T7-293T cell and application thereof in bovine parainfluenza virus type 3 infectious clone rescue virus

Abstract

The invention relates to the technical field of genetic engineering, in particular to a T7-293T cell and application thereof in bovine parainfluenza virus type 3 infectious clone rescue virus. The preservation number of the T7-293T cell provided by the invention is CGMCC (China General Microbiological Culture Collection Center) No.46335. The T7-293T cell provided by the invention is a strain of 293T cell capable of stably expressing T7 RNA polymerase, and has the advantages of high transfection efficiency and cheap transfection reagent. Furthermore, a method for rescuing the virus through bovine parainfluenza virus type 3 infectious clone is established on the basis of T7-293T cells, NP, P and L genes of the bovine parainfluenza virus type 3 are constructed into the same helper plasmid, the helper plasmid and the virus full-length gene plasmid co-transfect the T7-293T cells, the low efficiency caused by simultaneous transfection of four plasmids is avoided, and the virus type 3 infectious clone virus rescuing method has the advantages that the virus type 3 infectious clone virus rescuing method is simple and convenient to implement, and the virus type 3 infectious clone virus rescuing method is suitable for large-scale popularization and application. Therefore, the success rate of virus rescue by the bovine parainfluenza virus type 3 infectious clone is further improved.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, in particular to a T7-293T cell and its application in rescuing bovine parainfluenza virus type 3 infectious clones. Background Art

[0002] Bovine parainfluenza virus type 3 (BPIV3) is a major cause of respiratory disease in cattle. It can cause fever, coughing, runny nose, and decreased appetite, leading to reduced productivity. It often co-infects with bovine respiratory syncytial virus, bovine viral diarrhea, infectious bovine rhinotracheitis, and Pasteurella multocida, causing bovine respiratory syndrome (BRS). Currently, there is no effective treatment for BPIV3, and prevention and control relies primarily on vaccines. While no vaccine is commercially available in China, traditional inactivated and live attenuated BPIV vaccines are available internationally, but these vaccines have limitations in terms of efficacy and safety. To control BPIV3 infection, the development of new, safe, and effective vaccines is crucial.

[0003] The creation of a full-length infectious clone of a virus involves constructing an infectious clone plasmid in vitro using the viral genetic material, and then rescuing the live virus in cells or susceptible hosts. This technique is crucial for studying viral biological properties and developing vaccines. Therefore, the full-length infectious clone of BPIV3 provides crucial technical support for studying the biological properties of BPIV3 and developing related biological products.

[0004] BSR T7 / 5 cells are BHK-21 cells stably expressing T7 RNA polymerase, derived through lentiviral infection. Currently, these cells are often used to rescue infectious clones of bovine parainfluenza virus type 3. BSR T7 / 5 cells are not available in Chinese cell banks or the American Type Culture Collection (ATCC), making them difficult for researchers to access.

[0005] Currently, the rescue of bovine parainfluenza virus type 3 infectious clones requires the construction of four plasmids containing NP, P, L, and the full-length viral genes. These plasmids are then co-transfected into BSR T7 / 5 cells. After 24 hours, the supernatant is inoculated into MDBK cells and cultured until cytopathic effects develop. Only when the four different plasmids are successfully transfected into a single cell will replicable viral particles be produced. However, the low transfection efficiency of BSR T7 / 5 cells makes this even less likely, which is a key reason why rescue of bovine parainfluenza virus type 3 infectious clones often fails. Summary of the Invention

[0006] To address the above problems, the present invention provides a T7-293T cell strain and its use in rescuing viruses from an infectious clone of bovine parainfluenza virus type 3. The T7-293T cell strain provided by the present invention is a 293T cell strain that stably expresses T7 RNA polymerase and can be used to rescue viruses from an infectious clone of bovine parainfluenza virus type 3. It has the advantages of high transfection efficiency and inexpensive transfection reagents, which can improve the success rate of virus rescue.

[0007] In order to achieve the above object, the present invention provides the following technical solutions: The present invention provides a T7-293T cell expressing T7 RNA polymerase, with the deposit number being CGMCC No. 46335.

[0008] The present invention provides the use of the T7-293T cells described in the above technical solution in preparing a bovine parainfluenza virus type 3 infectious clone rescued virus product.

[0009] The present invention provides a kit for rescuing bovine parainfluenza virus type 3 infectious clone virus, comprising the T7-293T cells, BPIV3-p15A plasmid and helper plasmid pIRES2-NPL described in the above technical solution; The BPIV3-p15A plasmid includes a LacZ-p15A vector and a full-length gene sequence of bovine parainfluenza virus type 3 cloned into the LacZ-p15A vector; the nucleotide sequence of the LacZ-p15A vector is shown in SEQ ID NO.8; The auxiliary plasmid pIRES2-NPL includes a pIRES2-EGFP vector and a homologous recombination gene segment; the gene segment includes a nucleoprotein gene sequence of bovine parainfluenza virus type 3, a phosphoprotein gene sequence of bovine parainfluenza virus type 3, an antibiotic resistance gene and a large polymerase protein gene sequence of bovine parainfluenza virus type 3.

