Application of potato StPELP gene in late blight resistance improvement
By overexpressing the StPELP gene in potatoes and rice, the problem of lack of broad-spectrum resistance genes in the existing technology was solved, significantly improving resistance to late blight, gray mold and rice blast, and increasing yield without affecting growth.
Patent Information
- Application Number
- CN202510809455.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-17
- Publication Date
- 2025-09-16
AI Technical Summary
The existing technology lacks key target genes that can significantly improve the broad-spectrum resistance of potatoes and rice to late blight and other diseases, resulting in poor resistance improvement results in breeding.
By overexpressing the potato StPELP gene in potatoes and rice, we can utilize its function of regulating broad-spectrum resistance to enhance resistance to oomycete diseases and fungal diseases, stimulate the plant's basal immune response, and heterologously overexpress the StPELP gene in rice to improve resistance to rice blast.
It significantly improved the resistance of potatoes to late blight and gray mold, and enhanced the resistance to rice blast in rice. At the same time, it had no adverse effect on potato growth and development, and even increased tuber yield.
Smart Images

Figure CN120648706A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of plant bioengineering, and particularly relates to application of potato StPELP gene in improving late blight resistance. Background Art
[0002] Late blight, caused by the fungus Phytophthora infestans, is one of the most devastating diseases in potato production. The disease develops rapidly and is highly devastating, causing annual yield losses of 10%-20%, and in epidemic years, up to 50%-70% or even complete crop failure. Breeding new varieties with broad-spectrum and durable resistance to late blight is a global challenge that potato breeding urgently needs to address.
[0003] To improve potato resistance to late blight, breeders have screened and identified material carrying resistance genes (R) from wild Solanum species, such as Solanum dimissum (Park et al., 2009). These R genes are then introduced into cultivated potato varieties through conventional hybridization, somatic cell fusion, and genetic engineering, hoping to develop long-lasting resistance. Currently, several late blight resistance genes have been successfully cloned, including RB / Rpi-blb1, Rpi-blb2, Rpi-blb3, Rpi-blb4, Rber, Rpi1, Rpi-mcq1, and Rpi-vnt1.1. Among these, Rpi-blb1, Rpi-blb2, Rpi-blb3, Rpi-vnt1, and Rpi-amr1 have been successfully introduced into cultivated varieties. However, late blight pathogens can quickly adapt and overcome these resistance genes. However, in the process of co-evolution with pathogens, plants have also evolved a basic defense system that is independent of pathogen species and has a defensive effect against a variety of diseases. By regulating the expression of genes involved in the basic defense response, it is theoretically possible to improve the plant's long-lasting and broad-spectrum resistance.
[0004] PELP1 (proline-, glutamate-, and leucine-rich protein 1) is a multidomain protein named for its rich proline, glutamate, and leucine residues. It functions as a multifunctional regulatory factor in animal cells, participating in and regulating a wide range of biological processes and signaling pathways. PELP1 possesses a unique structure, containing motifs and domains common to many transcriptional regulatory factors. Its N-terminus contains 10 LXXLL nuclear receptor interaction motifs, three PxxP motifs, and a nuclear localization signal. PELP1 also contains a cysteine-rich region that may form zinc fingers and a glutamate-rich region at the C-terminus. Human PELP1 not only interacts with the estrogen receptor (ER) but also functions as a coactivator for multiple nuclear transcription factors. Furthermore, studies have suggested that human PELP1 may be a potential oncogene, with dysregulated expression in various hormone-driven tumors. PELP1 can perform multiple biological functions, including ER-mediated genomic and non-genomic signaling, cell cycle regulation, chromatin modification, histone modification, DNA damage response, RNA splicing, ribosome biogenesis, and other neural functions. Proteins annotated as PELP also exist in plants, and their structures are relatively conserved, but their specific functions in plants are unknown, and there are no reports of PELP proteins functioning in plant immunity.
