Corn PHD2 gene and application thereof in regulation and control of plant drought resistance

Abstract

The invention relates to a corn PHD2 gene and application of the corn PHD2 gene in regulation and control of plant drought resistance. Through overexpression of the PHD2 gene provided by the invention, the leaf withering degree of a transgenic plant under a drought treatment condition is lighter than that of a contrast, which indicates that the drought resistance of the plant can be remarkably improved through overexpression of the gene. A drought-resistant plant is obtained by adopting a transgenic overexpression technology, compared with a traditional breeding mode, the time is short, the purposiveness is strong, a gene resource is provided for cultivating and improving a new variety of the drought-resistant plant, and a theoretical basis is provided for clarification of a molecular mechanism of PHD2 in plant drought stress signal response.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering breeding, in particular to a corn PHD2 gene and its application in regulating plant drought resistance. Background Art

[0002] Corn is a major global food crop, accounting for approximately 36% of global grain production. With population growth and increasing food demands, the demand for corn is also increasing. China is a major corn producer in the world. Corn boasts high economic returns and significant production potential, and its cultivated area is increasing annually. It has become a vital source of food, feed, and industrial processing raw materials.

[0003] As the world's population continues to grow and living standards improve, the increasing scarcity of water resources is one of the major challenges facing global sustainable development. This challenge will become even more pressing as global warming exacerbates water scarcity.

[0004] The plant homeodomain (PHD) zinc finger protein family is a class of zinc finger transcriptional regulatory factors that are ubiquitous in eukaryotes. They can recognize various forms of histone modifications, including histone acetylation and methylation, and can also act as chromatin remodeling factors to regulate chromatin state. They are key molecules in regulating transcription and chromatin structure, and play an important role in plant growth and development.

[0005] Water shortages have an immeasurable impact on corn growth, development, and yield. Therefore, in the face of scarce freshwater resources, using genetic engineering to improve corn traits and enhance drought resistance is crucial for ensuring food security and sustainable development. While the structure and function of PHD zinc finger proteins have been extensively studied in animals, relatively little has been reported on their function in plants, particularly in relation to drought resistance. Summary of the Invention

[0006] In response to the shortcomings of the prior art, the present invention aims to provide a maize PHD2 gene and its use in regulating plant drought resistance. By overexpressing the PHD2 gene provided by the present invention, transgenic plants exhibited less leaf wilting under drought conditions than controls, demonstrating that overexpression of this gene can significantly improve plant drought resistance. This transgenic overexpression technology, which yields drought-resistant plants, is more efficient and time-efficient than traditional breeding methods. It provides genetic resources for cultivating and improving new drought-resistant plant varieties and offers a theoretical basis for elucidating the molecular mechanisms of PHD2 in plant drought stress signaling.

[0007] In order to achieve the above purpose, the technical solution adopted by the present invention is:

[0008] A corn PHD2 gene, characterized in that its nucleotide sequence is:

[0009] The sequence shown as SEQ ID No.1.

[0010] A corn PDH2 protein, characterized in that its amino acid sequence is:

[0011] (1) The sequence shown in SEQ ID No. 2 is encoded by the nucleotide sequence of the above-mentioned maize PHD2 gene.

[0012] An application of a corn PHD2 gene in plant drought resistance is characterized in that the application is used to breed drought-resistant plants by overexpressing the corn PHD2 gene in plants.

[0013] The corn PHD2 gene and its application in regulating plant drought resistance described in the present invention have the following beneficial effects:

[0014] (1) The transgenic plants overexpressing the PHD2 gene constructed in the present invention have significantly enhanced drought resistance, have better growth conditions under drought conditions, and have significantly reduced leaf wilting.

[0015] (2) Compared with traditional breeding methods, the method for breeding drought-resistant plants provided by the present invention has the advantages of short breeding time and strong purpose, which significantly shortens the cycle of drought-resistant breeding and improves the efficiency of drought-resistant breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] The present invention has the following accompanying drawings:

[0017] Figure 1 Comparative graph of plant growth after drought treatment between the control (ND101) and the PHD2 overexpressing strain in Example 3 of the present invention.

