Vomitoxin detoxification enzyme DH9-2 as well as coding gene and application thereof
By using the Devossia DH9-2 enzyme isolated from mealworm feces, the problem of DON contamination in mealworm feed was solved, efficient and low-cost biological detoxification was achieved, and the feed quality and safety were improved.
Patent Information
- Application Number
- CN202510802135.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-16
- Publication Date
- 2025-09-16
AI Technical Summary
Existing technologies make it difficult to remove vomitoxin (DON) from mealworm feed efficiently and at low cost. Traditional methods have a negative impact on feed quality and safety, and the application of biological enzymatic degradation of DON is not yet mature.
Provided is a detoxification enzyme from the bacteria Dvosella DH9-2 derived from Tenebrio molitor feces, which is produced in Escherichia coli via a recombinant expression vector and uses Ca2+ and PQQ coenzyme to efficiently oxidize DON to low-toxic 3-keto-DON at 35°C and pH 9.0.
It showed a 100% DON degradation rate in mealworm bran feed, achieving a safe, efficient and environmentally friendly detoxification effect, and improving breeding efficiency and product safety.
Smart Images
Figure CN120648668A_ABST
Abstract
Description
Technical Field
[0001] The embodiments of the present invention relate to the fields of biotechnology and feed safety, and specifically to a vomitoxin detoxification enzyme DH9-2, its encoding gene, and application. Background Art
[0002] Deoxynivalenol (DON), also known as deoxynivalenol, is a type B trichothecene toxin produced by Fusarium fungi during grain growth, harvesting, and storage. It is one of the most common contaminants in grains and their products. DON poses a serious threat to human and animal health, causing acute and chronic toxic reactions such as anorexia, vomiting, diarrhea, immunosuppression, growth retardation, and reproductive failure. It poses significant economic losses and public health risks to the global agricultural and food industries.
[0003] As a highly nutritious and easily cultured insect, mealworms (Tenebrio molitor) are increasingly becoming a promising new source of animal protein and a sustainable feed resource. They are widely used in feeds for specialty species (such as poultry, fish, and reptiles) and in the development of future human food. Mealworms typically rely on cereal by-products such as wheat bran and cornmeal, or a mixture of these. These feed matrices are highly susceptible to contamination with fungal toxins such as DON.
[0004] Therefore, DON pollution has the potential to have a significant negative impact on the mealworm farming industry. First, although mealworms show a certain tolerance to DON, studies have shown that certain concentrations or long-term exposure to DON may still pose a potential threat to the health of mealworms, such as affecting their survival rate, growth and development rate, and feed conversion efficiency, thereby affecting the profitability of farming. Second, although some studies have shown that DON does not accumulate significantly in mealworms, there is still a potential risk that DON and its metabolites will remain in their bodies and be passed through the food chain to economic animals (such as poultry and aquatic products) or humans that feed on mealworms, thus posing a food safety risk.
[0005] Currently, DON detoxification methods primarily include physical methods (such as heating, screening, and adsorption), chemical methods (such as ozone treatment, acid-base treatment, and oxidant treatment), and biological methods. Physical and chemical methods often present challenges such as harsh operating conditions, high costs, potential loss of the original nutritional value of the feed, generation of harmful byproducts or secondary pollution, and impact on feed palatability. These limitations are particularly pronounced when processing insect feeds such as mealworms, which place high demands on feed quality and safety, making them difficult to meet the mealworm aquaculture industry's demand for safe, efficient, and low-cost detoxification technologies. Biological methods, particularly the use of microorganisms or their enzymes to degrade DON, are considered the most promising DON reduction technologies due to their environmental friendliness, high specificity, mild reaction conditions, and minimal impact on feed nutritional composition. The biotransformation pathways of DON primarily involve modification of the C3 hydroxyl group in its molecular structure (such as oxidation or epimerization) and ring-opening of the C12,13 epoxy groups. Among them, the oxidation of the C3 hydroxyl group to 3-keto-DON, whose toxicity is significantly reduced, is an important detoxification pathway, and this reaction is mainly catalyzed by pyrroloquinoline quinone (PQQ)-dependent alcohol dehydrogenase. Although there have been reports on research on DON-degrading bacteria and their enzymes, the development of DON detoxification enzymes that can be used efficiently, stably, and at low cost in complex feed matrices (such as mealworm wheat bran feed) and the establishment of supporting application technologies remain key issues that need to be addressed. In particular, enzymes isolated and screened from microorganisms closely associated with the intestines of specific hosts (such as mealworms) or their food-borne environments may exhibit unique advantages in detoxification applications targeting specific hosts or their feeds due to their natural adaptability.