[0005] Problems with the existing technology: Currently, some resistance defense genes have been discovered in potatoes, but in breeding practice, there is still a lack of key target genes that can effectively provide broad-spectrum resistance in improving late blight resistance and other disease resistance. There are no reports in the existing technology on the application of the potato StPELP gene in improving late blight resistance. Based on this, the key technical problem to be solved by the present invention is to discover through systematic research that overexpression of a potato gene StPELP in potatoes can significantly improve potato resistance to the oomycete disease late blight and the fungal disease gray mold; at the same time, heterologous overexpression of the potato StPELP gene in rice significantly improved rice resistance to the fungal disease rice blast. The study revealed that StPELP is a target gene that regulates broad-spectrum resistance, providing a key target gene with important utilization value for improving potato late blight resistance and other plant disease resistance. Summary of the Invention
[0006] In view of the deficiencies in the prior art, the present invention provides the application of potato StPELP gene in improving late blight resistance.
[0007] In order to achieve the above object, the present invention adopts the following technical solutions:
[0008] 1. Potato StPELP gene, the StPELP gene ID is Soltu.DM.11G006380.1, and the CDS sequence is shown in the sequence listing SEQ No. 1.
[0009] 2. Potato StPELP protein, the StPELP protein comprises 852 amino acids, and the amino acid sequence is shown in SEQ No. 2 in the sequence listing.
[0010] 3. A method for verifying the late blight resistance function of the potato StPELP gene comprises the following steps:
[0011] (1) Analysis of StPELP gene expression patterns, (2) StPELP gene cloning and vector construction, (3) Genetic transformation of potato and detection of transgenic plants, (4) Analysis of overexpression of StPELP in potato to enhance resistance to the oomycete disease late blight, (5) Overexpression of StPELP in potato to enhance resistance to the fungal disease gray mold, (6) Genetic transformation of StPELP in rice and detection of transgenic plants, (7) Overexpression of StPELP in rice improves resistance to rice blast, (8) Overexpression of StPELP stimulates basal immune response in plants, (9) Overexpression of StPELP in potato has no adverse effects on growth and development.
[0012] 4. Application of overexpressing the StPELP gene to enhance resistance to late blight in potatoes. The CDS sequence of the StPELP gene is shown in SEQ No. 1 in the sequence listing.
[0013] 5. Application of overexpressing the StPELP gene to enhance resistance to the fungal disease gray mold in potatoes. The CDS sequence of the StPELP gene is shown in SEQ No. 1 in the sequence listing.
[0014] 6. Application of overexpressing StPELP gene to enhance rice blast resistance, wherein the CDS sequence of the StPELP gene is shown in SEQ No. 1 in the sequence listing.
[0015] 7. Application of overexpressing StPELP gene to stimulate reactive oxygen species burst and activate immune response. The CDS sequence of the StPELP gene is shown in SEQ No. 1 in the sequence listing.
[0016] 8. Application of overexpressing StPELP gene to increase potato tuber yield, wherein the CDS sequence of the StPELP gene is shown in SEQ No. 1 in the sequence listing.
[0017] Preferably, overexpression of the StPELP gene has no significant effect on potato growth and development.
[0018] Beneficial Effects: This invention reports the function of the PELP protein in plants for the first time. Overexpression of the potato StPELP gene in potatoes was found to significantly improve resistance to the oomycete disease late blight and the fungal disease gray mold. Furthermore, heterologous overexpression of StPELP in rice can improve resistance to the fungal disease rice blast. Overexpression of StPELP in potatoes has no adverse effects on the growth and development of potato plants, and overexpression of StPELP can also increase potato tuber yield. Therefore, this invention has discovered an important gene, StPELP, that can enhance broad-spectrum disease resistance in plants. It can serve as a target gene for disease-resistant breeding and has great potential application value in improving broad-spectrum plant resistance. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 This is the result of StPELP induced expression in response to late blight pathogen.
[0020] Figure 2 Expression detection results of OE-StPELP and StPELP-RNAi transgenic potato lines. A. PCR detection of OE-StPELP transgenic lines (5, 6, 8, 9, and 10 are positive lines); WT ('E3') is a non-transgenic control line. B. qRT-PCR detection of StPELP relative expression in OE-StPELP transgenic lines (ANOVA, three biological replicates, p < 0.001). C. PCR detection of StPELP-RNAi transgenic lines (2, 3, and 4 are positive lines); WT (E3) is a control line. (D) qRT-PCR detection of StPELP relative expression in StPELP-RNAi transgenic potato lines (ANOVA, three biological replicates, *p < 0.05, **p < 0.01).
