AtDMR6 orthologous gene for negative regulation of tobacco black shank and application of AtDMR6 orthologous gene

Abstract

The invention belongs to the field of molecular biology, and particularly relates to an AtDMR6 orthologous gene for negative regulation of tobacco black shank and application of the AtDMR6 orthologous gene. Two AtDMR6 orthologous genes, namely NtDMR6-1 and NtDMR6-2, in tobacco are determined through homologous comparison, and the nucleotide sequences of the two AtDMR6 orthologous genes are shown as SEQ ID NO. 1 and SEQ ID NO. 2 respectively. The invention also discloses a method for preparing the AtDMR6 orthologous genes for negative regulation of the tobacco black shank and the application of the AtDMR6 orthologous genes for negative regulation of the tobacco black shank.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, and particularly relates to an AtDMR6 orthologous gene negatively regulating tobacco black shank disease and an application thereof. Background Art

[0002] Phytophthora nicotianae is one of the most devastating diseases in tobacco production, causing tobacco black shank and highly pathogenic to many Solanaceae crops. Black shank, a major disease of tobacco (Nicotiana tabacum L.), occurs worldwide and can infect various tobacco types, including flue-cured, cigar, and sun-cured tobacco. In my country, black shank causes economic losses exceeding 100 million yuan annually, making it the second-largest tobacco disease after viral diseases. Therefore, studying the mechanism of action of Phytophthora parasiticus and identifying resistant materials can provide important theoretical support for the study of Phytophthora and even Oomycete pathogens, and thus have significant scientific and social value.

[0003] Single and multiple genes for resistance to Phytophthora parasitica have been discovered in tobacco and other Solanaceae crops. Four major sources of resistance exist in tobacco: the cigar tobacco varieties Florida 301 and Beinhart 1000, and the wild species N. plumbaginifolia and N. longiflora. N. plumbaginifolia carries the resistance gene Php, while N. longiflora carries the resistance gene Phl. Resistant varieties bred from these two sources exhibit vertical resistance to black shank race 0, but are susceptible to other physiological races. Because Phytophthora parasitica reproduces sexually, its mutation and evolution are rapid. Long-term cultivation of varieties carrying genes for vertical resistance to black shank can lead to variation in physiological races within the growing area, resulting in a loss of resistance in resistant varieties. Therefore, identifying new sources of resistance with broad-spectrum and long-lasting resistance is crucial for developing black shank-resistant tobacco varieties.

[0004] Phytophthora parasiticus is a semi-biotrophic pathogen. Within 24 hours of infection in Nicotiana benthamiana, it primarily undergoes a biotrophic phase, followed by a rapid transition to a necrotrophic phase. Biotrophic and semi-biotrophic pathogens require certain host genes to complete their life cycle. The normal expression of these host genes, known as S genes, is crucial for successful infection. The S gene strategy, first proposed in 2010 by the Solanaceae Disease Resistance Breeding Center at Wageningen University in the Netherlands, aims to confer broad-spectrum disease resistance in plants by disabling susceptibility genes. S genes play a variety of roles in host plant metabolism, including transport proteins, metabolic enzymes, and transcription factors. Some are closely linked to various stress responses and developmental processes in plants and are essential for pathogen infection, colonization, and development. The proposed susceptibility gene strategy provides a new avenue for improving plant disease resistance.

[0005] DMR6 encodes a 2-oxoglutarate Fe(II)-dependent oxygenase (2OGO), which is upregulated during pathogen infection and may be involved in the activation of SA-mediated immune responses, acting as a suppressor of plant immunity. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to improve the resistance of tobacco to black shank disease.

[0007] In order to solve the above technical problems, the present invention provides two AtDMR6 orthologous genes NtDMR6-1 and NtDMR6-2 that negatively regulate tobacco black shank disease, whose nucleotide sequences are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.

[0008] The present invention provides two AtDMR6 orthologous genes NtDMR6-1 and NtDMR6-2 that negatively regulate tobacco black shank disease, and the amino acid sequences encoded by the two genes are shown in SEQ ID NO.9 and SEQ ID NO.10, respectively.