[0006] Therefore, there is an urgent need in this field for a new, efficient DON detoxification enzyme suitable for use in mealworm feed and its supporting technology to ensure the healthy and sustainable development of the mealworm breeding industry and the safety of related products. Summary of the Invention
[0007] The present invention aims to overcome the shortcomings of the existing technology by providing a novel and highly effective detoxifying enzyme for vomitoxin, its encoding gene, a recombinant production method, and its application in detoxifying DON from wheat bran feed in Tenebrio molitor. The goal is to provide a safe and effective biological solution to the problem of DON contamination in Tenebrio molitor aquaculture. In particular, the enzyme provided herein is derived from Devosella spp., previously isolated from Tenebrio molitor feces, and is expected to have good adaptability in Tenebrio molitor-related applications.
[0008] To achieve the above objectives, the present invention provides the following technical solutions:
[0009] In a first aspect, the present invention provides a detoxifying enzyme comprising an amino acid sequence selected from the group consisting of:
[0010] (a) the amino acid sequence shown in SEQ ID NO: 2; or
[0011] (b) A polypeptide derived from the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing by substitution, deletion or addition of one or more amino acid residues, having at least 90% (preferably at least 95%, more preferably at least 98%, most preferably at least 99%) sequence identity with the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing, and having the activity of catalyzing the oxidation of the C3 hydroxyl group of vomitoxin to produce 3-keto-vomitoxin.
[0012] In a preferred embodiment of the present invention, the enzyme exhibits optimal activity at 35°C and pH 9.0, and its activity is dependent on Ca 2+ The presence of ions and the participation of PQQ coenzyme.
[0013] In a preferred embodiment of the present invention, the enzyme is derived from Devosia sp. SD9-2 strain previously isolated from Tenebrio molitor feces and named DH9-2.
[0014] In a second aspect, the present invention provides a nucleic acid molecule encoding the vomitoxin detoxification enzyme of the first aspect, which has a nucleotide sequence selected from the group consisting of:
[0015] (a) the nucleotide sequence shown in SEQ ID NO: 1;
[0016] (b) a nucleotide sequence having at least 85% (preferably at least 90%, more preferably at least 95%, most preferably at least 98%) sequence identity with the nucleotide sequence shown in SEQ ID NO: 1 in the sequence listing, and encoding a polypeptide having the activity of catalyzing the oxidation of the C3 hydroxyl group of vomitoxin to produce 3-keto-vomitoxin; or
[0017] (c) A nucleotide sequence that is different from the nucleotide sequence shown in SEQ ID NO: 1 in the sequence listing due to the degeneracy of the genetic code, but encodes a polypeptide having the same amino acid sequence as that shown in SEQ ID NO: 2 in the sequence listing.
[0018] In a third aspect, the present invention provides a recombinant expression vector comprising the nucleic acid molecule described in the second aspect, operably linked to an expression control sequence. Preferably, the expression control sequence includes a promoter, a terminator, etc. In a preferred embodiment, the expression vector is pET-28a or a derivative thereof.
[0019] In a fourth aspect, the present invention provides a recombinant engineered bacterium comprising the recombinant expression vector described in the third aspect, or integrating the nucleic acid molecule described in the second aspect into the genome of its host cell. Preferably, the host cell is a prokaryotic or eukaryotic cell. In a preferred embodiment, the recombinant engineered bacterium is Escherichia coli BL21 (DE3); or a food-grade or feed-grade safe microorganism, such as Bacillus, lactic acid bacteria, or yeast.
[0020] In a fifth aspect, the present invention provides a method for producing the vomitoxin detoxifying enzyme according to the first aspect, the method comprising:
[0021] (a) cultivating the recombinant engineered bacteria described in the fourth aspect;
[0022] (b) inducing the recombinant engineered bacteria to express the vomitoxin detoxification enzyme under suitable conditions; and
[0023] (c) isolating and purifying the vomitoxin detoxification enzyme from the culture.
[0024] The culture can be bacterial cells or culture supernatant.