[0010] Preferably, the method for constructing the BPIV3-p15A plasmid comprises: The full-length gene sequence of bovine parainfluenza virus type 3 was divided into four segments for amplification, and the amplified target segments were cloned into the LacZ-p15A vector to obtain the BPIV3-p15A plasmid; the nucleotide sequences of the four pairs of primers used in the amplification were shown as follows: SEQ ID NO.9 and SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12, SEQ ID NO.13 and SEQ ID NO.14, and SEQ ID NO.15 and SEQ ID NO.16, respectively.

[0011] Preferably, the amplification is RT-PCR amplification; the template for the RT-PCR amplification is the RNA of the BPIV3-B1 virus strain; the preservation number of the BPIV3-B1 virus strain is CGMCC No.46410.

[0012] Preferably, the antibiotic resistance gene is an ampicillin (AmpR) resistance gene.

[0013] Preferably, the construction method of the helper plasmid pIRES2-NPL includes: Using the pIRES2-EGFP vector as a template, amplification was performed using primers with nucleotide sequences as shown in SEQ ID NO.17 and SEQ ID NO.18 to obtain a linearized pIRES2-EGFP vector; using a vector containing the full-length gene sequence of bovine parainfluenza virus type 3 as a template, amplification was performed using primers with nucleotide sequences as shown in SEQ ID NO.19 and SEQ ID NO.20 to obtain an NP gene; and homologous recombination was performed between the linearized pIRES2-EGFP vector and the NP gene to obtain a pIRES-NP vector; Using the pIRES-NP vector as a template, amplification is performed using primers with nucleotide sequences as shown in SEQ ID NO.21 and SEQ ID NO.22 to obtain a linearized pIRES-NP vector; using a vector containing the full-length gene sequence of bovine parainfluenza virus type 3 as a template, amplification is performed using primers with nucleotide sequences as shown in SEQ ID NO.23 and SEQ ID NO.24 to obtain a P gene; and homologous recombination is performed between the linearized pIRES-NP vector and the P gene to obtain a pIRES-NP-P vector; Using the pIRES-NP-P vector as a template, amplification was performed using primers with nucleotide sequences as shown in SEQ ID NO.25 and SEQ ID NO.26 to obtain a linearized pIRES-NP-P vector; using a vector containing the AmpR resistance gene as a template, amplification was performed using primers with nucleotide sequences as shown in SEQ ID NO.27 and SEQ ID NO.28 to obtain the AmpR resistance gene; homologous recombination was performed between the linearized pIRES-NP-P vector and the AmpR resistance gene to obtain a pIRESA-NP-P vector; The pIRESA-NP-P vector was used as a template and primers with nucleotide sequences as shown in SEQ ID NO.29 and SEQ ID NO.30 were used for amplification to obtain a linearized pIRESA-NP-P vector. A vector containing the full-length gene sequence of bovine parainfluenza virus type 3 was used as a template and primers with nucleotide sequences as shown in SEQ ID NO.31 and SEQ ID NO.32 were used for amplification to obtain the L gene. The linearized pIRESA-NP-P vector and the P gene were homologously recombined to obtain the helper plasmid pIRES2-NPL.

[0014] Preferably, the vector containing the full-length gene sequence of bovine parainfluenza virus type 3 is a LacZ-p15A vector; and the vector containing the AmpR resistance gene is a LacZ-p15A vector.

[0015] The present invention provides a method for preparing a bovine parainfluenza virus type 3 infectious clone rescue virus, comprising: The BPIV3-p15A plasmid and the auxiliary plasmid pIRES2-NPL are co-transfected into T7-293T cells to obtain the bovine parainfluenza virus type 3 infectious clone rescue virus; the T7-293T cells are the T7-293T cells described in the above technical solution or the T7-293T cells in the kit described in the above technical solution; the BPIV3-p15A plasmid and the auxiliary plasmid pIRES2-NPL are the BPIV3-p15A plasmid and the auxiliary plasmid pIRES2-NPL in the kit described in the above technical solution.

[0016] Preferably, the mass ratio of the BPIV3-p15A plasmid to the helper plasmid pIRES2-NPL is 1:1.

[0017] Beneficial effects: The present invention provides a T7-293T cell strain expressing T7 RNA polymerase, with a deposit number of CGMCC No. 46335. The T7-293T cell strain provided by the present invention is a 293T cell strain stably expressing T7 RNA polymerase. It can be used to rescue bovine parainfluenza virus type 3 infectious clones. Furthermore, compared to virus rescue using BSR T7 / 5 cells (using a liposome transfection reagent), the T7-293T cell strain can achieve a transfection efficiency of over 90% using inexpensive linearized polyethyleneimine (PEI) transfection. These cells have the advantages of high transfection efficiency and low transfection reagent costs, thereby improving the success rate of virus rescue.