[0021] Figure 3Results of analysis of StPELP-enhanced resistance to late blight in potato. A. Representative inoculation images demonstrate that overexpression of StPELP significantly inhibits the colonization of late blight. Bar = 1 cm. B. Box plots demonstrate that lesion area on leaves of OE-StPELP transgenic potatoes was significantly reduced compared to the 'E3' control (ANOVA, three biological replicates, p < 0.001, n ≥ 30). C. Bar graph demonstrates that the number of spores collected from inoculated leaves of OE-StPELP transgenic potatoes was significantly reduced compared to the 'E3' control (ANOVA, four biological replicates, p < 0.001, n = 9). D. Representative inoculation images demonstrate that interfering with StPELP significantly promotes the colonization of late blight. Bar = 1 cm. E. Box plots demonstrate that lesion area on leaves of StPELP-RNAi transgenic potatoes was significantly increased compared to the 'E3' control (ANOVA, three biological replicates, p < 0.001, n ≥ 30). F. Bar graph showing that the number of spores collected from inoculated leaves of StPELP-RNAi transgenic potatoes was significantly increased compared to the 'E3' control (ANOVA, four biological replicates, p<0.001, n=9).
[0022] Figure 4 StPELP enhances resistance to gray mold in potato. A. Representative inoculation images show that overexpression of StPELP significantly inhibits colonization of gray mold. Bar = 1 cm. B. Box plots show that lesion area on leaves of StPELP-OE transgenic potatoes was significantly reduced compared to the 'E3' control (ANOVA, three biological replicates, p < 0.001, n ≥ 30).
[0023] Figure 5 Results of target gene expression testing in StPELP-OE transgenic rice lines. A. Detection of StPELP-OE transgenic lines. B. qRT-PCR analysis of relative StPELP expression in StPELP-OE transgenic rice lines (ANOVA, three biological replicates, p < 0.001).
[0024] Figure 6 StPELP enhances rice blast resistance. A. Representative inoculation images demonstrate that overexpression of StPELP significantly inhibits the colonization of rice leaves by the blast pathogen. B. Box plots show that the lesion area of StPELP-OE transgenic rice lines was significantly reduced compared to the WT control (ANOVA, three biological replicates, p < 0.001, n ≥ 10). C. Bar graphs show that the number of blast pathogen hyphae in leaves of StPELP-OE transgenic rice plants was significantly reduced compared to the WT control (ANOVA, three biological replicates, p < 0.001, n = 3).
[0025] Figure 7 Analysis of StPELP-induced reactive oxygen species (ROS) burst and INF1-induced cell death. A. After flg22 induction, the ROS burst in leaves of the OE-StPELP transgenic potato line was greater than that of the control 'E3' line. Leaves were treated with 10 μM flg22 before ROS detection. RUL, relative luminescence unit. B. Images show the magnitude of cell death induced by StPELP alone or co-injected with HA-EV and INFI. StPELP promotes INF1-induced HR. Images were taken under natural light 40, 52, and 60 hours after Agrobacterium infection. Trypan blue staining is shown in the lower right corner of the image.
[0026] Figure 8 Phenotypes and yield results of OE-StPELP-stable potato plants. A. Representative plant phenotypes of the potato control 'E3' and OE-StPELP lines. Bar = 5 cm. B. Histogram showing that, compared with the 'E3' control, plant heights of OE-StPELP-5 and OE-StPELP-9 were significantly increased among the OE-StPELP transgenic lines. Other lines (OE-StPELP-6 and -8) showed no significant differences from the control (ANOVA, *p < 0.05, **p < 0.01, n = 6). C. Bar graph showing that compared to the 'E3' control, transgenic potato lines OE-StPELP-5 and OE-StPELP-9 had significantly increased yield per plant when grown in greenhouses, while lines OE-StPELP-6 and OE-StPELP-8 showed no significant differences (ANOVA, *p<0.05, **p<0.01, n=6). D. Bar graph showing that compared to the control, lines OE-StPELP-5 and OE-StPELP-9 had significantly increased tuber number per plant when grown in greenhouses, while lines OE-StPELP-6 and OE-StPELP-8 showed no significant differences (ANOVA, *p<0.05, n=6). E. Schematic diagram of tubers per plant in 'E3' and OE-StPELP potato lines. Bar = 5 cm.