[0025] In a sixth aspect, the present invention provides use of the detoxifying enzyme described in the first aspect, the nucleic acid molecule described in the second aspect, the recombinant expression vector described in the third aspect, or the recombinant engineered bacteria described in the fourth aspect for detoxifying cereal-based materials. In a preferred embodiment, the cereal-based material is mealworm bran feed.
[0026] In a seventh aspect, the present invention provides a method for degrading vomitoxin in mealworm bran feed or other grain-based materials, the method comprising contacting the feed or material with the vomitoxin detoxification enzyme described in the first aspect or the recombinant engineered bacteria described in the fourth aspect (or its lysate containing the enzyme, culture supernatant, or in the form of an enzyme preparation) under suitable conditions.
[0027] The suitable conditions preferably include: a temperature of 25°C to 45°C, more preferably about 35°C; a pH of 7.0 to 10.0, more preferably about pH 9.0; and preferably, 100 μmol / L CaCl2 and 100 μmol / L PQQ coenzyme are added to the reaction system.
[0028] The contacting method may include directly adding the enzyme or engineered bacteria to the feed for mixing treatment, spraying treatment, or detoxification through a feed fermentation process.
[0029] The embodiments of the present invention have the following advantages:
[0030] The present invention provides a novel DON detoxification enzyme DH9-2, derived from the Devosia sp. SD9-2 strain, previously isolated from Tenebrio molitor feces and associated with the Tenebrio molitor's food source. This enzyme efficiently oxidizes DON to the less toxic 3-keto-DON, providing a new enzyme resource for the biological detoxification of Tenebrio molitor wheat bran feed. Due to its unique source, the enzyme may be naturally more adapted to the Tenebrio molitor intestinal environment or its primary feed matrix (such as wheat bran), thereby exhibiting improved stability, adaptability, and potential synergy with Tenebrio molitor intestinal microorganisms in practical applications.
[0031] The present invention provides the coding gene and recombinant production method of the enzyme, which can be efficiently expressed and purified in hosts such as Escherichia coli through genetic engineering methods, laying the foundation for the large-scale, low-cost production of the enzyme and its application in mealworm feed processing. The obtained recombinant enzyme DH9-2 exhibits good enzymatic properties. For example, at 35°C and pH 9.0, it is Ca-dependent. 2+ The enzyme, along with PQQ, exhibits high DON degradation activity, achieving 100% degradation of 50 μg / mL DON within 30 minutes. Experiments have demonstrated that the enzyme is not only effective in buffer systems but also exhibits excellent DON degradation in simulated and actual mealworm wheat bran feed matrices, demonstrating excellent potential for practical applications.
[0032] The enzyme and application method provided by the present invention provide a safe, efficient and environmentally friendly new biological detoxification method to solve the problem of DON contamination in feed raw materials such as wheat bran in mealworm farming, which helps to improve the farming efficiency of mealworm and product safety. BRIEF DESCRIPTION OF THE DRAWINGS
[0033] To more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for the embodiments or the description of the prior art. Obviously, the drawings described below are merely exemplary, and those skilled in the art can derive other implementation drawings based on the provided drawings without inventive effort.
[0034] Figure 1 This is an agarose gel electrophoresis diagram of the PCR amplification products of the DH9-2 gene fragment and the linear vector pET28a provided by the present invention.
[0035] Figure 2 This is an SDS-PAGE electrophoresis analysis diagram of the recombinant enzyme DH9-2 provided by the present invention.
[0036] Figure 3 This is the optimal reaction temperature curve of the recombinase DH9-2 provided by the present invention.
[0037] Figure 4 This is the optimal reaction pH curve of the recombinant enzyme DH9-2 provided by the present invention.
[0038] Figure 5 This is a diagram showing the effect of metal ions on the activity of the recombinant enzyme DH9-2 provided by the present invention.
[0039] Figure 6 This is the enzymatic reaction kinetic curve of the recombinant enzyme DH9-2 provided by the present invention.
[0040] Figure 7 This is a diagram showing the effect of the recombinant enzyme DH9-2 provided by the present invention on degrading DON in wheat bran samples.
[0041] Figure 8 This is an HPLC chart of the degradation of DON in wheat bran samples by the recombinant enzyme DH9-2 provided by the present invention. DETAILED DESCRIPTION
[0042] The following describes the implementation of the present invention using specific embodiments. Those skilled in the art will readily understand the other advantages and benefits of the present invention from the disclosure herein. Obviously, the embodiments described are only a portion of the present invention, not all of it. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without inventive effort are intended to fall within the scope of protection of the present invention.