[0018] Furthermore, the present invention establishes a method for rescuing bovine parainfluenza virus type 3 infectious clones based on T7-293T cells. The NP, P, and L genes of bovine parainfluenza virus type 3 are constructed into the same helper plasmid and co-transfected with the full-length viral gene plasmid into T7-293T cells, avoiding the inefficiency of simultaneous transfection of four plasmids, thereby further improving the success rate of rescuing bovine parainfluenza virus type 3 infectious clones (cytopathic effect appears on the 5th day after transfection). BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments are briefly introduced below.

[0020] Figure 1 is the electrophoresis diagram of the T7 RNA polymerase sequence; Figure 2 is the plasmid map of the LacZ-p15A vector; Figure 3 This is the electrophoresis diagram of the amplified product of the gene segment of bovine parainfluenza virus type 3; Figure 4 Cytopathic effect diagram of rescued bovine parainfluenza virus type 3.

[0021] Biological Deposit Description T7-293T cells, classified and named as 293T cell line stably expressing T7 RNA polymerase, were deposited in the General Microbiology Center of China Culture Collection of Microorganisms on March 26, 2025. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with the deposit number CGMCC No. 46335.

[0022] The BPIV3-B1 strain, classified and named bovine parainfluenza virus type 3, was deposited at the General Microbiology Center of the China Culture Collection Administration on March 26, 2025. The deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 46410. DETAILED DESCRIPTION

[0023] The present invention provides a T7-293T cell expressing T7 RNA polymerase, with the deposit number being CGMCC No. 46335.

[0024] The T7-293T cells provided by the present invention are a cell line constructed based on 293T cells that stably expresses T7 RNA polymerase. They can not only be used to rescue the infectious clone of bovine parainfluenza virus type 3, but also, compared with the use of BSR T7 / 5 cells (using liposome transfection reagent) to rescue the virus, can achieve a transfection efficiency of over 90% by transfection with low-cost linearized polyethyleneimine (PEI). These cells have the advantages of high transfection efficiency and low cost of transfection reagents, which can improve the success rate of virus rescue.

[0025] The present invention provides the use of the T7-293T cells described in the above technical solution in preparing a bovine parainfluenza virus type 3 infectious clone rescued virus product.

[0026] The present invention provides a kit for rescuing bovine parainfluenza virus type 3 infectious clone virus, comprising the T7-293T cells, BPIV3-p15A plasmid and helper plasmid pIRES2-NPL described in the above technical solution; The BPIV3-p15A plasmid includes a LacZ-p15A vector and a full-length gene sequence of bovine parainfluenza virus type 3 cloned into the LacZ-p15A vector; the nucleotide sequence of the LacZ-p15A vector is shown in SEQ ID NO.8; The auxiliary plasmid pIRES2-NPL includes a pIRES2-EGFP vector and a homologous recombination gene segment; the gene segment includes a nucleoprotein gene sequence of bovine parainfluenza virus type 3, a phosphoprotein gene sequence of bovine parainfluenza virus type 3, an antibiotic resistance gene and a large polymerase protein gene sequence of bovine parainfluenza virus type 3.

[0027] The LacZ-p15A vector provided by the present invention contains, in order, a β-galactosidase (LacZα) coding sequence, a hammerhead ribozyme (HamRz) coding sequence, a T7 promoter, a p15A replicon, an AmpR resistance gene, a T7 terminator, and a hepatitis D virus ribozyme (HdvRz) coding sequence. The β-galactosidase (LacZα) is used for blue-white spot screening, improving the efficiency of screening for constructing full-length BPIV3 gene fragment clones. The hammerhead ribozyme (HamRz) core sequence is 58 nt and contains a self-cleavage modification site at the C end of its 3' terminus. The hepatitis D virus ribozyme (HdvRz) core sequence is 88 nt and contains a self-cleavage modification site at the G end of its 5' terminus. HamRz and HdvRz are introduced at either end of the BPIV3 viral genome, respectively. Ribozyme activity achieves precise cleavage of the genomic RNA termini, thereby improving the efficiency of recombinant virus rescue. The T7 promoter is a highly efficient and specific prokaryotic promoter that enables gene transcription by specifically binding to the T7 RNA polymerase. The p15A replicon is a low-copy replicon that can accommodate large gene insertions (>10 kb). The AmpR resistance gene is used for clone selection. The T7 terminator uses specific sequences (such as a hairpin structure and a U-rich sequence) to signal the T7 RNA polymerase to terminate RNA synthesis and prevent read-through.

[0028] The present invention constructs the NP, P, and L genes of bovine parainfluenza virus type 3 into the same helper plasmid (helper plasmid pIRES2-NPL), and co-transfects them with the full-length viral gene plasmid (BPIV3-p15A plasmid) into T7-293T cells, avoiding the inefficiency of simultaneous transfection of four plasmids, thereby further improving the success rate of virus rescue (cytopathic effect appears on the 5th day after transfection).

