DsPopeACT and dsRNA nano-composite for preventing and controlling phthorimaea operculella and application of dsPopeACT and dsRNA nano-composite

Abstract

The invention relates to the technical field of pest prevention and control, in particular to a dsPopeACT and dsRNA nano-composite for preventing and controlling phthorimaea operculella and application of the dsPopeACT and dsRNA nano-composite. The dsPopeACT is synthesized by using a PopeACT gene cloned from phthorimaea operculella and a dsRNA specific primer, the nucleotide sequence of the dsPopeACT is shown as SEQ ID NO.6, and meanwhile, in order to effectively protect dsRNA from being influenced by environment and insect intestinal nuclease, the dsPopeACT and a nano-carrier SPc are loaded and combined to form the dsRNA nano-composite. The dsRNA nano-composite is introduced into the phthorimaea operculella, the fatality rate of the nano-composite on newly hatched larvae of the phthorimaea operculella within 5 days is close to 100%, compared with non-nanocrystallized dsRNA, the lethal effect of the nano-composite on the newly hatched larvae of the phthorimaea operculella is better, and a new method is provided for biological control of the phthorimaea operculella.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and agricultural applications, and relates to a dsPopeACT, dsRNA nanocomplex for preventing and controlling potato tuber moth and an application thereof. Background Art

[0002] The potato tuber moth, Phthorimaea operculella, is an invasive pest of the family Phthorimaea in the order Lepidoptera. It primarily harms Solanaceae crops such as potatoes and tomatoes, with a particular preference for potatoes. Its larvae primarily infest potato tubers and leaves, causing tuber rot and reduced yields, severely damaging my country's potato industry.

[0003] Currently, agricultural production primarily uses chemical pesticides and biological pesticides to control potato pests. However, due to the extensive use of these pesticides, the potato tuber moth has developed resistance, particularly to toxic organophosphorus insecticides. Excessive use of chemical pesticides can lead to environmental pollution and the potential for pesticide residues.

[0004] RNAi technology holds broad application prospects in pest control due to its high efficiency, specificity, and environmental friendliness. However, its application in lepidopteran pests is limited by their insensitivity to RNAi. Nanocarriers bind and encapsulate negatively charged dsRNA, effectively protecting it from degradation by dsRNase in the digestive tract of lepidopteran insects. They also significantly reduce dsRNA particle size and improve its delivery efficiency, thereby enhancing the effectiveness of RNAi interference against lepidopteran insects.

[0005] Actin (ACT) is a highly conserved protein ubiquitous in eukaryotic cells, with a molecular weight of 43 kDa. It participates in the formation of the complex cytoskeletal network of proteins in eukaryotic cells, providing support for the cell, determining its shape, imparting its strength, and spatially organizing organelles and certain macromolecules. In agricultural pest control, studies have reported that the actin gene can be used as a target for RNAi against the Colorado potato beetle, a coleopteran potato pest, but this has not been reported in lepidopteran pests. Due to their high sensitivity to RNAi, coleopteran insects are generally highly responsive to RNAi, particularly to orally delivered dsRNA. This high efficiency may be related to the presence of specific dsRNA-binding proteins (such as Staufen C) in their gut, which are involved in dsRNA uptake and processing. Furthermore, RNAi effects in coleopteran insects can spread throughout the body via the hemolymph, achieving systemic gene silencing. The midgut of lepidopteran insects contains highly active dsRNases that rapidly degrade ingested dsRNA. This results in low RNAi efficiency. Furthermore, the Dicer enzyme in Lepidoptera insects is inefficient at processing dsRNA into siRNA, and the recruitment of the RISC complex is weak, further limiting the effectiveness of RNAi. Therefore, RNAi against Lepidoptera pests currently relies primarily on vector protection and novel delivery systems. After identifying highly effective fragments, effectively leveraging existing technological advances to create highly effective nanoformulations and applying them to pest control would be of great significance for the large-scale control of these Lepidoptera pests. Summary of the Invention

[0006] To address the shortcomings of the existing technology, the technicians of the present invention took the potato tuber moth as the research object, screened the target gene PopeACT that can be used to interfere with the potato tuber moth and prepared dsRNA. They used a nanocarrier SPc for loading and created a nanodrug delivery system that can improve the stability and delivery efficiency of dsRNA in the potato tuber moth, thereby contributing to the green prevention and control of the potato tuber moth.