[0043] Example 1: Cloning of the DON detoxification enzyme DH9-2 gene and construction of a recombinant expression vector
[0044] 1.1 Gene source and sequence acquisition:
[0045] The gene encoding the detoxifying enzyme DH9-2 is derived from the bacterium Devosuliae SD9-2, previously isolated from the feces of Tenebrio molitor larvae. SD9-2 was isolated from the excrement of Tenebrio molitor larvae by the inventors through enrichment culture and microbial purification techniques, with the addition of the cofactor pyrroloquinoline quinonedisodium salt (PQQ). This strain is highly effective in degrading DON at a concentration of 50 μg·mL within 72 hours at 30°C and pH 7.0. -1 The degradation rate of DON was as high as 100%, and the degradation product was 3-keto-DON. For details, please refer to the screening, identification and degradation characteristics characterization of a vomitoxin-degrading strain [J]. Environmental Chemistry, 2024, 43(8): 2845-2853.
[0046] To obtain the gene encoding the detoxification enzyme DH9-2 for vomitoxin, the whole genome of the SD9-2 strain was first sequenced and annotated, and its protein sequence database was established. Subsequently, the amino acid sequence of the known PQQ-dependent alcohol dehydrogenase DepA (NCBI accession number: KFL25551.1) was used as a probe, and homology alignment was performed in this database using the BLASTP program. The screening condition was E-value ≤ 10 -5 , combined with functional domain analysis. This method identified a candidate PQQ-dependent alcohol dehydrogenase gene, the encoded enzyme of which was designated DH9-2. The mature peptide of this enzyme consists of 565 amino acids with a molecular weight of 62.5 kDa. The theoretical isoelectric point (pI) calculated based on its amino acid composition is 4.45, indicating that it is an acidic enzyme. Its nucleotide sequence and amino acid sequence are shown in the sequence listings as SEQ ID NO:1 and SEQ ID NO:2, respectively:
[0047]
[0048] QSDLLENMSPVTDEMIQNPDPGAWLSYRRTLDNQGFSPLDQITKENVGDLQVVWSRGMTEGYQEGTPLVHDGVMFVPHPRDIIQALDATNGDLLWEYKRELPNNVPMIVATRNMAIWDNLIVFSSKDNYLVALDAKTGQLVWETQLRDQDSWAWSTPGPIIVNGKAISGRSCAQQPSGDTPVGGPETCFLTAHDMKTGEEMWRFHTLPHGDMAGSETWNGVDDSLRHHVGSWISPAYDPELNLVYFGTSVTSPYSKFYFANFDSVEDLDAQEFLYQTSTLAIDADTGELKWFQQHLRDHWDLDHPFERVLVNTAIAPNADEVRWINPNVTPGEERRVVTGIPGKTGIFYSMDAGTGEFLWARETVFQNVISDIDTATGRATIPHDMIPTEIGQSMLVCPSASGGRRWFTSTYSPLTNAIYTPLSNNCMQSVTLPNDIRLSPPVMAPGVTNIGTISAISVETGEELWSLDQEDFTTSLLSTQGGLLFGGDTNRRFRAFDQDNGDVLFEAIVPSSVGGVPISYEVDGRQYIAVQVGSWLDIAPFVALSPREVVTGGNAVVVFALPQK(SEQ ID NO:2).
[0049] 1.2 Primer design and gene amplification:
[0050] To clone the candidate DON detoxification enzyme encoding gene, based on the T5 exonuclease-dependent assembly (TEDA) strategy, the upstream primer: 5'-CATCATCATCATCACCAGTCGGACCTTCTGGAGAACA-3' (SEQ ID NO: 3) and the downstream primer: 5'-AGCAGCCGGATCTCATTACTTCTGCGGAAGGGCGA-3' (SEQ ID NO: 4) were designed according to the region encoding the mature peptide in SEQ ID NO: 1. PCR amplification was performed using genomic DNA of Devosia sp. SD9-2 strain as a template using high-fidelity Q5 DNA polymerase. PCR reaction system (50 μL): 50 ng template DNA, 1 μL upstream primer (10 μM), 1 μL downstream primer (10 μM), 1 μL dNTPs (10 mM each), 10 μL 5× reaction buffer, 0.5 μL high-fidelity DNA polymerase, and ddH₂O to 50 μL. PCR conditions: 98°C initial denaturation for 30 s; 30 cycles of 98°C denaturation for 10 s, 72°C annealing and extension for 30 s, and 72°C extension for 90 s; final extension at 72°C for 4 min. Primers and conditions for amplification of the pET28a linearized vector are as follows: Primer Vector_FOR: TGAGATCCGGCTGCTAACAAAGC (SEQ ID NO: 5); Primer Vector_REV: GTGATGATGATGATGATGGCTGCT (SEQ ID NO: 6). Amplification conditions: 98°C / 2 min; 35× (98°C / 10 s, 68°C / 30 s, 72°C / 180 s); 72°C / 4 min. PCR products were detected by 1% agarose gel electrophoresis, and target fragments consistent with the expected sizes (approximately 1.7 kb and 5.3 kb) were recovered using a gel recovery kit ( Figure 1 , a is the DH9-2 gene fragment, b is the linear vector pET28a).