[0009] The present invention also provides uses of the genes NtDMR6-1 and NtDMR6-2. Knocking out the genes NtDMR6-1 and NtDMR6-2 in tobacco can improve the resistance of tobacco to black shank disease.

[0010] The present invention also provides that the nucleotide sequence of the gene NtDMR6-1 mutant is shown in SEQ ID NO.3, and the nucleotide sequence of the gene NtDMR6-2 mutant is shown in SEQ ID NO.4.

[0011] The present invention also provides a method for knocking out genes NtDMR6-1 and NtDMR6-2 in tobacco, which is characterized by comprising the following steps:

[0012] 1) Design two CRISPR / Cas9 editing target sequence sgRNAs,

[0013] sgRNA1 GAAGCCATAGCAGAGAGCCTAGG, the nucleotide sequence is shown in SEQ ID NO.5,

[0014] sgRNA2 AGATTAATGACAAAGGCATCTGG, the nucleotide sequence is shown in SEQ ID NO. 6;

[0015] 2) Constructing a CRISPR / Cas9 plasmid using the sequence obtained in step 1);

[0016] 3) Transforming tobacco with the vector obtained in step 2) to obtain corresponding T0 transgenic tobacco plants;

[0017] 4) The TO transgenic tobacco plants obtained in step 3) were self-pollinated and identified by PCR to obtain homozygous mutant materials of NtDMR6-1 and NtDMR6-2, i.e., tobacco plants with knockout genes NtDMR6-1 and NtDMR6-2.

[0018] The technology used in the present invention is specifically to use CRISPR / Cas9 technology to design two sgRNAs (sgRNA1 and sgRNA2) targeting exon 3 of NtDMR6-1 and NtDMR6-2, knock out the tobacco NtDMR6-1 and NtDMR6-2 genes, thereby obtaining corresponding T0 transgenic tobacco plants, self-pollinating the T0 materials and PCR identification to obtain NtDMR6-1 and NtDMR6-2 homozygous mutant materials, with a 1-base insertion at the NtDMR6-1 position (SEQ ID NO.3) and a 1-base deletion at the NtDMR6-2 position (SEQ ID NO.4), thereby obtaining the tobacco plant DC6229L with the genes NtDMR6-1 and NtDMR6-2 knocked out.

[0019] Beneficial effects of the present invention: By inoculating black shank pathogens into the mutant strain DC6229L and the wild-type material HD, it was found that the mutant strain DC6229L can significantly improve the resistance of tobacco to black shank pathogens ( Figure 4 ) To evaluate the effects of knocking out NtDMR6-1 and NtDMR6-2 on tobacco plant growth, a field experiment was conducted. During the peak flowering period of tobacco, four agronomic traits, plant height, leaf length, width, and leaf number, were investigated. The results showed that the plant height, leaf length, width, and leaf number of the DC6229L mutant strain did not show a significant decrease compared with the wild type ( Figure 5 ). This indicates that the mutant line DC6229L has no adverse effects on plant growth. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 :Identification and expression analysis of tobacco AtDMR6 homologous genes

[0021] A. Sequence alignment of NtDMR6-1 and NtDMR6-2 with AtDMR6, SlDMR6-1, SlDMR6-2, StDMR6-1 and StDMR6-2; B. Phylogenetic analysis of DMR6 proteins in tobacco, Arabidopsis thaliana, tomato, and the ancestral tobacco species Nicotiana tabacum and Nicotiana vulgaris; C. Responses of NtDMR6-1 and NtDMR6-2 genes to tobacco infection with black shank;

[0022] Figure 2 : Location of sgRNA target sites in NtDMR6-1 and NtDMR6-2 genes

[0023] The positions of the two sgRNAs in the gene sequence of ABNtDMR6s and the positions of the two sgRNAs in the CDNtDMR6 protein, with yellow representing sgRNA1 and purple representing sgRNA2;

[0024] Figure 3 : PCR amplification of tobacco T0 mutants was performed using two primer combinations targeting two NtDMR6 genes

[0025] A. PCR primers bNtDMR6-1-F + bNIDMR6-IR were used to identify the NtDMR6-1 mutant.