[0029] As an embodiment, the method for constructing the BPIV3-p15A plasmid comprises: The full-length gene sequence of bovine parainfluenza virus type 3 was divided into four segments for amplification, and the amplified target segments were cloned into the LacZ-p15A vector to obtain the BPIV3-p15A plasmid; the nucleotide sequences of the four pairs of primers used in the amplification were shown as follows: SEQ ID NO.9 and SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12, SEQ ID NO.13 and SEQ ID NO.14, and SEQ ID NO.15 and SEQ ID NO.16, respectively.

[0030] As an embodiment, the amplification is RT-PCR amplification; the template of the RT-PCR amplification is the RNA of the BPIV3-B1 virus strain; the preservation number of the BPIV3-B1 virus strain is CGMCC No.46410.

[0031] As an embodiment, the antibiotic resistance gene is an AmpR resistance gene.

[0032] As an embodiment, the method for constructing the helper plasmid pIRES2-NPL includes: Using the pIRES2-EGFP vector as a template, amplification was performed using primers with nucleotide sequences as shown in SEQ ID NO.17 and SEQ ID NO.18 to obtain a linearized pIRES2-EGFP vector; using a vector containing the full-length gene sequence of bovine parainfluenza virus type 3 as a template, amplification was performed using primers with nucleotide sequences as shown in SEQ ID NO.19 and SEQ ID NO.20 to obtain an NP gene; and homologous recombination was performed between the linearized pIRES2-EGFP vector and the NP gene to obtain a pIRES-NP vector; Using the pIRES-NP vector as a template, amplification is performed using primers with nucleotide sequences as shown in SEQ ID NO.21 and SEQ ID NO.22 to obtain a linearized pIRES-NP vector; using a vector containing the full-length gene sequence of bovine parainfluenza virus type 3 as a template, amplification is performed using primers with nucleotide sequences as shown in SEQ ID NO.23 and SEQ ID NO.24 to obtain a P gene; and homologous recombination is performed between the linearized pIRES-NP vector and the P gene to obtain a pIRES-NP-P vector; Using the pIRES-NP-P vector as a template, amplification was performed using primers with nucleotide sequences as shown in SEQ ID NO.25 and SEQ ID NO.26 to obtain a linearized pIRES-NP-P vector; using a vector containing the AmpR resistance gene as a template, amplification was performed using primers with nucleotide sequences as shown in SEQ ID NO.27 and SEQ ID NO.28 to obtain the AmpR resistance gene; homologous recombination was performed between the linearized pIRES-NP-P vector and the AmpR resistance gene to obtain a pIRESA-NP-P vector; The pIRESA-NP-P vector was used as a template and primers with nucleotide sequences as shown in SEQ ID NO.29 and SEQ ID NO.30 were used for amplification to obtain a linearized pIRESA-NP-P vector. A vector containing the full-length gene sequence of bovine parainfluenza virus type 3 was used as a template and primers with nucleotide sequences as shown in SEQ ID NO.31 and SEQ ID NO.32 were used for amplification to obtain the L gene. The linearized pIRESA-NP-P vector and the P gene were homologously recombined to obtain the helper plasmid pIRES2-NPL.

[0033] As an embodiment, the vector containing the full-length gene sequence of bovine parainfluenza virus type 3 is a LacZ-p15A vector; the vector containing the AmpR resistance gene is a LacZ-p15A vector.

[0034] The present invention provides a method for preparing a bovine parainfluenza virus type 3 infectious clone rescue virus, comprising: The BPIV3-p15A plasmid and the auxiliary plasmid pIRES2-NPL are co-transfected into T7-293T cells to obtain the bovine parainfluenza virus type 3 infectious clone rescue virus; the T7-293T cells are the T7-293T cells described in the above technical solution or the T7-293T cells in the kit described in the above technical solution; the BPIV3-p15A plasmid and the auxiliary plasmid pIRES2-NPL are the BPIV3-p15A plasmid and the auxiliary plasmid pIRES2-NPL in the kit described in the above technical solution.

[0035] As an embodiment, the mass ratio of the BPIV3-p15A plasmid and the helper plasmid pIRES2-NPL is 1:1.

[0036] The rescue method provided by the present invention constructs the NP, P and L genes of bovine parainfluenza virus type 3 into the same helper plasmid, and co-transfects T7-293T cells with the full-length viral gene plasmid, thereby avoiding the inefficiency of simultaneous transfection of four plasmids, thereby further improving the success rate of virus rescue from bovine parainfluenza virus type 3 infectious clones (cytopathic effect appears on the 5th day after transfection).