[0018] Figure 2 , the water loss phenotype of detached leaves of the control (ND101) and PHD2 overexpressing strains after drought treatment in Example 3 of the present invention. DETAILED DESCRIPTION

[0019] The present invention will be further described in detail below with reference to the accompanying drawings.

[0020] The maize PHD2 gene consists of 1,128 bases, with the T01 transcript's reading frame extending from bases 156 to 785 from the 5' end. The gene consists of one exon, one coding exon, with a reading frame extending from bases 1 to 630. The gene originates from the zheng58 maize strain and is registered in the maize genome database as Zm00001eb041990. Because the same DNA sequence in maize can produce different transcripts and translate into different proteins, the different transcripts and proteins produced by this sequence are all protected by this patent.

[0021] The nucleotide sequence of the PHD2 gene is shown in SEQ ID No. 1. Based on the nucleotide sequence disclosed in the present invention, this gene was overexpressed in maize using transgenic technology. Specifically, the technical solution of the present invention includes extracting total maize RNA, reverse transcribing it to obtain cDNA, amplifying the PHD2 gene using the cDNA as a template and primers F and R. The amplified product is then constructed into an overexpression vector based on the pBECXUN backbone and driven by the Ubi promoter. The resulting recombinant expression vector is named pBECXUN-PHD2. The vector is then transformed into Agrobacterium, and transformed seedlings are obtained by Agrobacterium infection of maize embryos. Positive plants are screened using herbicides or PCR. Transgenic plants are then self-pollinated to obtain T3 generations for drought treatment experiments. The PHD2 gene has more than one transcript, and overexpression of other transcript cDNAs may also confer drought resistance, and all of these are within the scope of protection claimed by the present invention. Specific detection experiments include measuring drought-related physiological indicators such as drought treatment during the seedling stage.

[0022] The following examples illustrate the present invention but do not limit its scope. The transcript used in these examples is T01, which serves only as an example and does not limit the editing sites in practice. Unless otherwise specified, all examples were conducted according to conventional experimental conditions or those specified in the product instructions.

[0023] The maize inbred line ecotype was ND101; the Agrobacterium strain was EHA105. Key reagents included restriction enzymes, DNA polymerase, and T4 ligase from biotechnology companies such as NEB and Toyobo; a reverse transcription kit from Thermo Fisher Scientific; an RNA extraction kit from Magen; and quantitative PCR reagents from Taraka. Plasmid extraction and DNA recovery kits were purchased from Tiangen. MS medium, agar powder, agarose, and antibiotics such as ampicillin, kanamycin, gentamicin sulfate, and rifampicin were purchased from Sigma. All other chemical reagents used in the examples were imported or domestically produced analytical grade. Primer synthesis and sequencing were performed by Yingjun Biotechnology.

[0024] Example 1, Construction and Detection of PHD2 Gene Overexpression Vector

[0025] To study the molecular mechanism of PHD2 family proteins in plant drought resistance, total RNA was extracted from zheng58 maize (Zea mays L.) and reverse transcribed to obtain cDNA. The PHD2 gene was amplified using cDNA as a template and primers F and R with restriction enzyme sites. After enzyme digestion, the primers were ligated to the overexpression vector.

[0026] Vector construction method:

[0027] (1) Total RNA from zheng58 maize was extracted using the RNA extraction kit from Magen. The specific steps were as per the kit instructions.

[0028] (2) Use the reverse transcription kit from Thermo Corporation to reverse transcribe RNA into cDNA. For specific steps, refer to the kit instructions.

[0029] (3) Using cDNA as template and primers F and R, amplify the PHD2 gene cDNA. The amplified product was run on electrophoresis and gel-cut to recover the product. The recovery method was similar to the kit of Tiangen Company.

[0030] The primers used were:

[0031] Upstream primer F: ATGGTGAGGATGAAGCAGGTAAA (SEQ ID No. 3)

[0032] Downstream primer R: AGAATTTTGATGAAGTGGCATATACATTTG (SEQ ID No. 4)

[0033] (4) The recovered PHD2 gene cDNA and pBCXUN vector were double-digested with Xba I and Cla I, and the digestion products were recovered by electrophoresis and gel cutting. The recovered products were ligated with T4 ligase. The PHD2 gene was ligated to the pBCXUN vector (the pBCXUN vector uses the commercial vector pCAMBIA1300 as the backbone, and the hygromycin resistance gene hpt is replaced with the herbicide resistance gene barM; at the same time, the promoter of the maize ubiquitin gene Ubi is cloned into the vector by enzyme digestion and ligation to drive the transcription of the downstream overexpressed gene), and the Ubi promoter was used to drive the expression of the PHD2 gene.