[0027] Figure 9 Figure 2 is the CDS sequence of the StPELP gene, with the start and stop codons underlined. DETAILED DESCRIPTION
[0028] The present invention will be described in detail below with reference to the accompanying drawings and specific examples, but they should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.
[0029] Example 1
[0030] This example provides the potato StPELP gene, such as Figure 9 As shown in SEQ No. 1 in the sequence listing, the CDS sequence of the StPELP gene contains 2559 bp of nucleotides and encodes 852 amino acids (SEQ No. 2). The potato StPELP gene ID is Soltu.DM.11G006380.1.
[0031] Example 2
[0032] This example provides a verification method and results for verifying that the StPELP gene has late blight resistance function, as follows:
[0033] 1. Analysis of StPELP gene expression patterns
[0034] In a study of gene expression in potato in response to infection with late blight pathogen (P. infestans), we used fluorescence quantitative PCR (qRT-PCR) technology to find that an unknown functional gene StPELP in potato was induced by late blight pathogen and showed an upward trend after infection with late blight pathogen, reaching a peak at 48 hours ( Figure 1 ).
[0035] 2. StPELP gene cloning and vector construction
[0036] Amplification primers were designed based on the coding region sequence of the gene (2559 bp):
[0037] HA-StPELP-F:ATTACGCCGAGGTCATGGCGGCCTCTGATACAATG;
[0038] HA-StPELP-R:TAGGGAAGAGGTTAATCAGAATCGGGCTCAACATCA.
[0039] The full-length CDS sequence of this gene was amplified using reverse-transcribed cDNA extracted from RNA from the potato variety 'Emalingshuhao 3' as a template. The PCR reaction system consisted of 2 μl (100 ng) of template cDNA, 2 μl (10 μM) of each forward and reverse primer, 1 μl (10 mM) of dNTP Mix, 1 μl of Phanta Max Super-Fidelity DNA Polymerase, 25 μl of 2× Phanta Max Buffer, and ddH2O to a final volume of 50 μl. The reaction procedure was as follows: 95°C for 5 min; 35 cycles of 95°C for 20 s, 58°C for 20 s, and 72°C for 90 s; and 72°C for 10 min. The resulting PCR fragment was recovered using the Magen HiPure Gel Pure DNA Mini Kit.
[0040] Construction of transient expression vector: The gene fragment and the HA-pH7LIC vector after enzyme digestion were recovered and recombined using Novagen recombinase to construct the HA-StPELP fusion expression vector; the fusion vector plasmid HA-StPELP was then transformed into Agrobacterium GV3101 by electroporation for later use.
[0041] Construction of plant interference expression vector: The StPELP gene sequence was analyzed using the Spud DB Search website. A specific fragment of 300 bp suitable for constructing an interference vector was found on the StPELP gene sequence and named StPELP-RNAi. Primers were designed:
[0042] RNAi-F:5'-TTTGGAGAGGACACGCTCGAGATGGCGGCCTCTGATACAAT-3'
[0043] RNAi-R:5'-TGGGGTACCGAATTCCTCGAGATCAACTTTTCATCAGATTCCGGTG-3'
[0044] PCR amplification was performed using the HA-StPELP plasmid as a template to obtain the target fragment. This fragment was then constructed using Gateway recombination into the pHellsgate8 interference vector, generating the interference vector pHellsgate8-StPELP-RNAi. This interference vector was then transformed into Agrobacterium tumefaciens LBA4404 by electroporation. The vector was then stored at -80°C with 50% glycerol until ready for use.
[0045] 3. Potato genetic transformation and transgenic plant detection
[0046] Potato genetic transformation: Thin slices of potato cultivar 'Emalingshu 3' (hereafter referred to as 'E3') were used as explants. Transformation was performed using Agrobacterium tumefaciens, following the steps described in Si et al. (2003). The potato slices and Agrobacterium were co-cultured on P1 medium for two days. Resistant shoots were cultured on selection medium P2. When resistant shoots grew larger than 0.5 cm on selection medium (containing kan), they were excised and transferred to rooting medium P3 containing the selection antibiotic kan and cephalosporin (cef) for rooting, ultimately obtaining complete plants. Transformation media are shown in Table 1.
