Application of silent miR529b in forward regulation of brown planthopper resistance of rice

Abstract

The invention relates to the technical field of biological genetic engineering, in particular to application of silent miR529b in forward regulation of brown planthopper resistance of rice. According to the present invention, the silence vector of the miR529b is adopted to silence the miR529b in the receptor rice through the short tandem target mimic (STTM) technology so as to obtain the transgenic plant STTM-miR529b with the silence of the miR529b, and the transgenic plant STTM-miR529b with the silence of the miR529b is provided with the silence of the miR529b. And carrying out brown planthopper resistance identification on T2-generation homozygous transgenic plants by adopting a seedling stage group method. Compared with a transgenic receptor parent Nipponbare (a control group, marked as NIP, similarly hereinafter), the STTM-miR529b is more resistant to insects, and it is proved that the miR529b is related to the resistance of rice to brown planthoppers and can be used for creating new rice brown planthopper resistant germplasm.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to the application of silencing miR529b in positively regulating rice resistance to brown planthoppers. Background Art

[0002] Brown planthoppers (NLP), a major pest in my country's rice production, directly feed on rice sap, causing it to lose nutrients, turn yellow, wither, and even die. They also spread numerous pathogens, indirectly harming rice. These pests can reduce or even completely eliminate rice yields, posing a serious threat to food security.

[0003] Discovering and utilizing rice genes that confer resistance to brown planthoppers and cultivating and growing insect-resistant rice varieties are the primary, economical, effective, and environmentally friendly means of controlling brown planthoppers. This approach can control brown planthopper reproduction for a limited time, but as new biotypes of the brown planthopper emerge, the resistance of previously insect-resistant rice plants may be overcome, causing resistant rice to become susceptible again. Therefore, we must continuously discover new insect-resistant genes and cultivate new resistant rice varieties. Fully discovering and utilizing more key resistance-regulating genes is crucial to curbing the damage caused by brown planthoppers and ensuring the safety of rice production.

[0004] MicroRNA (miRNA) is a type of endogenous non-coding single-stranded RNA with a length of about 22nt. It is a small molecule regulatory factor that can widely participate in the regulation of various life activities of organisms such as embryonic development, cell growth, differentiation, metabolism, etc. It plays an important role in the post-transcriptional regulation of genes and has the characteristics of simplicity and high efficiency. In plants, it mainly exerts its post-transcriptional regulatory function on target genes by inhibiting gene transcription or directly degrading the mRNA of target genes. MiRNA is not only involved in regulating plant growth, development, metabolism and other processes, but also in the response of plants to biotic and abiotic stresses. In summary, miRNA and resistance-related genes play an important role in the evolution of insect resistance and can be used as important targets for pest control. At present, there are no relevant research reports on the application of miR529b in the present invention to regulate rice resistance to brown planthoppers.

[0005] STTM( S hort T andem T argets Mmimics are synthetic short tandem target mimics with a specific 48-nt nucleotide sequence in the middle and target miRNA binding sites at either end. Each miRNA binding sequence consists of three non-complementary bases (CTAs), which bind to the target miRNA to form a non-completely complementary duplex, effectively preventing the miRNA from binding to the target gene, silencing the miRNA and increasing target gene expression. This technology has been widely applied to the functional study of miRNAs in Arabidopsis, rice, tomato, and soybean. Using STTM technology to study the function of miR529b and further develop brown planthopper control efforts has contributed to the development of brown planthopper-resistant rice varieties at the cellular level. Summary of the Invention

[0006] In order to solve the above problems, the present invention provides the application of silencing miR529b in the positive regulation of rice resistance to brown planthoppers. After silencing miR529b, the resistance of rice plants to brown planthoppers is enhanced. It is a key gene for regulating rice resistance to brown planthoppers. This miRNA has important research value for breeding new rice varieties resistant to brown planthoppers.

[0007] In order to achieve the above object, the present invention provides the following technical solutions:

[0008] The present invention provides an application of silencing miR529b in positively regulating rice resistance to brown planthoppers.

