use of the aforementioned Streptomyces leucocele mutant strain gouC or the aforementioned oryzanol product in the preparation of antifungal, antitumor or antiviral drugs.

[0017] The present invention discloses the following technical effects:

[0018] This invention addresses the low yield of oryzanol from wild-type Streptomyces strains by constructing a mutant strain overexpressing the gouC gene. The fermentation yield is increased to 2.36 g / L, with significantly better mycelial growth and sporulation rates than the wild type. The purity of the fermentation product from this mutant strain was verified by LC-MS, and its activity was confirmed by antibacterial experiments with Rhodotorula rubrum. This provides an efficient technical solution for the large-scale production of oryzanol and its antifungal and antitumor applications. This invention also provides the fermentation medium (containing corn flour, soybean meal, and glucose) and the detection method (LC-MS). The gouC mutant strain of Streptomyces rubrum exhibits rapid growth and high sporulation efficiency, and its fermentation product shows strong antibacterial activity against Rhodotorula rubrum, making it widely applicable in the development of antifungal and antitumor drugs. This invention solves the problem of low yield in wild-type strains, providing reliable technical support for the industrial production of oryzanol. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 This is an amplification diagram of the target fragment gouA-gouM, where M: DL5000 marker;

[0021] Figure 2 The image shows the double enzyme digestion diagram of the pLQ646 plasmid; where M1: DL5000 marker; M2: DL15000 marker; 1-5: linearized fragments of pLQ646; 6: negative control pLQ646 plasmid.

[0022] Figure 3 This is an overexpression validation diagram; where M: DL5000 marker; 1-3 are overexpressing strains; 4 is CK-15 strain; A: gouA overexpressing strain; B: gouB overexpressing strain; C: gouC overexpressing strain; D: gouD overexpressing strain; E: gouE overexpressing strain; F: gouF overexpressing strain; G: gouG overexpressing strain; H: gouH overexpressing strain; I: gouI overexpressing strain; J: gouJ overexpressing strain; K: gouK overexpressing strain; L: gouL overexpressing strain; M: gouM overexpressing strain.

[0023] Figure 4 The growth phenotypes of each overexpressing strain;

[0024] Figure 5Statistics on the production of oryzanol by overexpressing strains gouC, gouD and CK-15 (A) and production determination of overexpressing strains gouA-gouM and CK-15 (B);

[0025] Figure 6 For comparison of the yields of different overexpression strains;

[0026] Figure 7 The curves showing the changes in mycelial dry weight of overexpression strains gouC and CK-15 at different time points;

[0027] Figure 8 To determine the antibacterial activity of fermentation broths of overexpressing strains gouC and CK-15 against Rhodotorula rubrum. Detailed Implementation

[0028] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0029] Unless otherwise specified, the experimental methods used in the following examples are conventional experimental methods in the field; and the materials or reagents used can be purchased from conventional channels unless otherwise specified.

[0030] Phanta Max Super-Fidelity DNA Polymerase P505-d2 was purchased from Nanjing Novizan Biotechnology Co., Ltd., and DNAMaker DL5000 and DNAMaker DL15000 were purchased from TaKaRa Corporation of Japan.

[0031] For details on Streptomyces albulus CK-15, please refer to patent CN118995552A. The preservation information for Streptomyces albulus CK-15 is as follows: it was deposited on July 10, 2024 at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 31251. The deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, 100101, China.

[0032] Example 1: Construction of overexpression mutant

[0033] 1. Amplification of the target fragment

[0034] Based on the reported oryzin gene clusters in *Streptomyces graminearum* on NCBI, the target gene gouA-gouM with high similarity was found in the genome of the *Streptomyces graminearum* strain CK-15 (Genebank ID NZ_CP026094.1). The nucleotide sequences of gouA-gouM are shown below:

[0035] The nucleotide sequence of gouA is:

[0036]

[0037] The nucleotide sequence of gouB is as follows:

[0038]

[0039] The nucleotide sequence of gouC is as follows:

[0040]

[0041] The nucleotide sequence of gouD is as follows:

[0042] ATGACCGAGCACGCCCGGCCGCCGGCCACCGAGCACCGCCCCGTCGACGTCAGCGTCATCATCCCCGCCTACAACGCGCGCGCCACGCTGGAGGCGTGCCTGCTGTCGCTGACGCACCAACGACCGCAAGGAAACGGGTCGTTCGAGGTGCTCGTCATCGACGACGGCTCCACGGACGGCACCGGCCCGATGGTCGACTCCTTCGCCTCCCGCCTGGACCTGCGCTACGTCCACGAGCCCCGTACCCCGGCATCGGGACGCGCCCGGGCGCGCAACATCGGACTGGCCCTGGCCACCGGCAGCCTGGTCGTGACGCTCGACGCCGACCAGGTCGTGGGCCCCGACTTCCTGGCGGAGCACGTCCGCGCGCACGGCACCGCCGACGACCTGCTGGTCGTCGGCCGGCGCCACCAACTGGGGGAGGGCACGTTCGACCTGGCGCGCCTGGCCCGCGGGTTCAGCCTCGGGGCGCTGCCGGAGGTGGTGCGCGGCGACGAACGCGAACCGGTCCTCGCGGCGCTGGGCGGCGAGCTGAGCGATCTGCGCACCGCCTGGCACTACCTGTGGACCTGCAACGCCTCGGTGCGGCGCGACCGACTGGCCGCCGTCGGGGGCTTCGACGAGGAGTTCCACGGCTGGGGCCTGGAGGACGCCGAGTTGGGGTACCGGCTCGTTCAGGACGGCGTCCGGATGCGCTACAGCACCCGAGCCGCCGTCTACCACGAGCACCGCTCCCCGGTCTCCGCGTCGATGTACCGCGAATGGCGCGCGAACCTCGCCCACTTCGCCGGCAAGCACCCCGACCCCGTGGTCCGGCTCCAGGAGATGTTCGCGCCCGCCATCGATCCGGCCGCACCGGCGGCGGAGGCGTGGGTGGACACCGCCGTGCGGTTCGAGCACCGCGCCCGGGCACTGGCCGGCGTCCCGCAGCCGGCCCACCACGGGTGA(SEQ ID NO.4);

[0043] The nucleotide sequence of gouE is as follows:

[0044] ATGACCGAACCGACCACGGCACGCACCCGATCCGCCCTCCTCACCACCCTGCACTCGCTCGCCGGCGAGGTTGACGGGGCACGGAAGTGGAGTCAGACCTCCCGGACCATGGCACCGGCGCGCGTCGCCACGGTGTTCGGCTCGGCCCGCACCGAACGGGACGAACCTGCCTACCAGATGGCCAGGGAACTGGGCGCCGCCCTCGCCGCCCGGCGCTGGACGACCGTGACCGGCGGCGGCCCCGGGATCATGCAGGCCGTCCGGGACGGCAGCGGCACCACGCTGTCCCGGGCGGTGCGCATCGAGATCCCCGGCGAAGTGCCCGACACGGTGCTCGACGAGGACCGTTCGCTCACCGTCGGCACCTTCGCGCTGCGCAAGCTGCTCCTCACCCACGACATCGACGCGCTGTTCGTCTTCCCCGGCGGGGTGGGCACGTTCGACGAGCTCTTCGAGGTCCTGGTCCACCACGACACCGACCGGCTCGACCGCTTCCCCGTGGTGCTCGTCCAACCCGAAGGCACCGGCCTGTGGCAGGCGTTCGTGCAGTTCGTCCAAGCACACCTGGTCGACGCCGGGCTCGCCAGTCCCACGGTGGTCAAGGAACTCGTCGTCGCCGAGTCGGTGGAGGCGGCGCTGGCGGCCGTGGGGGCGCACCCACCGGCCACCGTCCCGCAGCCGGGGACCGCCACCGCGCCGGACGCCACCGCAGACCTCGGCACGGAACGGCGGACGGCATGA(SEQ ID NO.5); The nucleotide sequence of gouF is:

[0045]

[0046] The nucleotide sequence of gouG is:

[0047]

[0048] The nucleotide sequence of gouH is:

[0049]

[0050] The nucleotide sequence of gouI is as follows:

[0051] ATGCCTTCGACTGACCCGGTGGTGGACGCCGCGGTCCGGGACCTGCTGGACCGTTGGGGGCAGCCCGCCGCGGCGTTCTGCGCCTCCGGCGGCGCGGCGCTCGAAGCGGCCCTGGAAGTGCTGGAGGTGGGCTCGGGCGCCGAGGTCGTGGTGCCCGACGTCGGCTGCCACTCCGTCGCCGCGGCCGTCGTCCGCGTCGGCGCGGTGCCGGTGTTCGTCGGCGTCGGCGAGGGCTTGACCCTGCACCCGCCGGACGTGGCGGCGGCGTGCTCCGCACGGACCCGCGCGGTCATCGCGGTGCACCAGTACGGGCTGCCGTGCGACGTGCCCGGCATCGTCGCGGCCGTCCCGCGCGGCGTGGCGGTCATCGAGGACGTGGCCCAGACCTGGGGCTCGACGACCCGGGGCGTGCCGGCCGGCTCCACCGGCACGCTCACCGTCACCTCGTTCGGGCCGTCCAAACCGGTGGCATTGGGCGCCGGCGGTGCGCTCCTCGGCCCGGCAGACCTGGTGTCCGGTGCCGTCGCACGGGGCGACACGTCGGACCGGCACCGGCCGCGTCCCCCGTCACCCGCGCGCTTCCCGGCGCCCCTGTACCCCCTGCTCCCGGCCGCCGTCGCCGAGGCGGACCGCCAACTCGCCAGTCGTAGGGCGGCGGTTGAGCGCTTCACCGGCGGTGACTTGGCCAGGCACTTCCGCCTCCCCGGCCTGCTGCCCGGCTCCAGCGCCGGTTGGACCCGCGTGCCGCTCTACCCGGCAAGGTCCGCAACGCCCCGCCACCTCGCGCAGCTGACGGACGCCCTGGGGGCCGCCCAACGGATGCATCCGCGCCCGCCGTCCGCCCTGCCGATGTTCCGGGGCCGGGACACCCGCGTGGTGACCGGCACCCGGCGGCCCGTGGAACCCCTTCTCGTCAAGATTGGACGACCCTCATGA(SEQ ID NO.9);

[0052] The nucleotide sequence of gouJ is:

[0053]

[0054] The nucleotide sequence of gouK is as follows:

[0055] ATGCACACTGACACCGTTTCCCCCGACGAGCTCGACAAGGCCGTCGCCGGCCTGCCCGTGCAGGTGTGGAACGCGCCGACGGCGGCCGAACTCTACGGACAGACCCTCAACCTCGTCTGCCGGACCCGCGGCGGCCGCACGGCGGGCGCCTGGGTGGTCCCCCTGGACGACGACGGAACGGCCGCCCGCCGTCCCTTCCGACTCCTGCCCTACGCCTCACCATGGGTGGACCCGGAACTGCACCCCGTCGACCGCCACCGGGCGGTCCTGTCGATGACCCAGGCACTCATGGACCGGGTGGAGTCGGCGGAGATCCCGATGGACCCGCGCTTCGGAGAGGCGGCCGCCCTGGCCGAAGCGGGGGCCGAACTCCTCTGCCGGCACACCCGCGTCCTGGAACTGCACGCCGACCGCGATCCCCGCACGGGGTACGTGGCCACTGCCCGGAACCACATCAGGGCCGCGGCCCGGGAGCACACCGTGCGGACCGCCCCGCTCGACGCGTTCGACTTCTCCCGCGCGGTCGTCGGCCAACCGGCGGACGCCGTCGCCGCGCGGCGCAGGTCGGGGCTGCGCGTCGGCGGTGTCGAGCCGGCGCTGTGCCTCGCCGCGACGGACCCCGACGGGACCTGCCGGGGCCAGGTGTTCGTCCTGCTCTGCGACGGCGCCGCGGTCCTCATGCACTCGTGGTTCGACCGGGCGGGCGCCCGCGGGGTGCCGAGCCTGCTGGTGGACGAGGCGATCGCGTGGGCGGGCCGGCAGCCCGGCACCGACGTGTTCGACTTCGAGGGCAGCGTGCTGCCCGGCGTCGACCGCTTCATGACCGGATTCGGCGCCCGTGCCTGCGCCTACCCGCAACTGCGGTGGCGCCGCTCGACCGAACCGGGCGCGGGAGCGGGGGAGTTCGGATGA(SEQ ID NO.11);

[0056] The nucleotide sequence of gouL is as follows:

[0057] GTGGCCAACCTTGCCTTGTACGGTCTCGGCGAAATGGGCGCGGACATCGCGCGGTGCCTGGTGTCCCGCGGTGTCGCACTGCACGCGTACGACCCGGTGTCCGACGTGACGTTGGCGGCGGGGAACTTCCACCGCTGCTCGACGGCGGCGGAGGCGGCCCGTGCGGCCGCGGTCCACCTCGTCGTCGTGAAGCGGCCGGACGACGTGCGCGCCCTGCTCTTCGGCGCCGACGGGCTGTGCGCCGCGGCGCCCGCCGGCTCCCACGTGGTGCTGCACACCACCCTCACCCCGCAGACCGTCCGCGAACTGGCCGAGGAGGTGCGGCGGCAGGGGCACGTCCTGCTGGACGCCGCCCTCAGTCGGCGCAACGGTCTGATCCGCGAGGGTTCGCTGTCCCTGTTCGTGGGCGGGACGGCCGAGGAGGTCGCCGCCGTGGGGCCCGTCCTGGACCGCTACGCCGACAACGTGGTCCACGCCGGGCCCACCGGTGCCGGGATGACCGTCAAGCTCTGCAACAACTGGCTCCTCTACAGCAACCGGCACGCCGCGCTCCAGGCGCTCGGCACCGGACGGGCGCTCGGCGTCGACCCCGACGTCCTGCGCGGCGCACTGGCCTCGTCGACCGGTTCCAGTTGGGCACTCGCGCACTACTCGGACCTCGACGAGGCGATCGTCACCGGCCAGGGCGCCCCGGCCGTGGTGCGCGACCGGACCACGTCCGAACTGCGGATGGCCCGGGACATGGCCGCCACCAACGGCCAGGTGCCCACCAGCCTCCAGGAGACCTTCGCGCTGCTCGACGCGATGTGA(SEQ ID NO.12);

[0058] The nucleotide sequence of gouM is as follows:

[0059]

[0060] 2. The sequences of primers used to amplify the target sequence gouA-gouM are shown in Table 1. Primer design was performed using the Primer3Plus-Pick Primers website.

[0061] Table 1 Primer sequences

[0062]

[0063]

[0064]

[0065] PCR reaction system: ddH2O 13μL; 2*Phanta MAX Buffer 25μL; dNTPmix 1μL; upstream primer 2μL; downstream primer 2μL; Phanta Max Super-Fidelity DNA Polymerase P505-d 21μL; DNA 1μL; 50% DMSO 5μL. PCR reaction conditions: Pre-denaturation: 95℃ 10min; Denaturation: 95℃ 30sec 31 cycles; Annealing: 65℃ 30sec 31 cycles; Extension: 72℃ 30-60sec / kb: 31 cycles; Complete extension: 72℃ 10min.

[0066] The PCR products were detected by electrophoresis on a 1% agarose gel. The electrophoresis results were consistent with the size of the target fragment. The synthetic genes gouA-gouM (nucleotide sequences shown in SEQ ID NO.1-SEQ ID NO.13) within the glutathione gene cluster were amplified by PCR. The PCR products were detected by electrophoresis on a 1% agarose gel. The electrophoresis results were consistent with the size of the target fragment. The sizes of the target fragments were as follows: gouA: 1041bp; gouB: 1788bp; gouC: 1302bp; gouD: 948bp; gouE: 741bp; gouF: 1194bp; gouG: 1167bp; gouH: 1161bp; gouI: 936bp; gouJ: 1119bp; gouK: 912bp; gouL: 810bp; gouM: 1503bp. Figure 1 )

[0067] The gouA-M gene fragment (SEQ ID NO.1-SEQ ID NO.13) was cloned according to the designed primers (Table 1). The plasmid pLQ646 was double-digested using Fast Digest EcoRI (FD0274) and Fast Digest NdeI (FD0584) enzymes from Thermo Scientific. After digestion, the digested fragments were recovered from the gel after gel chromatography to confirm the results. The linearized fragments after double digestion (…) Figure 2 (1-6) were analyzed by agarose gel electrophoresis, and the results are as follows: Figure 2 As shown, the fragment size is consistent with expectations. The double digestion system consisted of 1 μg DNA; 2 μL 10x Fast Digest Green Buffer; 1 μL Fast Digest EcoRI (FD0274); 1 μL Fast Digest NdeI (FD0584); and 20 μL Nuclease-free water. Reaction conditions: 37℃, 40 min.