[0047] Table 1 Potato genetic transformation medium
[0048]
[0049] Detection of transgenic positive lines: The transgenic lines obtained were positively identified by PCR, and the results showed that OE-StPELP-5, 6, 8, 9 and 10 were positive lines ( Figure 2 A). qRT-PCR was used to detect the expression of StPELP in the above positive strains, and finally the strains with higher excess expression of OE-StPELP-5, 6, 8 and 9 were selected for subsequent experiments ( Figure 2 B). In addition, this study used pHellsgate8 vector-mediated transgenic interference technology to interfere with StPELP in potato 'E3' material. PCR was used to identify the positive transgenic lines obtained, and the detection found that StPELP-RNAi-2, 3, and 4 were positive lines ( Figure 2 C). The expression of StPELP in the above positive strains was detected by qRT-PCR, and it was found that the silencing efficiency of StPELP reached more than 60% ( Figure 2 D), StPELP-RNAi-2, 3, and 4 strains were subsequently used for inoculation and identification.
[0050] 4. Overexpression of StPELP in potatoes enhances resistance to the oomycete disease late blight
[0051] OE-StPELP transgenic potato seedlings were grown in plastic pots in an isolated plastic greenhouse. Potato plants were grown for about 6 weeks and used for inoculation experiments. The third and fourth fully expanded compound leaves below the top of four robust OE-StPELP transgenic potato lines were collected and inoculated with late blight pathogen HB09-14-2. Lesion area was measured four days after inoculation. Results showed that the lesion area and spore count on leaves overexpressing StPELP were significantly smaller than those on the wild-type control 'E3' ( Figure 3 AC); the lesion area and spore number on StPELP-RNAi leaves were significantly greater than those in the wild-type control 'E3' ( Figure 3 DF). This indicates that StPELP positively regulates potato late blight resistance.
[0052] 5. Overexpression of StPELP in potatoes enhances resistance to the fungal disease Botrytis cinerea
[0053] To verify whether OE-StPELP transgenic potatoes have broad-spectrum resistance, leaves from four OE-StPELP transgenic potato lines were inoculated with the fungus Botrytis cinerea. The sporangium concentration used for inoculation was 10 5 Spores / mL were used, and at least 10 leaves of each strain were inoculated each time (repeated three times or more). The lesion area was measured 3 days after inoculation. The results showed that the lesion area on the leaves overexpressing StPELP was significantly smaller than that on the wild-type control 'E3' ( Figure 4A, B), indicating that StPELP is regulating potato resistance to gray mold.
[0054] 6. Genetic transformation of rice StPELP gene and detection of transgenic plants
[0055] To further investigate whether StPELP possesses broad-spectrum disease resistance in monocots, we conducted experiments in rice. We constructed the full-length StPELP construct into the pBWA(V)HS vector, generating the pBWA(V)HS-3×flag-StPELP fusion expression vector. This construct was then transformed into the rice 'kitaake' variety via Agrobacterium tumefaciens. Rice transformation was performed by Wuhan Boyuan Biotechnology Co., Ltd. using the following method:
[0056] Select rice grains without mold spots and with normal buds, disinfect them with 75% alcohol for 1 minute, rinse with sterile water for 1 minute each time, disinfect them with 15% sodium hypochlorite for 20 minutes, and rinse with sterile water 3 times for 1 minute each time. Inoculate the disinfected rice grains into the induction medium and culture them under light at 26°C for 20 days. Then, pick Agrobacterium and place it in the infection solution to prepare the OD value. 600 = 0.2 Agrobacterium suspension, pick callus into a triangular flask, add Agrobacterium suspension, infect for 10-15 minutes, discard the bacterial solution, inoculate the callus into co-cultivation medium, and co-cultivate at 20℃ for 48-72 hours. Perform callus screening by inoculating the above callus into screening medium and incubating in the dark at 26℃ for 20-30 days. Then, inoculate positive callus into secondary screening medium. During callus selection, be sure to select single clones of callus and incubate in the dark at 26℃ for 7-10 days. Finally, perform differentiation and rooting. Inoculate positive callus into differentiation medium and incubate at 25-27℃ in the light for 15-20 days. After differentiation of 2-5 cm shoots, inoculate into rooting medium and incubate at 30℃ in the light for 7-10 days.