[0009] Preferably, the nucleotide sequence of miR529b is shown as SEQ ID No.1.

[0010] Preferably, the application comprises the following steps:

[0011] 1) Artificially synthesizing a 48-nt specific hairpin loop structure nucleotide sequence as shown in SEQ ID No. 2, with target miRNA binding sites added at both ends. Each miRNA binding sequence includes three non-complementary bases, and the three non-complementary bases are CTA. The resulting hairpin structure nucleotide sequence is shown in SEQ ID No. 3;

[0012] 2) ligating the sequence SEQ ID No. 3 obtained in step 1) with the pBWA(V)HS vector to obtain the ligated vector pBWA(V)HS-STTM529b;

[0013] 3) Transforming Escherichia coli with the ligated vector pBWA(V)HS-STTM529b obtained in step 2) and extracting the plasmid;

[0014] 4) Transforming the plasmid obtained in step 3) into Agrobacterium to obtain transformed bacteria;

[0015] 5) Transforming rice with the transformed bacteria obtained in step 4) to obtain brown planthopper-resistant transgenic rice STTM-miR529b with silenced miR529b.

[0016] Preferably, the connection vector pBWA(V)HS-STTM529b is characterized in that the primers for amplifying the sequence shown in SEQ ID No. 3 in step 1) are forward primer TG1 and reverse primer TG2, the nucleotide sequence of the forward primer TG1 is shown in SEQ ID No. 4, the nucleotide sequence of the reverse primer TG2 is shown in SEQ ID No. 5, and the template sequence is SEQ ID No. 2.

[0017] Preferably, the system used to amplify the hairpin sequence is:

[0018] 12 μL of 100 μM forward primer TG, 22 μL of 100 μM reverse primer TG, 1 μL of spacer template, 25 μL of Pfu PCRMix, and 20 μL of ddH2O; the hairpin structure sequence is shown in SEQ ID No. 3.

[0019] Preferably, the operating program for amplifying the target sequence is: 1) 94°C for 5 min; 2) 30 cycles: 94°C for 30 s, 50°C for 45 s, 72°C for 3 s; 3) 72°C for 10 min; 4) storage at 4°C; the target sequence is the sequence shown in SEQ ID No. 3.

[0020] Preferably, the pBWA(V)HS vector and the hairpin structure nucleotide sequence SEQ ID No. 3 are digested with BsaI / Eco31I enzymes and then ligated using T4 DNA ligase to obtain the recombinant vector pBWA(V)HS-STTM529b.

[0021] Preferably, the Escherichia coli is Escherichia coli DH5α; and the Agrobacterium is Agrobacterium EHA105.

[0022] The present invention also provides the use of the silent miR529b described in the above technical solution in the positive breeding of brown planthopper-resistant rice.

[0023] The beneficial effects of the present invention are:

[0024] In this example, the pBWA(V)HS-STTM529b vector was introduced into the rice variety Nipponbare to generate transgenic plants (STTM-miR529b) with suppressed expression of miR529b. Using the seedling colony method, the T2 generation homozygous transgenic plants were tested for brown planthopper resistance. Compared to the transgenic recipient parent, Nipponbare, STTM-miR529b was more resistant to the insect, confirming that miR529b is associated with rice resistance to brown planthoppers and could be used to create new rice germplasm resistant to brown planthoppers. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments are briefly introduced below.

[0026] Figure 1 This is the map of the pBWA(V)HS-STTM529b vector, where the target1-spacer-target2 sequence is the inserted fusion hairpin loop sequence containing the miR529b binding site;

[0027] Figure 2 Identification of brown planthopper resistance in miR529b-STTM transgenic plants; A. Insect-resistant phenotype of STTM-miR529b transgenic plants, NIP is Nipponbare plant (negative control), STTM-miR529b-1 and STTM-miR529b-1 are two independent T2 generation lines of pBWA(V)HS-STTM529b vector transgenic plants; B: Brown planthopper resistance value of rice plants corresponding to Figure A. DETAILED DESCRIPTION