[0007] The present invention provides the following technical solutions:

[0008] In a first aspect, the present invention provides a dsPopeACT for controlling potato tuber moth, the nucleotide sequence of which is shown in SEQ ID NO.6, and is synthesized from the PopeACT gene shown in SEQ ID NO.5 and dsRNA primers shown in SEQ ID NO.7 to SEQ ID NO.8.

[0009] The second aspect of the present invention provides the use of the above-mentioned dsPopeACT in the prevention and control of potato tuber moth.

[0010] In a third aspect, the present invention provides a dsRNA nanocomplex comprising the dsPopeACT described above, further comprising a nanocarrier SPc. The dsRNA nanocomplex is prepared from dsPopeACT at a concentration of 1000 ng / μL and nanocarrier SPc at a concentration of 1000 ng / μL, with the mass ratio of dsPopeACT to SPc being 2:1.

[0011] A fourth aspect of the present invention provides the use of the above-mentioned dsRNA nanocomplex in the prevention and control of potato tuber moth.

[0012] A fifth aspect of the present invention provides a method for preventing and controlling potato tuber moths, which comprises feeding dsPopeACT, a substance that inhibits the expression of the potato tuber moth's PopeACT gene, to potato tuber moths.

[0013] Beneficial effects of the present invention:

[0014] The present invention uses PopeACT cloned from the potato tuber moth and dsRNA-specific primers to synthesize the nucleotide sequence dsPopeACT (shown in SEQ ID NO. 2). To effectively protect the dsRNA from environmental and insect gut nucleases, the dsPopeACT is combined with a nanocarrier SPc to form a dsRNA nanocomplex. The dsRNA nanocomplex was introduced into potato tuber moths using a feeding method. Within five days, the nanocomplex achieved a nearly 100% lethality against newly hatched larvae of the moths. Compared to non-nanoencapsulated dsRNA, the nanocomplex also demonstrated superior lethality against newly hatched larvae, providing a new method for biological control of the moth. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Preparation and characterization of dsRNA / SPc nanocomplexes.

[0016] Figure 2 This is the protective effect of SPc on the stability of dsRNA.

[0017] Figure 3 Enhanced dsRNA delivery efficiency for SPc in cell lines.

[0018] Figure 4 This is a biological assay of the SPc / dsPopeACT complex solution.

[0019] Figure 5 This is the phylogenetic tree of actin genes. DETAILED DESCRIPTION

[0020] The specific embodiments of the present invention are described below to facilitate understanding of the present invention by those skilled in the art. However, it should be clear that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the appended claims, these changes are obvious, and all inventions and creations utilizing the concepts of the present invention are protected.

[0021] Example 1 Preparation of dsRed / SPc Nanocomposite

[0022] The nanocarrier SPc used in this example was provided by the College of Plant Protection, China Agricultural University.

[0023] In this example, dsRNA of the control gene Red was used to characterize the dsRNA / SPc nanocomplex. Based on the control gene Red CDS sequence (SEQ ID NO. 1), primers carrying a T7 promoter were designed for synthesizing dsRed (SEQ ID NO. 2). The nucleotide sequences of the upstream primer dsRed-F (SEQ ID NO. 3) and the downstream primer dsRed-R (SEQ ID NO. 4) are shown below:

[0024] dsRed-F (SEQ ID NO.3): TAATACGACTCACTATAGGGCTTCGCCTGGGACATCCTGT;

[0025] dsRed-R (SEQ ID NO. 4): TAATACGACTCACTATAGGGCCAGAGTCTTCTTCTGCATTACGG.

[0026] 1.1 Preparation and Characterization of dsRNA / SPc Nanocomplexes

[0027] 1000 ng / μL dsRNA was mixed with 1000 ng / μL SPc at a mass ratio of 4 / 1, 2 / 1, 1 / 1, 1 / 2, and 1 / 4, respectively. The mixture was incubated at room temperature for 30 min, and the binding was verified by 2% agarose gel electrophoresis.