[0037] To further illustrate the present invention, a T7-293T cell strain provided by the present invention and its use in rescuing bovine parainfluenza virus type 3 infectious clones are described in detail below with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0038] Example 1 Construction of T7-293T stable cell line 1. Construction of T7 RNA polymerase gene expression vector With reference to the complete genome sequence of Escherichia coli BL21 (DE3) (AM946981.2), homology arm primers (SEQ ID NO.1 and SEQ ID NO.2) were designed. Genomic DNA of E. coli BL21 (DE3) was extracted, and the T7 RNA polymerase sequence was amplified by PCR. The pCDNA3.1 vector was digested with EcoRI, and the T7 RNA polymerase sequence was homologously recombined into the pCDNA3.1 vector using the Shanghai Yisheng Hieff Clone® Universal II One Step Cloning Kit to obtain the T7-pCDNA vector.

[0039] Using the T7-pCDNA vector as a template, primers SEQ ID NO. 3 and SEQ ID NO. 4 were used for amplification to obtain a linearized T7-pCDNA vector with the NeoR / KanR gene sequence removed.

[0040] Sangon Biotech (Shanghai) Co., Ltd. (Shanghai Sangon) was commissioned to synthesize the puromycin N-acetyltransferase (PAC) gene sequence (SEQ ID NO. 7). Using the PAC sequence shown in SEQ ID NO. 7 as a template, homology arm primers (SEQ ID NO. 5 and SEQ ID NO. 6) were used for amplification to generate a PAC sequence containing homology arms. This PAC sequence containing homology arms was then homologously recombined into the linearized T7-pCDNA vector. DH5α competent cells were transformed, and the plasmid was extracted and named T7-PAC-pCDNA.

[0041] SEQ ID NO.1: actgtgctggatatctgcagatgaacacgattaacatcgctaagaacg (nucleotide sequence direction is 5'-3', the same below); SEQ ID NO.2:ccactagtccagtgtggtggttacgcgaacgcgaagtccg; SEQ ID NO.3: tcctgtctcttgatcagatccgaaaat; SEQ ID NO.4: cacgagatttcgattccaccg; SEQ ID NO.5: gatctgatcaagagacaggaatgaccgagtacaagcccacg; SEQ ID NO.6: ggtggaatcgaaatctcgtgtcaggcaccgggcttgc; SEQ ID NO.7: .

[0042] 2. Transfection of 293T cells (human renal epithelial cell line) with T7-PAC-pCDNA plasmid The day before transfection, seed 293T cells into a 6-well plate at a cell density of 70%-80% at the time of transfection. Dilute 2 μg of T7-PAC-pC DNA plasmid in 100 μL of serum-free DMEM medium, then add 4 μL of PEI transfection reagent (1 mg / mL), gently mix, and incubate at room temperature for 15 minutes to prepare the DNA-PEI complex. Add the DNA-PEI complex to the cells, shake the culture plate, and mix the medium. Incubate at 37°C, 5% CO2 for 24 hours. Trypsinize the cells and seed them into a T25 cell culture flask. Simultaneously, maintain a blank control flask with puromycin at a final concentration of 4 μg / mL. Incubate at 37°C, 5% CO2 for 5-7 days, until all blank control cells die. Once the transfected cells have reached confluency, maintain puromycin at a final concentration of 4 μg / mL and passage three times to establish a stable T7-293T cell line.

[0043] 3. Verification of T7-293T stable cell line RNA from T7-293T cells was extracted using Trizol. The primers shown in SEQ ID NO.1 and SEQ ID NO.2 were used to amplify the T7 RNA polymerase sequence by RT-PCR. The target band was detected, indicating that the T7-293T stable cell line was successfully constructed. Figure 1 , where M is a marker and lane 1 is the T7 RNA polymerase sequence. The T7-293T cell line was deposited in the General Microbiology Center of the China Culture Collection Administration under the deposit number CGMCC No. 46335.

[0044] Example 2 Construction of a full-length bovine parainfluenza virus type 3 gene plasmid 1. The LacZ-p15A vector was constructed by Shanghai Bioengineering, which contains the β-galactosidase (LacZα) coding sequence, the hammerhead ribozyme (HamRz) coding sequence, the T7 promoter, the p15A replicon, the AmpR resistance gene, the T7 terminator and the hepatitis D virus ribozyme (HdvRz) coding sequence. The sequence is shown in SEQ ID NO. 8. The plasmid map is shown in Figure 2 .

[0045] SEQ ID NO.8:

[0046] 2. Referring to the full-length gene sequence of bovine parainfluenza virus type 3 on GeneBank, primers were designed in the conserved regions, the full-length gene was divided into four segments, and BsmBI restriction sites were added to the upstream and downstream primers. RNA from the BPIV3-B1 strain (deposit number CGMCC No. 46410) was extracted using a viral DNA / RNA extraction kit. RT-PCR amplification of the target fragments was performed using primer pair 1 (shown in SEQ ID NO. 9 and SEQ ID NO. 10), primer pair 2 (shown in SEQ ID NO. 11 and SEQ ID NO. 12), primer pair 3 (shown in SEQ ID NO. 13 and SEQ ID NO. 14), and primer pair 4 (shown in SEQ ID NO. 15 and SEQ ID NO. 16), respectively. The electrophoresis results are shown in Figure 2. Figure 3 , where M is a marker, lane 1 is the amplification product of primer pair 1, lane 2 is the amplification product of primer pair 2, lane 3 is the amplification product of primer pair 3, and lane 4 is the amplification product of primer pair 4.