[0068] The pLQ646 plasmid, disclosed in the literature "Elucidation of genes enhancing natural product biosynthesis through co-evolution analysis" (DOI:10.1038 / s42255-024-01024-9), was used to construct an overexpression vector. The amplified product of the gouA-M fragment and the double-digested pLQ646 plasmid were assembled together using a one-step isothermal Gibson Assembly method. After successful fragment sequencing, the overexpression recombinant plasmid was obtained and named pLQ646-gouA-M (where gouA-M represents gouA-gouM). The overexpression recombinant plasmid pLQ646-gouA-M was transformed into Ecoli. DH5α competent cells using chemical transformation. After single-colony PCR verification confirmed a positive result, the cells were sent to a company for sequencing. The sequencing results from the company were compared with the target gene sequence, and the results were consistent, indicating successful construction of the gouA-M gene overexpression recombinant plasmid.

[0069] The recombinant plasmid successfully constructed and transformed into Ecoli. DH5α was extracted and chemically transformed into Ecoli. ET12567 (PUZ8002) competent cells. Three to four transformed clones were selected for colony or culture PCR verification to confirm positive results. The PCR products were then sent to Sangon Biotech for sequencing. The sequencing results were compared with the constructed vector sequence; the results were consistent, further confirming the successful construction and transformation of the overexpression vector into Ecoli. ET12567 (PUZ8002). Figure 3 ).

[0070] Example 2: Conjugation transfer of overexpression strain with CK-15 wild-type strain

[0071] (1) On the afternoon of the day before conjugation transfer, ET12567 cells carrying the target plasmid (the target plasmid is the gouA-M gene overexpression recombinant plasmid pLQ646-gouA-M) were inoculated into LB medium and cultured at 37°C to obtain ETZ bacterial culture. When the OD of the bacterial culture... 600 Once the viscosity reaches 0.4-0.6, the binding transfer experiment can begin.

[0072] (2) Spread the spores of wild-type CK-15 strain evenly on SFM solid medium and incubate at 30℃ for 3 to 5 days until the surface of the medium is covered with gray-black spores. Then, collect the spores with a cotton swab and suspend them in TES solution for direct conjugation transfer; or dissolve them in 20% glycerol after collection and store them at -80℃ for long-term use.

[0073] (3) Add 1 mL of LB medium to each EP tube, mix thoroughly, and centrifuge at 12000 rpm for 1 minute to collect ETZ cells. Repeat this step 3 times. Finally, resuspend the cells in 100 μL of medium (equivalent to 10 times concentration) to ensure that the cells are mixed evenly and ready for use.

[0074] (4) Take an appropriate amount of spores and add them to 1 m LTES solution. Mix well and centrifuge at 12000 rpm for 1 minute. Repeat this operation twice, then mix with 1 m LTES and centrifuge for 1 minute. After washing twice, resuspend the spores in 500 μL LTES and mix well.

[0075] (5) Heat the resuspended Streptomyces spores in a 50°C water bath for 10 minutes, then add 2 times the concentration of spore pre-germination solution and 20 μL of 0.5M calcium chloride, and mix thoroughly.

[0076] (6) Heat-shocked CK-15 wild-type strain spores and Escherichia coli ET12567 cells were mixed evenly at a ratio of 10:1 and coated onto a substrate containing 10 mM Mg 2+Plates were placed on SFM solid medium. After being allowed to air dry naturally in a clean bench, the plates were incubated at 30°C for 16 hours.

[0077] (7) After culturing for 16 hours, evenly cover each plate with 1.5 mL of the mixture (40 μL Apramycin and 40 μL Nalidixic acid added to ddH2O). After the liquid is dried, continue to incubate the plates in a 30°C incubator for 3 to 5 days until conjugate formation is observed.

[0078] (8) After picking the conjugates, streak them on SFM solid medium containing 0.1% apramycin and 0.1% nalidixic acid and incubate for 2 to 3 days.

[0079] (9) When the mycelium grows significantly, transfer it to a non-resistant seed culture medium and culture it at 30°C for 2 to 3 days. After the mycelium has grown sufficiently, perform PCR verification to confirm the correctness of the conjugate.

[0080] After the correctly verified conjugates were cultured on antibiotic-free SFM solid medium until full sporulation, the spores were collected, suspended in 20% glycerol, and finally stored in a -80°C freezer.