[0028] The present invention provides an application of silencing miR529b in positively regulating rice resistance to brown planthoppers. In the present invention, the nucleotide sequence of miR529b is shown in SEQ ID No. 1. In the present invention, the application includes the following steps: 1) artificially synthesizing a 48nt specific hairpin loop structure nucleotide sequence as shown in SEQ ID No. 2, adding target miRNA binding sites at both ends, each miRNA binding sequence includes 3 non-complementary bases, and the 3 non-complementary bases are CTA. The obtained hairpin structure nucleotide sequence is shown in SEQ ID No. 3; 2) connecting the sequence SEQ ID No. 3 obtained in the step 1) with the pBWA (V) HS vector to obtain the connection vector pBWA (V) HS-STTM529b; 3) transforming the connection vector pBWA (V) HS-STTM529b obtained in the step 2) into Escherichia coli and extracting the plasmid; 4) transferring the plasmid obtained in the step 3) into Agrobacterium to obtain a transformed bacterium; 5) transforming the transformed bacterium obtained in the step 4) into rice to obtain a transgenic rice STTM-miR529b resistant to brown planthoppers with silenced miR529b.

[0029] In the present invention, the ligation vector pBWA(V)HS-STTM529b, the primers for amplifying the sequence shown in SEQ ID No. 3 in step 1) are forward primer TG1 and reverse primer TG2, the nucleotide sequence of the forward primer TG1 is shown in SEQ ID No. 4, the nucleotide sequence of the reverse primer TG2 is shown in SEQ ID No. 5, and the template sequence is SEQ ID No. 2. In the present invention, the system used for amplifying the hairpin structure sequence is: 2 μL of forward primer TG1 at a concentration of 100 μM, 2 μL of reverse primer TG2 at a concentration of 100 μM, 1 μL of spacer template, 25 μL of Pfu PCRMix, and 20 μL of ddH2O; the hairpin structure sequence is shown in SEQ ID No. 3. In the present invention, the target sequence amplification procedure is: 1) 94°C for 5 minutes; 2) 30 cycles of 94°C for 30 seconds, 50°C for 45 seconds, and 72°C for 3 seconds; 3) 72°C for 10 minutes; 4) storage at 4°C. The target sequence is the sequence shown in SEQ ID No. 3. In the present invention, the pBWA(V)HS vector and the hairpin structure nucleotide sequence SEQ ID No. 3 are digested with BsaI / Eco31I enzymes and then ligated using T4 DNA ligase to obtain the recombinant vector pBWA(V)HS-STTM529b. In the present invention, the Escherichia coli is Escherichia coli DH5α, and the Agrobacterium is Agrobacterium tumefaciens EHA105.

[0030] The present invention also provides the application of the silencing miR529b described in the above technical solution in the positive breeding of brown planthopper-resistant rice.

[0031] SEQ ID No. 1:

[0032] 19-AGAAGAGAGAGAGUACAGCUU-39.

[0033] SEQ ID No. 2:

[0034] GTTGTTGTTGTTATGGTCTAATTTAAATATGGTCTAAAGAAGAAGAAT.

[0035] SEQ ID No.3:

[0036] aagctgtactcctatctctcttcTGTTGTTGTTGTTATGGTCTAATTTAAATATGGTCT AAAGAAGAAGAATtaagctgtactcctatctctcttct.

[0037] SEQ ID No.4: cagtGGTCTCacaacaagctgtactcctatctctcttctgttgttgttgttatggt;

[0038] SEQ ID No. 5: cagtGGTCTCatacaagaagagagataggagtacagcttattcttcttctttaga.

[0039] In order to further illustrate the present invention, the present invention is described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0040] Example 1

[0041] 1. Experimental Materials

[0042] 1. Rice materials

[0043] The rice used in this study was Nipponbare (NIP). The rice was grown at the Institute of Genetics at Wuhan University and cultivated outdoors from May to October. The remaining months were spent in a greenhouse, maintained at a temperature of 28°C, a relative humidity of 70-80%, and a photoperiod of 16 hours of light / 8 hours of darkness.