[0057] The obtained transgenic lines were positively identified by PCR, and the results showed that StPELP-OE-1, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 19 and 20 were positive lines ( Figure 5 A). qRT-PCR was used to detect the expression of StPELP in the above positive strains, and finally the strains with higher excess expression of StPELP-OE-8, 13 and 20 were selected for subsequent experiments ( Figure 5 B).
[0058] 7. Overexpression of StPELP in rice improves blast resistance
[0059] Three StPELP-overexpressing rice lines were selected and cultured to four leaves and one heart. The rice blast fungus EA18 was used to infect the leaves of the StPELP transgenic rice lines and the wild type. First, the 6-week-old leaves of the wild type 'kitaake' (WT), StPELP-OE-8, StPELP-OE-13 and StPELP-OE-20 were inoculated with the rice blast fungus EA18 by the punch method. The leaf phenotype was observed after 14 days, and the lesion area was measured using ImageJ software to calculate the lesion area. The results showed that compared with the wild type WT, the lesion area of the three rice transgenic lines of StPELP-OE-8, StPELP-OE-13 and StPELP-OE-20 was significantly reduced, indicating that the transgenic lines had significantly enhanced resistance to rice blast ( Figure 6 In addition, the biomass of rice blast fungus was detected, showing that the biomass of rice blast fungus on leaves of the three overexpression lines StPELP-OE-8, StPELP-OE-13, and StPELP-OE-20 was significantly greater than that of the control WT ( Figure 6 C) The above results indicate that heterologous overexpression of the StPELP gene in rice can enhance resistance to the fungal disease rice blast.
[0060] 8. Overexpression of StPELP stimulates plant basal immune response
[0061] To explore the potential mechanism by which StPELP positively regulates disease resistance, we measured the total reactive oxygen species (ROS) levels in potato control 'E3' and transgenic lines OE-StPELP-5, OE-StPELP-6, and OE-StPELP-8 induced by the bacterial flagellin core peptide flg22. The results showed that the burst levels of reactive oxygen species in OE-StPELP-5, OE-StPELP-6, and OE-StPELP-8 transgenic lines were higher than those in the control 'E3', indicating that StPELP plays an important role in stimulating the ROS burst. Figure 7 A).
[0062] INF1 is an elicitor secreted by late blight pathogen that can stimulate immune responses and induce hypersensitivity reactions (HR) in Nicotiana benthamiana. Studies have found that transient overexpression of StPELP and INF1 in Nicotiana benthamiana can significantly promote the HR process induced by INF1. Figure 7 B). This indicates that StPELP can promote INF1-mediated immune responses.
[0063] 9. Overexpression of StPELP in potatoes has no adverse effects on growth and development
[0064] To investigate whether overexpression of StPELP affects potato growth and development, OE-StPELP transgenic lines were planted in a greenhouse and their plant phenotypes were observed after 6 weeks. The results showed that the plant height of OE-StPELP-5 and OE-StPELP-9 lines was significantly increased compared with the control 'E3', while OE-StPELP-6 and OE-StPELP-8 showed no significant difference compared with the control 'E3' ( Figure 8 A, B).
[0065] In order to verify the effect of StPELP on potato tuber characteristics, the weight of tubers per plant and the number of tubers per plant were measured under greenhouse pot cultivation conditions. After the harvest of the transgenic lines grown in the greenhouse, the tubers were first placed in a ventilated and cool place to dry the surface moisture of the tubers, and the surface soil and debris were removed, and the weight of 5 individual tubers was weighed. According to the statistical results, the control plant 'E3' had a single tuber weight of about 520g, and the transgenic lines OE-StPELP-5, OE-StPELP-6, OE-StPELP-8 and OE-StPELP-9 were about 678g, 433g, 446g and 693g respectively. Among them, the average single tuber weight of the over-produced transgenic lines OE-StPELP-5 and OE-StPELP-9 was significantly higher than that of the control material 'E3' ( Figure 8 C). In addition, the effect of StPELP on the number of potato tubers was statistically analyzed. The results showed that the control 'E3' had about 10 tubers per plant, while the OE-StPELP-5, OE-StPELP-6, OE-StPELP-8 and OE-StPELP-9 transgenic lines had about 18, 15, 16 and 17 tubers per plant, respectively. Among them, the average number of tubers per plant of the overexpressing transgenic lines of OE-StPELP-5, OE-StPELP-8 and OE-StPELP-9 was significantly higher than that of the control material 'E3'. The above results indicate that overexpression of StPELP can increase potato tuber yield to a certain extent ( Figure 8 D, E).