[0081] Example 3: Screening and Validation of Overexpression Strains

[0082] The recombinant plasmid pLQ646-gouA-M, successfully constructed and transformed into Ecoli. ET12567 (PUZ8002), was introduced into the wild-type Streptomyces CK-15 strain via conjugation transfer. Single colonies grown on antibiotic-coated plates were extracted and cultured on antibiotic-resistant plates containing nadolpicolone acetonide and apramycin to remove Escherichia coli. Then, a suitable amount of mycelium was inoculated into seed culture medium containing apramycin and cultured for one generation. PCR verification was performed using 152-Long-F / 152-Long-R (Table 1). PCR products were detected by agarose gel electrophoresis. Figure 3 As shown, the overexpression strain can amplify bands that match the size of the target fragment, indicating that the overexpression strain gouA-gouM has been successfully constructed.

[0083] Example 4: Observation of the growth phenotype of the overexpression strain

[0084] Wild-type strain CK-15 and overexpression strain gouA-gouM were cultured on SFM plates for 4 days, and their growth was observed. The results showed that all overexpression strains exhibited significantly faster sporulation rates compared to the wild-type strain CK-15. Figure 4 ).

[0085] Example 5: Detection of glutenin production by overexpression strain gouA-gouM

[0086] Preparation of Soybean Meal Fluorescent Medium (SFM): Weigh 20g of soybean meal, add to 800mL of distilled water and mix well. Sterilize at 121℃ for 20min. Collect the supernatant and filter it through gauze. Add 20g of mannitol to the supernatant, and then add distilled water to bring the volume to 1L. Mix well and dispense into four 500mL Erlenmeyer flasks. Add 4g of agar powder to each flask and sterilize at 121℃ for 20min.

[0087] Prepare seed culture medium (g / L): Weigh 20g of glucose, 6g of peptone, 6g of yeast powder, and 10g of sodium chloride into 1L of distilled water, and adjust the pH to 7.2-7.4.

[0088] Prepare oryzanol fermentation medium (g / L): corn flour: 30g; soybean meal: 20g; glucose: 20g; ammonium sulfate: 4g; calcium carbonate: 3g in 1L of distilled water.

[0089] Overexpression strains gouA-gouM were cultured on SFM plates, and after spore harvesting, they were stored in glycerol at a final concentration of 20%. Three mutant strains were stored for each overexpression strain. 600 The OD values ​​of spores from wild-type and overexpressing strains were detected using a microplate reader at a specific wavelength. The spore solutions of all strains were adjusted to the same concentration. 50 μL of the adjusted spore solutions from three mutant strains of the same overexpressing gene were mixed and spread evenly on SFM plates. After incubation at 30°C for 2 days, the mixture was inoculated into seed culture medium and cultured on a shaker at 30°C and 220 rpm for 24 hours. A 10% inoculum was then transferred to 50 mL of freshly prepared oryzanol fermentation medium for fermentation at 30°C, 220 rpm, and for 72 hours.

[0090] Take 1 mL of fermentation broth, centrifuge at 4000 rpm for 10 min at 4℃, dilute the supernatant 10-fold with ddH2O, filter through a 0.22 μm aqueous filter membrane, and perform LC-MS analysis. The instrument used for LC-MS is an Agilent Ultivo triple quadrupole LC / TQ system, using a Waters Amide column (ACQUITY UPLC BEH Amide Column). 1.7μm, 2.1mm x 100mm, 1 / pk), protective column (ACQUITY UPLC BEH Amide Van Guard Pre-column, (1.7 μm, 2.1 mm x 5 mm, 3 / pk). Mobile phase A (aqueous phase) was 5 mM ammonium acetate solution, and mobile phase B was acetonitrile. The flow rate was 0.3 mL / min, the detection time for each sample was 17 min, and the injection volume was 1.00 μL. See Table 2 for the time schedule, Table 3 for the ACQUITY UPLCBEHAmide Column rinsing method, and Table 4 for the MRM conditions.

[0091] Table 2 Timetable

[0092]

[0093] Table 3 ACQUITYUPLC BEH Amide Column Flushing Method

[0094]

[0095] Table 4 MRM Conditions

[0096]

[0097]

[0098] The yield of oryzanol by the overexpression strain gouA-gouM was detected by LC-MS. The results showed that the overexpression strain gouC significantly increased the yield by 194.82% compared with the wild-type strain CK-15, with a corresponding oryzanol yield of 2.23 g / L. Figure 5 and Figure 6 ).