[0051] 1.3 Construction of recombinant expression vector:
[0052] Using the TEDA cloning method, the PCR product was directionally cloned into the linearized pET-28a(+) vector, with a His6-tag at the N-terminus. The ligation product was transformed into Escherichia coli TOP10 competent cells, plated on LB agar plates containing 50 μg / mL kanamycin, and incubated at 37°C for 16 hours. Single colonies were selected, and the correctness of the recombinant plasmid was verified by colony PCR and restriction enzyme analysis. Positive clones that were correctly digested were sent for DNA sequencing to ensure the correct sequence and reading frame of the insert, resulting in the recombinant expression plasmid pET28a-DH9-2.
[0053] Example 2: Expression and purification of recombinant vomitoxin detoxification enzyme DH9-2
[0054] The recombinant plasmid pET28a-DH9-2 with correct sequencing was transformed into Escherichia coli BL21 (DE3) competent cells. A single transformant was picked and inoculated into 5 mL of LB liquid medium containing 50 μg / mL kanamycin, and cultured at 37°C, 220 rpm, and shaken overnight as a seed culture. The seed culture was transferred to 1 L of LB liquid medium containing the same concentration of kanamycin at a 1% (v / v) inoculation volume, and cultured at 37°C, 220 rpm, and shaken until the bacterial liquid optical density OD 600 Reach 0.6-0.8. Add isopropyl-β-D-thiogalactopyranoside (IPTG) to a final concentration of 0.2 mmol / L and transfer to an 18°C shaker at 220 rpm to induce expression for 16 hours. Centrifuge the induced culture at 6000-8000 × g for 10-15 minutes at 4°C to collect the pellet. Resuspend the pellet in lysis buffer (50 mM Tris-HCl pH 8.0, 300 mM NaCl, 10 mM imidazole, 1 mM PMSF) and disrupt by ultrasonication on ice. Centrifuge the lysate at 12000-15000 × g for 20 minutes at 4°C, and collect the supernatant. Pass the supernatant through a Ni-NTA agarose affinity chromatography column pre-equilibrated with binding buffer (same as lysis buffer, but without PMSF). Wash the column extensively with binding buffer to remove unbound contaminants. Subsequently, the target protein was eluted with an elution buffer containing a gradient concentration of imidazole (20, 50, 100, 250, 500 mM imidazole). The eluted fractions were collected. The expression and purification of the target protein in each fraction were detected by SDS-PAGE electrophoresis. The fractions containing high-purity target protein (molecular weight approximately 63.3 kDa) were combined. The SDS-PAGE electrophoresis analysis is shown in Figure 2. Figure 2, where M: marker; 1: cell disruption buffer; 2: cell disruption supernatant; 3: column flow-through; 4: 20 mmol / L imidazole eluent; 5: 50 mmol / L imidazole eluent; 6: 100 mmol / L imidazole eluent; 7: 200 mmol / L imidazole eluent; 8: 500 mmol / L imidazole eluent. The combined protein solution was concentrated using a 30 kDa molecular weight cutoff ultrafiltration centrifuge tube, aliquoted, and stored at -80°C until use.