[0047] Using the Golden Gate cloning method, the reaction system was prepared with 75 ng of LacZ-p15A vector, 150 ng of each PCR product, 1 μL of Esp3I (BsmBI) restriction enzyme, 1 μL of T4 ligase, and 2 μL of 10× T4 ligase buffer, which was then diluted to 20 μL. The reaction was performed as follows: 30 cycles of 1 min at 37°C, 1 min at 16°C, and 5 min at 60°C for termination. The reaction product was transformed into a DH5α competent cell culture medium, and 10 μL of 0.1 M IPTG and 10 μL of X-gal (20 mg / mL) were added. The plate was then plated on an AmpR-resistant LB plate and incubated overnight at 37°C. White colonies were picked and identified by PCR using primer pairs 1 to 4. Positive colonies were cultured overnight at 37°C with shaking at 250 rpm to extract the plasmid, which was designated BPIV3-p15A.

[0048] SEQ ID NO.9: cgcggatccggctaccgtctctgaagagacttgcttgggaatattaattc; SEQ ID NO.10: acgcgtcgacggctaccgtctcgtccgcattgtttaggacattc; SEQ ID NO.11: cccaagcttggctaccgtctcgcggatactgcatcgaagatagactttctagcag; SEQ ID NO.12: acgcgtcgacggctaccgtctcttttggtgtcgtctttgcactgacttttggtctg; SEQ ID NO.13: acgcgtcgacggctaccgtctctcaaattcaaaaatggaatattgg; SEQ ID NO.14: acgcgtcgacggctaccgtctcgacaataaggatctccaacatatattg; SEQ ID NO.15: cccaagcttggctaccgtctcgttgtccaccatcagatattgaacatttaccac; SEQ ID NO. 16: ggctaccgtctcaagtcaccaaacaagagaaaaactc.

[0049] Example 3 Construction of bovine parainfluenza virus type 3 NP, P, and L gene expression plasmids Primers were designed based on the full-length gene of bovine parainfluenza virus type 3, and the NP gene was amplified by PCR using plasmid BPIV3-p15A as a template. The NP gene was homologously recombined into the downstream of the CMV promoter of the pIRES2-EGFP vector to obtain the plasmid pIRES-NP; wherein, the nucleotide sequences of the pIRES2-EGFP vector linearization primers are shown in SEQ ID NO.17 and SEQ ID NO.18, and the nucleotide sequences of the NP gene amplification primers are shown in SEQ ID NO.19 and SEQ ID NO.20.

[0050] Using plasmid BPIV3-p15A as a template, the P gene was amplified by PCR and homologously recombined into the pIRES-NP vector downstream of the internal ribosome entry site (IRES), replacing the EGFP gene to obtain the plasmid pIRES-NP-P. The nucleotide sequences of the pIRES-NP vector linearization primers are shown in SEQ ID NO.21 and SEQ ID NO.22, and the nucleotide sequences of the P gene amplification primers are shown in SEQ ID NO.23 and SEQ ID NO.24.

[0051] Using the vector LacZ-p15A as a template, the AmpR resistance gene was amplified by PCR and inserted between the SV40 polyadenylation signal and the SV40 promoter of the pIRES-NP-P vector by homologous recombination to obtain the plasmid pIRESA-NP-P. The nucleotide sequences of the pIRES-NP-P vector linearization primers are shown in SEQ ID NOs. 25 and 26, and the nucleotide sequences of the AmpR resistance gene amplification primers are shown in SEQ ID NOs. 27 and 28.

[0052] Using plasmid BPIV3-p15A as a template, the L gene was amplified by PCR and homologously recombined into the downstream of the SV40 promoter of the pIRESA-NP-P vector, replacing the NeoR / KanR genes to obtain the plasmid pIRESA-NP-PL (denoted as pIRES2-NPL). The nucleotide sequences of the pIRESA-NP-P vector linearization primers are shown in SEQ ID NOs. 29 and 30, and the nucleotide sequences of the L gene fragmentation primers are shown in SEQ ID NOs. 31 and 32.