[0099] Example 6: Mycelial growth detection of overexpression strain gouC and wild-type strain CK-15

[0100] During the fermentation of oryzanol by wild-type strain CK-15 and overexpression strain gouC, the mycelial dry weight was measured at different fermentation time points. The results showed that during the exponential growth phase (0-12h), the mycelial growth of overexpression strain gouC was better than that of wild-type strain CK-15. Both wild-type strain CK-15 and overexpression strain gouC reached their maximum biomass at 12h. During the period from 12h to 120h, when cell growth transitioned from the exponential phase to the stationary phase, the mycelial growth of overexpression strain gouC remained better than that of wild-type strain CK-15. Figure 7 Therefore, based on the results, it is inferred that overexpression of gouC promoted mycelial growth.

[0101] Example 7: Detection of antibacterial activity of overexpression strain gouC fermentation broth

[0102] The antibacterial activity of the fermentation broths of wild-type CK-15 strain and overexpression strain gouC was determined using the tube-butterfly method with Rhodotorula glutinis as an indicator. 30-50 μL of Streptomyces strains preserved in 20% glycerol tubes were spread onto SFM plates and incubated at 30℃ for 2 days. A 1 cm section was then cut off... 2 Small square pieces were placed in 30 mL of seed culture and cultured at 30 °C and 220 rpm for 24 h. 10% of the inoculum was then inoculated into 50 mL of freshly prepared fermentation medium and cultured at 30 °C and 220 rpm for 72 h. After culturing, 1 mL of fermentation broth was centrifuged at 12000 rpm for 1 min, and the supernatant was aspirated with a 1 mL syringe and filtered through a 0.22 μm aqueous filter membrane into a sterile 1.5 mL EP tube. 1 mL of red yeast culture with an OD value of 1.2 was added to PDA medium, mixed well, and 20 mL of PDA medium containing red yeast was added to each plate. Sterile Oxford cups were placed on the plates using sterile forceps, and 200 μL of the filtered fermentation broth was aspirated into each Oxford cup. Each treatment was repeated in four replicates. After culturing at 30 °C for 48 h, the diameter of the inhibition zone was observed and measured.

[0103] The results showed that oryzanol exerted a broad-spectrum antibacterial effect by inhibiting protein synthesis. Rhodotorula spp. (purchased from the Microbial Culture Collection Center of the Chinese Academy of Sciences) was selected as an indicator strain for detecting the activity of this antibiotic because it is highly sensitive to protein synthesis inhibitors and forms clear inhibition zones in the experiment, with the size of the inhibition zones positively correlated with oryzanol activity. The antibacterial activity of the overexpressing strain gouC and the wild-type strain CK-15 against Rhodotorula spp. was measured, with five replicates for each treatment. The results showed that the inhibition zone of the gouC overexpressing strain against the Rhodotorula spp. indicator strain was significantly larger than that of the wild-type strain CK-15. Therefore, the gouC overexpressing strain significantly increased the production of the antibacterial active substance oryzanol compared to the wild-type strain CK-15. Figure 8 ).

[0104] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. Application of the Streptomyces leucocele mutant strain gouC in the fermentation production of oryzanol, wherein the Streptomyces leucocele mutant strain gouC is obtained by overexpressing the gouC gene in Streptomyces leucocele CK-15, and the nucleotide sequence of the gouC gene is shown in SEQ ID NO. 3; The Streptomyces CK-15 strain is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 31251.

2. A method for producing oryzanol by fermentation, characterized in that, The method includes the following steps: culturing the *Streptomyces leucocephala* mutant strain gouC as described in claim 1; fermenting it in a culture medium containing corn flour, soybean meal, and glucose; and extracting and purifying oryzanol.

3. The method according to claim 2, characterized in that, The fermentation conditions were 30°C, 220 rpm, and 72 hours.

4. A method for increasing the yield of oryzanol, characterized in that, This includes steps for overexpressing the gouC gene in Streptomyces CK-15; The nucleotide sequence of the gouC gene is shown in SEQ ID NO.3; The Streptomyces CK-15 strain is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 31251.

5. The use of the *Streptomyces leucocephala* mutant strain gouC as described in claim 1 in the preparation of an antifungal drug, characterized in that... The fungus is red yeast.

Citation Information

Patent Citations

  • Protein system associated with biosynthesis of gougerotin, and encoding gene cluster and application thereof

    CN103183729A

  • Method for obtaining wuyiencin high-producing strain

    CN108707575A