[0026] B. Identification of NtDMR6-2 mutant using PCR primers bNtDMR6-2-F + bNDMR6-2-R;

[0027] Figure 4 :Analysis of characteristics of tobacco wild type and dmr6 mutant line DC6229L 3 days after infection with black shank;

[0028] Figure 5 :Agronomic traits of wild-type HD and dmr6 mutant lines under field conditions

[0029] A. There were no significant differences in plant height, leaf number, leaf width, and leaf length. B. There were no significant differences in field phenotypes. DETAILED DESCRIPTION

[0030] Example 1

[0031] By homology comparison, we determined that there are two AtDMR6 orthologous genes in tobacco: NtDMR6-1 (SEQ ID NO.1) and NtDMR6-2 (SEQ ID NO.2). Transcriptome data showed that both homologous genes responded to black leg pathogen infection, such as Figure 1shown.

[0032] Figure 1 A. Sequence alignment of NtDMR6-1 and NtDMR6-2 with AtDMR6, SlDMR6-1, SlDMR6-2, StDMR6-1, and StDMR6-2;

[0033] Figure 1 B. Phylogenetic analysis of DMR6 proteins in tobacco, Arabidopsis thaliana, tomato, and tobacco ancestral species Nicotiana tabacum and Nicotiana villosa;

[0034] Figure 1 C. Responses of NtDMR6-1 and NtDMR6-2 genes after tobacco was infected with black shank. The blue line represents the expression of NtDMR6-1, and the gray line represents the expression of NtDMR6-2. The data are derived from the transcriptome.

[0035] Example 2

[0036] 1) Design two CRISPR / Cas9-edited target sequence sgRNAs targeting exon 3 of NtDMR6-1 and NtDMR6-2, sgRNA1 GAAGCCATAGCAGAGAGCCTAGG, nucleotide sequence as shown in SEQ ID NO.5, sgRNA2 AGATTAATGACAAAGGCATCTGG, nucleotide sequence as shown in SEQ ID NO.6; the nucleotide sequence of NtDMR6-1 exon 3 is shown in SEQ ID NO.7, and the nucleotide sequence of NtDMR6-2 exon 3 is shown in SEQ ID NO.8. Figure 2 As shown, Figure 2 A, B. The positions of the two sgRNAs in the gene sequence of NtDMR6s. Figure 2 C, D. The locations of the two sgRNAs in the NtDMR6 protein, yellow represents sgRNA1 and purple represents sgRNA2.

[0037] 2) The sequence obtained in step 1) was used to construct a CRISPR / Cas9 plasmid, which was then introduced into Escherichia coli EHA105. The gene knockout vector construction and genetic transformation were entrusted to Baige Biotechnology Co., Ltd. Genomic DNA was extracted from transgenic positive plants and PCR amplified using primers on both sides of the designed target site. The primer sequences are shown in Table 1 below. The PCR products were directly sequenced. Figure 3 As shown, A. PCR primers bNtDMR6-1-F + bNIDMR6-IR were used to identify the NtDMR6-1 mutant, B. PCR primers bNtDMR6-2-F + bNDMR6-2-R were used to identify the NtDMR6-2 mutant;

[0038] Table 1

[0039] Primer Name Sequence (5' to 3') bNtDMR6-1-F ACAATCTTTTGGCGTAGGTCCA bNtDMR6-1-R TTAATTATCAGTTTCAGCACACATCT bNtDMR6-2-F AGCTACTGTGTTTCCCTCTCT bNtDMR6-2-R AACCGCTTATTATTAGTTTCAGCA

[0040] 3) 35 T0 materials were obtained by Agrobacterium-mediated transformation. The T0 generation was a knockout mutant genetically transformed plant. The T0 material was self-pollinated to obtain the T1 generation. After sowing, 25 plants of the T1 generation were identified by PCR, and a homozygous mutant material with a 1-base insertion at NtDMR6-1 gRNA1 (nucleotide sequence as shown in SEQ ID NO.7) and a 1-base deletion at NtDMR6-2 gRNA1 (nucleotide sequence as shown in SEQ ID NO.8) was obtained, numbered DC6229. After the material matured, the T2 generation was self-pollinated. At this time, the T2 generation plants were all homozygous mutants with a 1-base insertion at NtDMR6-1 gRNA1 and a 1-base deletion at NtDMR6-2 gRNA1, numbered DC6229L, and used for the next experiment, as shown in Table 2.