[0066] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes preferred embodiments. Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they are aware of the basic creative concepts. Therefore, the attached claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention. Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.
[0067] Main references:
[0068] Chang Guijiang. Strategic transformation of national food security and response to the development of Guangxi potato industry. Agricultural Economics, 2020, (05): 3-5. Jin Liping, Shi Ying, Gao Mingjie, Xu Jianfei and Luo Qiyou.
[0069] The development path of China's potato industry based on the perspective of big food. Potato industry and big food. Proceedings of the 25th China Potato Conference, 2024
[0070] Berindean IV,Taoutaou A,Rida S,Ona AD,Stefan MF,Costin A,Racz I,Muntean L.Modern breeding strategies and tools for durable late blightresistance in potato.Plants(Basel).2024,13:1711
[0071] CDC.The Potato,then and now.Canada's Digital Collections archived byLibrary and Archives Canada.1999
[0072] Foster SJ,Park TH,Pel M,Brigneti G,Sliwka J,Jagger L,van der VossenE,Jones JD.Rpi-vnt1.1,a Tm-2(2)homolog from Solanum venturii,confersresistance to potato late blight.Mol Plant Microbe Interact,2009,22:589-600
[0073] Fry W.Phytophthora infestans:the plant(and R gene)destroyer.Mol PlantPathol.2008,9:385-402
[0074] Fry WE,Birch PR,Judelson HS,Grünwald NJ,Danies G,Everts KL,Gevens AJ,Gugino BK,Johnson DA,Johnson SB,McGrath MT,Myers KL,Ristaino JB,Roberts PD,Secor G,Smart CD.Five reasons to consider Phytophthora infestans a reemergingpathogen.Phytopathology.2015,105:966-81
[0075] Hoekstra R.International year of the potato.Biodiversity Newsletterfor Europe,2008.
[0076] Kamoun S,Furzer O,Jones JD,Judelson HS,Ali GS,Dalio RJ,Roy SG,SchenaL,Zambounis A,Panabières F,et al.The Top 10oomycete pathogens in molecularplant pathology.Mol Plant Pathol.2015,16:413-434
[0077] Li J,Kaur A,Harrower B,Armstrong M,Dou D,Wang X,Hein I.Identificationand mapping of Rpi-blb4 in diploid wild potato species Solanumbulbocastanum.Crop J,2023,11:1828-1835
[0078] Paluchowska P, J,Yin Z.Late blight resistance genes in potatobreeding.Planta.2022,255:127
[0079] Park TH,Gros J,Sikkema A,Vleeshouwers VG,Muskens M,Allefs S,JacobsenE,Visser RG,van der Vossen EA.The late blight resistance locus Rpi-bib3 fromSolanum bulbocastanum belongs to a major late blight R gene cluster onchromosome 4 of Plant Microbe. Interact,2005,18:722-729
[0080] Park TH,Vleeshouwers VGAA,Jacobsen E,Vossen EVD,Visser RGF.Molecular breeding for resistance to Phytophthora infestans(mont.)de bary in potato(Solanum tuberosum L.):a perspective of cisgenesis.Plant Breeding,2010,128(179):179(179).