[0028] In order to study the formation mechanism of nanopharmaceuticals, isothermal titration calorimetry (ITC) was used to analyze the binding mechanism between nanocarrier SPc and dsRNA.

[0029] The particle size and morphology of the nanoparticles were determined using a nanoparticle size analyzer and zeta potential analyzer, along with a scanning electron microscope. At room temperature, dsRNA and SPc were mixed uniformly at a mass ratio of 2:1 by pipetting and incubated for 30 minutes. 1 mL of each of the dsRNA solution, SPc solution, and dsRNA / SPc nanocomplex solution was pipetted into a quartz glass dish and placed on a nanoparticle size analyzer for particle size measurement. Another 10 μL was pipetted onto a silicon wafer, dried at room temperature, and then gold-sprayed for morphology observation under a scanning electron microscope.

[0030] 1.2 Protective effect of SPc on dsRNA stability

[0031] 1.2.1 RNase A protection treatment

[0032] 0, 2, 4, 8, 10, and 20 ng of RNase A were mixed with 1 μg of dsRNA (total volume 10 μL) and incubated in a metal bath at 37°C for 30 min. The degree of dsRNA degradation was observed by 2% agarose gel electrophoresis.

[0033] To investigate the protective effect of SPc on dsRNA, a completely biodegradable RNase A concentration of 1 μg dsRNA was used as the protective treatment condition. 200 ng, 400 ng, 600 ng, 800 ng, and 1000 ng of dsRNA / SPc complex were incubated at 37°C for 30 minutes. SDS solution was then added to the system to a final concentration of 0.1% to disaggregate the dsRNA / SPc complex. The complexes were then analyzed by 2% agarose gel electrophoresis. Band intensity was determined using ImageJ 1.8 software. Three biological replicates were performed for this experiment.

[0034] 1.2.2 Potato tissue fluid protection treatment

[0035] Take 0.5g of fresh potato leaves and grind them thoroughly under low temperature. Centrifuge at 12000rpm for 5min at 4℃. Aspirate the supernatant and centrifuge again to obtain potato tissue fluid.

[0036] 0 μL, 2 μL, 4 μL, 8 μL, and 10 μL of potato tissue fluid were mixed with 1 μg of dsRNA and incubated in a 25°C metal bath or at room temperature for 40 min. The degree of dsRNA degradation was observed by 2% agarose gel electrophoresis.

[0037] The stability protection effect of SPc on dsRNA was verified by using a plant tissue fluid concentration that could completely degrade 1 μg of dsRNA. Except for the reaction temperature and time, all other treatments were the same as in 1.2.1.

[0038] 1.2.3 Potato tuber moth digestive fluid protection treatment

[0039] Place 10 fourth-instar larvae of the potato tuber moth into a 1.5 mL centrifuge tube. Place the tube on ice and gently touch the larva's mouth with the tip of a pipette to stimulate the larva to expel intestinal fluid. Collect the intestinal fluid, centrifuge at 12,000 rpm, and remove the supernatant. Store at -20°C.

[0040] 1 μg of dsRNA was treated with 0 μL, 1 μL, 2 μL, 4 μL, 6 μL, 8 μL, and 10 μL of potato tuber moth intestinal fluid and incubated in a 25°C metal bath or at room temperature for 40 minutes. The degree of dsRNA degradation was observed by 2% agarose gel electrophoresis.

[0041] The stability protection effect of SPc on dsRNA was verified by using a concentration of intestinal fluid from the tuber moth that could completely degrade 1 μg of dsRNA. Except for the reaction temperature and time, all other treatments were the same as in 1.2.1.

[0042] 1.2.4 Potato tuber moth hemolymph protection treatment

[0043] Ten fourth-instar larvae of potato tuber moth were placed on ice. A small incision was made on the back of the larvae with scissors. Hemolymph was aspirated with a 10 μL pipette and transferred to a 1.5 mL centrifuge tube. The supernatant was collected by centrifugation at 12,000 rpm and stored at -20°C.