[0055] Example 3: Characterization of the enzymatic properties of recombinant enzyme DH9-2
[0056] 3.1 Enzyme activity determination method:
[0057] The standard reaction system (total volume 200 μL) contained: 50 μg / mL DON, 100 μmol / L PQQ, 100 μmol / L CaCl2, 40 μmol / L PMS (phenazine methosulfate as an electron acceptor), 25 mmol / L Tris-HCl buffer (pH 8.0), and an appropriate amount of purified DH9-2 enzyme. The reaction mixture was incubated in a 35°C water bath for 30 minutes. After completion, an equal volume of acetonitrile was added to terminate the reaction. After mixing thoroughly, the mixture was centrifuged at 12,000 × g for 5 minutes. The supernatant was filtered through a 0.22 μm filter and analyzed by high-performance liquid chromatography (HPLC).
[0058] HPLC conditions: column temperature 40 °C, injection volume 2 μL, ACQUITY A BEH C18 column (2.1 × 100 mm, 1.7 μmol / L; Waters) was used. Mobile phase A consisted of pure water, and mobile phase C consisted of acetonitrile. Elution conditions were as follows: 0-6 min, 0.2 ml / min, 5% C to 25% C; 6-12 min, 0.2 ml / min, 25% C; 12-13 min, 0.2-0.4 ml / min, 25% C to 5% C; 13-17 min, 0.4 ml / min, 5% C; 17-18 min, 0.4-0.2 ml / min, 5% C. DON was detected at a wavelength of 220 nm.
[0059] 3.2 Optimum reaction temperature and pH:
[0060] Optimum temperature: Under the standard reaction pH (pH 8.0) conditions, the enzyme activity was measured at different temperatures (4°C, 15°C, 25°C, 30°C, 35°C, 40°C, 45°C, 55°C, 65°C). The highest enzyme activity was taken as 100% to calculate the relative enzyme activity. The results showed that the optimal reaction temperature of DH9-2 was about 35°C ( Figure 3 ).
[0061] Optimum pH: Under the optimal reaction temperature (35°C), enzyme activity was determined using buffer systems with different pH values (pH 4.0-5.0 citric acid-sodium citrate buffer, pH 6.0-7.0 phosphate buffer, pH 8.0-9.0 Tris-HCl buffer, pH 10.0 carbonate buffer, all 25 mmol / L). The relative enzyme activity was calculated with the highest enzyme activity as 100%. The results showed that the optimal reaction pH of DH9-2 was approximately 9.0 ( Figure 4 ).
[0062] 3.3 Effect of metal ions on enzyme activity:
[0063] In the standard reaction system, CaCl2 was replaced with other metal ion salts (MgCl2, MnCl2, ZnCl2, CuCl2, FeCl2, all at 2 mmol / L) at equimolar concentrations, or no exogenous metal ions were added (only PQQ and PMS), and the enzyme activity was measured. The relative enzyme activity was calculated with the enzyme activity when CaCl2 was added as 100%. The results showed that the activity of DH9-2 was highly dependent on CaCl2. 2+ The presence of ions; without adding Ca 2+ When other test metal ions were added, the enzyme activity was significantly reduced or almost undetectable ( Figure 5 ).
[0064] 3.4 Enzyme kinetic parameters:
[0065] Under the optimal reaction conditions (35°C, pH 9.0, with sufficient PQQ and CaCl2), the initial reaction rate was determined by varying the DON substrate concentration (a series of concentration gradients from 10 μg / mL to 2000 μg / mL). The data were fitted using the nonlinear regression method (Michaelis-Menten equation) to calculate the enzyme kinetic parameters. The enzymatic reaction kinetic curve of DH9-2 is shown in Figure 6 The results showed that the Km value of DH9-2 for DON was 708±47.01μg / mL, and the Vmax value was 10.67±0.35μg / mL·min -1 , kcat value is 3.37±0.11s -1 .
[0066] Example 4: Application of recombinant enzyme DH9-2 in degrading DON in mealworm wheat bran feed
[0067] 4.1 Preparation of wheat bran feed samples:
[0068] Commercially available wheat bran commonly used for mealworms was ground and passed through a 40-mesh sieve. A portion of the wheat bran sample was artificially added with a DON standard solution, mixed thoroughly, and air-dried to a final DON contamination concentration of 10 μg / g (dry weight basis).
[0069] 4.2 Enzyme treatment:
[0070] Weigh 10 g of DON-contaminated wheat bran sample and place it in a 50 mL centrifuge tube. Add 20 mL of pH 9.0 Tris-HCl buffer (25 mmol / L, pre-dissolve 100 μmol / L PQQ and 100 μmol / L CaCl2) to fully mix the wheat bran and buffer to form a uniform paste or suspension. Experimental group: Add purified recombinant enzyme DH9-2 to the above wheat bran mixture so that the enzyme addition amount reaches 100 ng / g wheat bran. Control group 1: No enzyme is added, only an equal volume of enzyme storage buffer is added. All samples are placed in a 35°C constant temperature shaker and shaken at 150 rpm for 1 hour.