[0053] SEQ ID NO.17: gcgctagcggatctgacg; SEQ ID NO.18: gcatttggaaacaactaacctctgcagtcgacggtaccg; SEQ ID NO.19: accgtcagatccgctagcgccaccatgctgagtctatttgacacattcagtgcgc; SEQ ID NO.20: ggttagttgtttccaaatgcact; SEQ ID NO.21: ggttgtggccatattatcatcgt; SEQ ID NO.22: cggccgcgactctagatcataa; SEQ ID NO.23: atgataatatggccacaaccatggaaaacaatgttaaagacaatca; SEQ ID NO.24: atgatctagagtcgcggccggagttggatccttggttggct; SEQ ID NO.25: cactgattaagcattggtaacgcttacaatttacgccttaagat; SEQ ID NO.26:cctgaggcggaaagaacca; SEQ ID NO.27: ttaccaatgcttaatcagtgaggca; SEQ ID NO.28: ctggttctttccgcctcaggcgcggaacccctatttgtt; SEQ ID NO.29: cgatcctcatcctgtctcttgat; SEQ ID NO.30: tcaaccattaactctcagcaaggctaactgaaacacggaagg; SEQ ID NO.31: aagagacaggatgaggatcggccaccatggacaccgaatcccacag; SEQ ID NO. 32: tgctgagagttaatggttgaaccaaacaagagaaaaactctgtttgttatatatat.

[0054] Example 4 Method for rescuing bovine parainfluenza virus type 3 The day before transfection, T7-293T cells were seeded into 6-well plates, and the cell density at the time of transfection was 70%~80%. Take 100 μL of serum-free DMEM medium, add 0.5 μg of the plasmid BPIV3-p15A constructed in Example 2 and 0.5 μg of the expression auxiliary plasmid pIRES2-NPL constructed in Example 3, and then add 3 μL of PEI transfection reagent (concentration 1 mg / mL), mix gently, and incubate at room temperature for 15 minutes to prepare a DNA-PEI complex. Add the DNA-PEI complex to the T7-293T cells, shake the culture plate, and mix the culture medium. Culture in a 37°C, 5% CO2 incubator for 8 hours. Trypsinize the cells, mix them with MDBK cells, and inoculate them into a T25 cell culture flask with a cell density of about 40%~60%. Maintain the culture with DMEM medium containing 1% bovine serum. MDBK cells develop pathological changes after 5~7 days (see Figure 4 ), indicating that bovine parainfluenza virus type 3 was successfully rescued.

[0055] Example 5 Comparison of rescue efficiency of single helper plasmid and multiple helper plasmids Referring to the bovine parainfluenza virus type 3 rescue method of Example 4, the transfection reagent was 3 μL PEI, and the cells were divided into 4 groups according to Table 1. Group 1 and Group 2 used T7-293T cells as transfection cells. Group 1 was transfected with the full-length gene plasmid BPIV3-p15A and the auxiliary plasmid pIRES2-NPL, and Group 2 was transfected with the full-length gene plasmid BPIV3-p15A and three auxiliary plasmids pCI-NP, pCI-P and pCI-L. 8 hours after transfection, they were mixed and cultured with MDBK cells for 7 days, and the cell pathological changes were observed. If there were no lesions, they were blindly passaged for 3 generations.

[0056] Groups 3 and 4 used BHK-21 cells as transfection cells. Group 3 was transfected with the full-length gene plasmid BPIV3-p15A, auxiliary plasmids pIRES2-NPL and pCGSSS-T7, and group 4 was transfected with the full-length gene plasmid BPIV3-p15A, auxiliary plasmids pCI-NP, pCI-P, pCI-L and pCGSSS-T7. Eight hours after transfection, the cells were mixed and cultured with MDBK cells for 7 days to observe cell lesions. If there were no lesions, the cells were blindly passaged for three generations. The transfection method was based on Chinese patent CN116479016A.

[0057] The construction methods of plasmids pCI-NP, pCI-P, pCI-L, and pCGSSS-T7 are described in Chinese patent CN116479016A. The methods for constructing three auxiliary plasmids pCI-NP, pCI-P, and pCI-L and pCGSSS-T7 are respectively described. For the most basic gene construction, the target gene is constructed into the CMV promoter.

[0058] The cytopathic effect results are shown in Table 1 .

[0059] Table 1 Cytopathic effect results in different groups

[0060] The results showed that group 1 developed cytopathic effects on day 5; group 2 developed cytopathic effects on passage 3; and groups 3 and 4 showed no cytopathic effects. The experimental results demonstrate that the bovine parainfluenza virus type 3 rescue method established in the present invention based on the T7-293T cell line is significantly superior to the virus rescue method using multiple helper plasmids to transfect BHK-21 cells.

[0061] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. A T7-293T cell line expressing T7 RNA polymerase, characterized in that: The deposit number is CGMCC No.46335.

2. Use of the T7-293T cells according to claim 1 in preparing a bovine parainfluenza virus type 3 infectious clone rescued virus product.