[0044] Other operations are the same as 1.2.3.

[0045] 1.3 SPc enhances dsRNA delivery efficiency in cell lines

[0046] The effect of nanocarrier SPc on improving the dsRNA delivery efficiency was investigated using the Spodoptera frugiperda sf9 cell line. TM dsRNA modified with a Cy3 red fluorescent group was synthesized using the T7 High Yield Cy3 RNA Labeling Kit. A solution containing 1 μg of fluorescent dsRNA / SPc complex was mixed with 500 μL of culture medium containing sf9 cells and incubated at 25°C for 30 minutes, 4 hours, 8 hours, and 12 hours. Fluorescent dsRNA and SPc solutions at equal concentrations served as controls. Cell uptake of the fluorescent dsRNA was observed under a laser scanning confocal microscope after preparation. Three biological replicates were performed for each treatment.

[0047] 2 Results and Analysis

[0048] 2.1 Preparation and characterization of dsRNA / SPc nanocomplexes

[0049] We determined the optimal binding ratio of nanocarrier SPc to dsRNA by gel electrophoresis to be dsRNA / SPc=2 / 1. We also determined the thermodynamic parameters of the binding of dsRNA to SPc by ITC and found that the binding coefficient Ka(M -1 ) is 9.448×10 7 The dissociation constant Kd(M) is 1.058×10 -8 , indicating that there is a strong interaction between the two. The entropy change ΔH of the binding reaction is -649.0kJ / mol, the enthalpy change ΔS is -2024J / mol·K, and the calculated Gibbs free energy ΔG of the binding reaction is -45.848kJ / mol. ΔG<0 indicates that the nanocarrier SPc and dsRNA can spontaneously bind through hydrogen bonds and van der Waals forces. At the same time, according to scanning electron microscopy results, the structure of SPc and dsRNA / SPc is spherical ( Figure 1 ); The particle size measurement results showed that the nanocarrier SPc can effectively reduce the particle size of dsRNA after binding with dsRNA (Table 1).

[0050] Table 1: Particle size of dsRNA / SPc nanocomplexes

[0051]

[0052] 2.2 Protective effect of SPc on dsRNA stability

[0053] We used RNase A, potato tissue fluid, potato tuber moth intestinal fluid, and hemolymph to find that the nanocarriers could effectively protect dsRNA from degradation in all four degradation treatments, and the molecular size and other properties did not change ( Figure 2 ).

[0054] 2.3SPc enhances dsRNA delivery efficiency in cell lines

[0055] We found that a small amount of fluorescent dsRNA not bound to the nanocarrier entered the sf9 cell line after 12 hours of treatment; while the cell line treated with the dsRNA / SPc nanocarrier complex could detect the presence of red fluorescent signal in the cells at 8 hours, and a large amount of red fluorescent signal could be detected in the cells at 12 hours ( Figure 3 ).

[0056] Example 2 Preparation of dsPopeACT Nanocomposite and Its Control Effect on Potato Tuber Moth

[0057] 1. Bioassay of SPc / dsRNA Complex Solution

[0058] Based on the CDS sequence of the PopeACT gene (SEQ ID NO.5), primers carrying a T7 promoter were designed for synthesizing dsRNA (SEQ ID NO.6). The nucleotide sequences of the upstream primer dsPopeACT-F (SEQ ID NO.7) and the downstream primer dsPopeACT-R (SEQ ID NO.8) are shown below:

[0059] dsPopeACT-F (SEQ ID NO. 7):

[0060] TAATACGACTCACTATAGGGGAGATGAGGCCCAGAGCAAA;

[0061] dsPopeACT-R (SEQ ID NO. 8): TAATACGACTCACTATAGGGGCCAAGTCCAGACGGAGGAT.

[0062] This example uses a gastric poisoning (feeding) treatment method. Target gene (dsPopeACT gene) dsRNA with a concentration of 1000 ng / μL was mixed with SPc with a concentration of 1000 ng / μL in a mass ratio of 2:1 to prepare a dsRNA solution with a concentration of 400 ng / μL.