[0071] 4.3DON content detection and degradation rate calculation:
[0072] After the reaction is completed, 84:16 acetonitrile: water solution is added to each sample and vortexed vigorously for 30 minutes. Centrifuge the extract at 4°C and 8000×g for 10 minutes and take the supernatant. If the supernatant is turbid, it can be centrifuged again or filtered through a 0.45μm filter membrane. Purify part of the supernatant through an immunoaffinity column. The purified sample liquid was used for quantitative analysis of DON and its main degradation product 3-keto-DON by HPLC-UV. DON degradation rate (%) = [(DON concentration in the control group - DON concentration in the experimental group) / DON concentration in the control group] × 100%. The DON content in the experimental group was significantly lower than that in the control group, and the degradation rate could reach 92% ( Figure 7 ), and the generation of 3-keto-DON can be detected ( Figure 8 There was no significant difference in DON content in control group 1. This indicates that the DH9-2 enzyme provided by the present invention can effectively degrade DON in the mealworm wheat bran feed matrix.
[0073] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made thereto. Therefore, such modifications and improvements, without departing from the spirit of the present invention, are intended to be within the scope of protection claimed herein.
Claims
1. A detoxifying enzyme for vomitoxin, characterized in that: The amino acid sequence of the enzyme is selected from: (a) the amino acid sequence shown in SEQ ID NO: 2; or (b) A polypeptide having at least 90% sequence identity with the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing and having the activity of catalyzing the oxidation of the C3 hydroxyl group of vomitoxin to produce 3-keto-vomitoxin.
2. The detoxifying enzyme for vomitoxin according to claim 1, characterized in that The enzyme exhibits optimal activity at 35°C and pH 9.0, and its activity is dependent on Ca2 + The presence of ions and the participation of PQQ coenzyme.
3. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the vomitoxin detoxification enzyme according to claim 1 or 2.
4. The nucleic acid molecule according to claim 3, characterized in that The nucleotide sequence of the nucleic acid molecule is selected from: (a) the nucleotide sequence shown in SEQ ID NO: 1; or (b) a nucleotide sequence having at least 85% sequence identity with the nucleotide sequence shown in SEQ ID NO: 1 in the sequence listing, and encoding a polypeptide having the activity of catalyzing the oxidation of the C3 hydroxyl group of vomitoxin to produce 3-keto-vomitoxin; or (c) A nucleotide sequence that is different from the nucleotide sequence shown in SEQ ID NO: 1 in the sequence listing due to the degeneracy of the genetic code, but encodes a polypeptide having the same amino acid sequence as that shown in SEQ ID NO: 2 in the sequence listing.
5. A recombinant expression vector, characterized in that: It comprises the nucleic acid molecule according to claim 3 or 4, and is operably linked to an expression control sequence.
6. A recombinant engineered bacterium, characterized in that: It comprises the recombinant expression vector according to claim 5, or integrates the nucleic acid molecule according to claim 3 or 4 into the genome of its host cell.
7. The recombinant engineered bacterium according to claim 6, characterized in that The host cell is Escherichia coli, Bacillus, lactic acid bacteria or yeast.
8. A method for producing the vomitoxin detoxifying enzyme according to claim 1 or 2, characterized in that: The method comprises the steps of culturing the recombinant engineered bacteria according to claim 6 or 7, inducing expression under suitable conditions, and then recovering the enzyme from the culture.
9. Use of the vomitoxin detoxification enzyme according to claim 1 or 2, the nucleic acid molecule according to claim 3 or 4, the recombinant expression vector according to claim 5, or the recombinant engineered bacteria according to claim 6 or 7 for detoxification of vomitoxin from cereal-based materials, preferably, the cereal-based material is mealworm bran feed.
10. A method for reducing the content of vomitoxin in a cereal-based material, characterized in that: The method comprises mixing a cereal-based material with the vomitoxin detoxification enzyme according to claim 1 or 2, or the recombinant engineered bacteria according to claim 6 or 7, or a lysate, culture supernatant, or enzyme preparation thereof containing the enzyme in a Ca2 + ions and PQQ coenzyme.