[0041] Table 2

[0042]

[0043] Example 4

[0044] By inoculating the dmr6 mutant strain DC6229L and the wild-type material HD with black shank pathogen, it was found that the dmr6 mutant strain DC6229L could significantly improve the resistance of tobacco to black shank disease. Figure 4 As shown, 3 days after the tobacco wild type and dmr6 mutant line DC6229L were infected with black shank disease, the severity of black shank disease in the wild type HD was significantly higher than that in the dmr6 mutant line DC6229L. Figure 4 A. Disease index of tobacco wild-type HD and dmr6 mutant line DC6229L, Figure 4 B. Symptoms at the base of plants and stems of tobacco wild-type HD and dmr6 mutant line DC6229L 3 days after infection with black shank disease.

[0045] Example 5

[0046] To evaluate the effects of knocking out NtDMR6-1 and NtDMR6-2 on tobacco plant growth, a field experiment was conducted. During the peak flowering period, four agronomic traits, plant height, leaf length, width, and leaf number, were investigated. The results showed that the plant height, leaf length, width, and leaf number of the DC6229L mutant strain did not decrease significantly compared with the wild type ( Figure 5 ). This indicates that the tobacco dmr6 mutant material has no adverse effects on plant growth. Figure 5 Agronomic traits of wild-type HD and dmr6 mutant lines under field conditions. Figure 5A. There were no significant differences in plant height, leaf number, leaf width and length. Figure 5 B. There was no significant difference in field phenotypes. Fifteen plants were surveyed for each line with three replicates.

Claims

1. The AtDMR6 orthologous gene that negatively regulates tobacco black shank disease is characterized by : Through homology comparison, two AtDMR6 orthologous genes in tobacco were identified: NtDMR6-1 and NtDMR6-2, whose nucleotide sequences are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.

2. The tobacco black shank negatively regulated AtDMR6 orthologous gene according to claim 1, characterized in that: The two AtDMR6 orthologous genes NtDMR6-1 and NtDMR6-2 in tobacco encode amino acid sequences as shown in SEQ ID NO.9 and SEQ ID NO.10, respectively.

3. The use of the AtDMR6 orthologous gene for negative regulation of tobacco black shank disease according to claim 1, wherein the genes NtDMR6-1 and NtDMR6-2 are characterized by: : Knocking out the genes NtDMR6-1 and NtDMR6-2 in tobacco can improve tobacco's resistance to black shank disease.

4. The use of genes NtDMR6-1 and NtDMR6-2 according to claim 1, characterized in that: The nucleotide sequence of the gene NtDMR6-1 mutant is shown in SEQ ID NO.3, and the nucleotide sequence of the gene NtDMR6-2 mutant is shown in SEQ ID NO.

4.

5. A method for knocking out genes NtDMR6-1 and NtDMR6-2 in tobacco, characterized by: The following steps are involved: 1) Design two CRISPR / Cas9 editing target sequence sgRNAs, sgRNA1 GAAGCCATAGCAGAGAGCCTAGG, as shown in SEQ ID NO.5, sgRNA2 AGATTAATGACAAAGGCATCTGG, as shown in SEQ ID NO. 6; 2) Constructing a CRISPR / Cas9 plasmid using the sequence obtained in step 1); 3) Transforming tobacco with the vector obtained in step 2) to obtain corresponding T0 transgenic tobacco plants; 4) The TO transgenic tobacco plants obtained in step 3) were self-pollinated and identified by PCR to obtain homozygous mutant materials of NtDMR6-1 and NtDMR6-2, i.e., tobacco plants with knockout genes NtDMR6-1 and NtDMR6-2.

Images