[0063] Using a hole punch, potato tuber moth artificial diet was punched into 1.5 cm diameter rounds. The rounds were completely submerged in the dsPopeACT / SPc complex solution, removed, and air-dried. Once the surface of the artificial diet was slightly dry, newly hatched potato tuber moth larvae were inoculated onto the treated surface using a brush. Fresh artificial diet was replaced every 48 hours, and larval mortality was counted every 24 hours. This experiment used a solution of the target gene's dsPopeACT / SPc complex and a solution of dsPopeACT as treatments. The control gene, dsRed, was used as a control. Thirty larvae were isolated per treatment, with three biological replicates.

[0064] 2 Results and Analysis

[0065] The dsPopeACT was combined with the nanocarrier SPc to form a nanocomplex. The toxicity was tested by endotoxin assay. It was found that within 5 days, the nanocomplex had a nearly 100% lethality rate against newly hatched larvae of the potato tuber moth. Compared with non-nanoencapsulated dsRNA, the nanocomplex also had a better lethality effect on newly hatched larvae of the potato tuber moth ( Figure 4 ).

[0066] In summary, the present invention uses a nanocarrier SPc to load dsRNA of the potato tuber moth gene actin (PopeACT), creating a nanodrug delivery system that improves the stability and delivery efficiency of dsRNA in the potato tuber moth. This can significantly increase the mortality rate of newly hatched potato tuber moth larvae, contributing a new solution to the prevention and control of potato tuber moth and facilitating green control of potato tuber moth.

[0067] Example 3 Homology Comparison

[0068] The present inventors clustered the PopeACT gene of potato tuber moth with the ACT genes of other Lepidoptera insects and some Coleoptera, Hemiptera, Diptera, and Diptera insects and drew an evolutionary tree. They found that the branch spread value of the PopeACT gene of potato tuber moth was 86%, and the evolutionary distance from the ACT genes of other insects was relatively far ( Figure 5 ). This indicates that the PopeACT gene sequence of potato tuber moth has low homology with other insects.

[0069] The sequence sources are as follows:

[0070] Coleoptera: Potato beetle Leptinotarsa ​​decemlineata; Potato ladybird Henosepilachnavigintioctomaculata; Anoplophora glabripennis; Tribolium castaneum; Seven-spotted ladybird Coccinella septempunctata

[0071] Lepidoptera: Potato tuber moth Phthorimaea operculella; Cotton bollworm Helicoverpaarmigera; Japanese bagworm Eumeta japonica; Soybean borer Leguminivorella

[0072] Hemiptera: Pyrrhocoris apterus

[0073] Dionychia: Daphnia magna

[0074] Diptera: Anopheles albimanus.

Claims

1. A dsPopeACT for controlling potato tuber moth, characterized in that: The nucleotide sequence is shown in SEQ ID NO.6, and the gene is synthesized from the PopeACT gene shown in SEQ ID NO.5 and the dsRNA primers shown in SEQ ID NO.7 to SEQ ID NO.

8.

2. Use of the dsPopeACT according to claim 1 in the prevention and control of potato tuber moth.

3. A dsRNA nanocomplex, characterized in that The dsRNA nanocomplex comprises the dsPopeACT of claim 1.

4. The dsRNA nanocomplex according to claim 3, characterized in that The dsRNA nanocomplex further comprises a nanocarrier SPc.

5. The dsRNA nanocomplex according to claim 4, characterized in that The dsRNA nanocomplex is prepared from dsPopeACT with a concentration of 1000 ng / μL and nanocarrier SPc with a concentration of 1000 ng / μL, and the mass ratio of dsPopeACT to SPc is 2:

1.

6. Use of the dsRNA nanocomplex according to claim 3 in the prevention and control of potato tuber moth.

7. A method for controlling potato tuber moth, characterized in that: The substance that inhibits the expression of the PopeACT gene of the potato tuber moth is introduced into the potato tuber moth by feeding; the substance that inhibits the expression of the PopeACT gene of the potato tuber moth is the dsPopeACT according to claim 1.

Images