[0081] Pel MA,Foster SJ,Park TH,Rietman H,van Arkel G,Jones JD,Van Eck HJ,Jacobsen E,Visser RG,Van der Vossen EA.Mapping and cloning of late blightresistance genes from Solanum venturii using an interspecific candidate gene approach.Mol Plant Microbe Interact,2009,22:601-615
[0082] Portieles R, Ayra C, Gonzalez E, Gallo A, Rodriguez R, Chacón O, López Y, Rodriguez M, Castillo J, Pujol M, Enriquez G, Borroto C, Trujillo L, Thomma BP, Borrás-Hidalgo O. NmDef02, a novel antimicrobial gene isolated from Nicotianamegalosiphon confers high-level pathogen resistance under greenhouse and field conditions. Plant Biotechnol J, 2010, 8:678-90
[0083] Qi Y,Wu J,Yang Z,Li H,Liu L,Wang H,Sun X,Wu X,Nie J,Zhou J,Xu M,Wu defense.Nat Plants,2024,10:1576-1591
[0084] Qu L,Huang X,Su X.Zhu G,Zheng L,Lin J,Wang J,Xue H.Potato:fromfunctional genomics to genetic improvement.Mol Horticulture,2024,4,34
[0085] Seok-Jun M,Ardales EY,Shin D,Han S,Lee HE,Park SR.The EREBP-gene fromSolanum tuberosum confers resistance against oomycetes and a bacterialpathogen in transgenic potato and tobacco plants.Fruits,Vegetable and CerealScience and Biotechnology,2009,1:72-79
[0086] Si HJ,Xie CH,Liu J.An efficient protocol for Agrobacterium mediatedTransformation with microtuber and the introduction of an antisense class Ipatatin gene into potato.Acta Agronom.Sin.2003,29:801-805
[0087] Vadlamudi RK,Wang RA,Mazumdar A,Kim Y,Shin J,Sahin A,KumarR.Molecular cloning and characterization of PELP1,a novel human coregulatorof estrogen receptor alpha.J Biol Chem,2001,276:38272-38279
[0088] van der Vossen EA,Gros J,Sikkema A,Muskens M,Wouters D,Wolters P,Pereira A,Allefs S.The Rpi-blb2 gene from Solanum bulbocastanum is a Mi-1gene homolog conferring broad-spectrum late blight resistance in potato.PlantJ,2005,4422228.
[0089] Wang M,Allefs S,van den Berg RG,Vleeshouwers VG,van der Vossen EA,Vosman B.Allele mining in Solanum:conserved homologs of Rpi-blb1 areidentified in Solanum stoloniferum.Theor Appl Genet,2008,116:933-943
[0090] Xu M,Sun X,Wu X,Qi Y,Li H,Nie J,Yang Z,Tian Z.Chloroplast proteinStFC-II was manipulated by a Phytophthora effector to enhance hostsusceptibility.Hortic Res.2024,11(7):uhae149.
Claims
1. Application of overexpressing StPELP gene to enhance resistance to late blight in potato, characterized in that The CDS sequence of the StPELP gene is shown in SEQ No. 1 in the sequence listing.
2. Application of overexpressing StPELP gene to enhance resistance to potato fungal disease gray mold, characterized in that The CDS sequence of the StPELP gene is shown in SEQ No. 1 in the sequence listing.
3. Application of overexpressing StPELP gene to stimulate reactive oxygen species burst and activate immune response, characterized in that The CDS sequence of the StPELP gene is shown in SEQ No. 1 in the sequence listing.
4. Application of overexpressing StPELP gene to increase potato tuber yield, characterized in that The CDS sequence of the StPELP gene is shown in SEQ No. 1 in the sequence listing.
5. The method according to any one of claims 1 to 4, wherein the StPELP gene is overexpressed Overexpression of the StPELP gene had no significant effect on potato growth and development.
6. Application of overexpressing StPELP gene to enhance rice blast resistance, characterized in that The CDS sequence of the StPELP gene is shown in SEQ No. 1 in the sequence listing.
7. Potato StPELP gene, characterized in that The StPELP gene ID is Soltu.DM.11G006380.1, and the CDS sequence is shown in SEQ No. 1 in the sequence listing.
8. Potato StPELP protein, characterized in that The StPELP protein contains 852 amino acids, and the amino acid sequence is shown in SEQ No. 2 in the sequence table.
9. A method for verifying the late blight resistance function of the potato StPELP gene, characterized in that The method comprises the following steps: (1) analysis of StPELP gene expression patterns, (2) cloning of StPELP genes and construction of vectors, (3) genetic transformation of potatoes and detection of transgenic plants, (4) analysis of overexpression of StPELP in potatoes to enhance resistance to the oomycete disease late blight, (5) overexpression of StPELP in potatoes to enhance resistance to the fungal disease gray mold, (6) genetic transformation of the StPELP gene in rice and detection of transgenic plants, (7) overexpression of StPELP in rice to enhance resistance to the fungal disease rice blast, (8) overexpression of StPELP to stimulate plant basal immune responses, and (9) analysis of whether overexpression of StPELP in potatoes has no adverse effects on growth and development.