[0034] (5) Take 5 μL of the product from the enzyme digestion-ligation system and transform it into competent E. coli. Screen on LB plates containing 50 μg / mL kanamycin. Identify single clones by colony PCR and select positive clones for sequencing. The recombinant expression vector obtained with correct sequencing was named pBCXUN-PHD2. The universal primers for colony PCR and sequencing are as follows:

[0035] UbiP-seq:TTTTAGCCCTGCCTTCATACGC(SEQ ID No.5)

[0036] NosR-seq:AGACCGGCAACAGGATTCAATC. (SEQ ID No.6)

[0037] Example 2, Construction and Detection of PHD2 Gene Overexpression Plants

[0038] The pBCXUN-PHD2 overexpression plasmid constructed in Example 1 was transformed into the competent Agrobacterium EHA105 strain by the heat shock method, and the positive clones were identified by colony PCR. The correctly identified single Agrobacterium colony was inoculated into 2-3 mL of liquid culture medium containing 100 μg / mL kanamycin and 50 μg / mL rifampicin, cultured overnight at 28°C, and transferred to a large amount of liquid culture medium containing antibiotics for shaking culture the next day. After several transfers, the bacteria were collected and resuspended to an OD600 between 0.8 and 1.0. The obtained recombinant Agrobacterium suspension was used to infect the ND101 maize immature embryos dug out under sterile conditions, and callus was induced to form seedlings. After self-pollination, the transgenic plants were obtained to obtain the T3 generation for subsequent experiments. RNA of different transgenic inbred lines was extracted, cDNA was reverse transcribed, and quantitative PCR was used to detect transgenic overexpression.

[0039] Example 3: Drought Phenotype Detection of PHD2 Gene Overexpressing Maize

[0040] Add 100g of soil to each small pot and water to the tray. Place 4 seeds in each small pot and cover with 30g of soil. Once the pot is fully saturated with water, discard the remaining water in the tray. After seedlings emerge, remove any unevenly growing seedlings. Add 1L of water to the tray and, once fully saturated, discard the water. Start drought treatment and observe the drought phenotypes of the control and transgenic plants. Repeat with 2 pots each for the control and transgenic plants. Figure 1 The results showed that the transgenic plants overexpressing PHD2 grew better than ND101 (control) and had lower leaf wilting than ND101, indicating that the transgenic plants were more drought-resistant than the control.

[0041] like Figure 2 As shown, the horizontal axis represents the time after the leaf is detached, and the vertical axis represents the water loss rate after the leaf is detached. It can be found that at each time point on the horizontal axis, the vertical axis value of ND101 (control) (water loss rate of 49.0% after 6 hours of detachment) is higher than the vertical axis value of PHD2 overexpression lines PHD2-OE1, PHD2-OE2, and PHD2-OE3 (average water loss rate of 42.6% after 6 hours of detachment). Therefore, the water loss rate of ND101 in detached leaves is faster than that of the PHD2 overexpression lines, and the drought resistance of the PHD2 overexpression lines is better than that of the control.

[0042] While the present invention has been described in detail above using general descriptions and specific embodiments, modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to fall within the scope of protection claimed herein.

[0043] The contents not described in detail in this specification belong to the prior art known to those skilled in the art.

Claims

1. A corn PHD2 gene, characterized in that: Its nucleotide sequence is: The sequence shown as SEQ ID No.

1.

2. A corn PDH2 protein, characterized in that Its amino acid sequence is: The sequence shown in SEQ ID No. 2 is encoded by the nucleotide sequence according to claim 1.

3. The use of a corn PHD2 gene in plant drought resistance according to claim 1, characterized in that: The application is used to breed drought-resistant plants by overexpressing the corn PHD2 gene in plants.

Images