3. A kit for rescuing bovine parainfluenza virus type 3 infectious clone virus, characterized in that: comprising the T7-293T cells of claim 1, the BPIV3-p15A plasmid, and the helper plasmid pIRES2-NPL; The BPIV3-p15A plasmid includes a LacZ-p15A vector and a full-length gene sequence of bovine parainfluenza virus type 3 cloned into the LacZ-p15A vector; the nucleotide sequence of the LacZ-p15A vector is shown in SEQ ID NO.8; The auxiliary plasmid pIRES2-NPL includes a pIRES2-EGFP vector and a homologous recombination gene segment; the gene segment includes a nucleoprotein gene sequence of bovine parainfluenza virus type 3, a phosphoprotein gene sequence of bovine parainfluenza virus type 3, an antibiotic resistance gene and a large polymerase protein gene sequence of bovine parainfluenza virus type 3.

4. The kit according to claim 3, wherein The method for constructing the BPIV3-p15A plasmid comprises: The full-length gene sequence of bovine parainfluenza virus type 3 was divided into four segments for amplification, and the amplified target segments were cloned into the LacZ-p15A vector to obtain the BPIV3-p15A plasmid; the nucleotide sequences of the four pairs of primers used in the amplification were shown as follows: SEQ ID NO.9 and SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12, SEQ ID NO.13 and SEQ ID NO.14, and SEQ ID NO.15 and SEQ ID NO.16, respectively.

5. The kit according to claim 4, characterized in that The amplification is RT-PCR amplification; the template of the RT-PCR amplification is the RNA of the BPIV3-B1 virus strain; the preservation number of the BPIV3-B1 virus strain is CGMCC No.46410.

6. The kit according to claim 3, characterized in that The antibiotic resistance gene is an ampicillin resistance gene.

7. The kit according to claim 3, wherein The construction method of the auxiliary plasmid pIRES2-NPL comprises: Using the pIRES2-EGFP vector as a template, amplification was performed using primers with nucleotide sequences as shown in SEQ ID NO.17 and SEQ ID NO.18 to obtain a linearized pIRES2-EGFP vector; using a vector containing the full-length gene sequence of bovine parainfluenza virus type 3 as a template, amplification was performed using primers with nucleotide sequences as shown in SEQ ID NO.19 and SEQ ID NO.20 to obtain an NP gene; and homologous recombination was performed between the linearized pIRES2-EGFP vector and the NP gene to obtain a pIRES-NP vector; Using the pIRES-NP vector as a template, amplification is performed using primers with nucleotide sequences as shown in SEQ ID NO.21 and SEQ ID NO.22 to obtain a linearized pIRES-NP vector; using a vector containing the full-length gene sequence of bovine parainfluenza virus type 3 as a template, amplification is performed using primers with nucleotide sequences as shown in SEQ ID NO.23 and SEQ ID NO.24 to obtain a P gene; and homologous recombination is performed between the linearized pIRES-NP vector and the P gene to obtain a pIRES-NP-P vector; Using the pIRES-NP-P vector as a template, amplification was performed using primers with nucleotide sequences as shown in SEQ ID NO.25 and SEQ ID NO.26 to obtain a linearized pIRES-NP-P vector; using a vector containing an ampicillin resistance gene as a template, amplification was performed using primers with nucleotide sequences as shown in SEQ ID NO.27 and SEQ ID NO.28 to obtain an ampicillin resistance gene; and homologous recombination was performed between the linearized pIRES-NP-P vector and the ampicillin resistance gene to obtain a pIRESA-NP-P vector; Using the pIRESA-NP-P vector as a template, amplification was performed using primers with nucleotide sequences as shown in SEQ ID NO.29 and SEQ ID NO.30 to obtain a linearized pIRESA-NP-P vector; using a vector containing the full-length gene sequence of bovine parainfluenza virus type 3 as a template, amplification was performed using primers with nucleotide sequences as shown in SEQ ID NO.31 and SEQ ID NO.32 to obtain the L gene; and the linearized pIRESA-NP-P vector and the P gene were homologously recombined to obtain the helper plasmid pIRES2-NPL.

8. The kit according to claim 7, characterized in that The vector containing the full-length gene sequence of bovine parainfluenza virus type 3 is a LacZ-p15A vector; the vector containing the ampicillin resistance gene is a LacZ-p15A vector.

9. A method for preparing a bovine parainfluenza virus type 3 infectious clone rescue virus, characterized in that: include: The BPIV3-p15A plasmid and the auxiliary plasmid pIRES2-NPL are co-transfected into T7-293T cells to obtain a bovine parainfluenza virus type 3 infectious clone rescue virus; the T7-293T cells are the T7-293T cells described in claim 1 or the T7-293T cells in the kit described in any one of claims 3 to 8; the BPIV3-p15A plasmid and the auxiliary plasmid pIRES2-NPL are the BPIV3-p15A plasmid and the auxiliary plasmid pIRES2-NPL in the kit described in any one of claims 3 to 8.

10. The method according to claim 9, characterized in that The mass ratio of the BPIV3-p15A plasmid to the helper plasmid pIRES2-NPL is 1:1.

Images