[0044] 2. Brown planthopper and feeding

[0045] Brown planthoppers (NLP) were collected from natural populations in fields in Wuhan and reared in isolation for extended periods on susceptible rice varieties lacking insect-resistance genes. The NLPs were maintained in a greenhouse at Wuhan University, maintained at a temperature of 27±1°C, a relative humidity between 70% and 80%, and a photoperiod of 16 hours of light / 8 hours of darkness per day. Rice seedlings in good vegetative growth were used for NLP rearing, and rice seedlings were replaced regularly based on the population density and the growth status of the rice being fed.

[0046] 2. Experimental Procedure

[0047] 1. Design of simulated target sequences

[0048] Based on the sequence of miR529b, corresponding complementary oligonucleotide chains were designed. These sequences were designed to form an incompletely complementary bubble structure with the cleavage site of miR529b, thereby preventing the effective cleavage of miR529b.

[0049] The nucleotide sequence of miR529b (SEQ ID No. 1) is shown below:

[0050] 19-AGAAGAGAGAGAGUACAGCUU-39;

[0051] The STTM hairpin structure sequence comprising miR529b (SEQ ID No. 3): aagctgtactcctatctctcttcTGTTGTTGTTGTTATGGTCTAATTTAAATATGGTCTAAA GAAGAAGAATtaagctgtactcctatctctcttct.

[0052] 2. Construction of vector

[0053] 1) Enzyme digestion of vector: The enzyme digestion system is to use 1 μL of BsaI / Eco31I, 5 μL of buffer, 5 μL of 200 ng / μL pBWA(V)HS vector, 39 μL of ddH2O, and incubate at 37°C for 1 hour.

[0054] 2) Vector purification and recovery: After the vector enzyme digestion and incubation were completed, the gel was cut by electrophoresis, and the large fragments were recovered using the DC301 DNA gel recovery kit (Nanjing Novozymes Biotech Co., Ltd.) and eluted with 40 μL of elution buffer to obtain the purified product after the vector enzyme digestion.

[0055] 3) PCR amplification of the target sequence: With reference to the miR529b sequence, forward primer TG1 (SEQ ID No. 4): cagtGGTCTCacaacaagctgtactcctatctctcttctgttgttgttgt tatggt, and reverse primer TG2 (SEQ ID No. 5): cagtGGTCTCatacaagaagagagatagga gtacagcttattcttcttctttaga were designed. PCR amplification was performed using the spacer template (SEQ ID No. 2): GTTGTTGTTGTTA TGGTCTAATTTAAATATGGTCTAAAGAAGAAGAAT. The target sequence was amplified using the following protocol: 1) 94°C for 5 min; 2) 30 cycles of 94°C for 30 s, 50°C for 45 s, and 72°C for 5 s; 3) 72°C for 10 min; and 4) storage at 4°C.

[0056] 4) Purification and recovery of PCR products: After the PCR amplification reaction is completed, the gel is cut by electrophoresis, and the target fragment is recovered using the DC301 DNA gel recovery kit and eluted with 40 μL of elution buffer to obtain the purified PCR product.

[0057] 5) Enzyme digestion of PCR products: The enzymatic digestion system used was 1 μL of BsaI / Eco31I, 5 μL of Buffer, 40 μL of the purified PCR product obtained in step 4) above, and 4 μL of ddH2O. The mixture was incubated at 37°C for 1 hour.

[0058] 6) Purification and recovery of PCR products after enzyme digestion: After the above-mentioned enzyme digestion and incubation of the PCR products are completed, the gel is cut by electrophoresis, and the target fragment is recovered using the DC301 DNA gel recovery kit and eluted with 40 μL of elution buffer to obtain the purified product after enzyme digestion of the PCR product.

[0059] 7) Ligation: Ligate the purified vector obtained in steps 2) and 6) with the PCR product using a ligation system consisting of 2 μL of vector digestion product, 6 μL of PCR digestion product, 1 μL of T4 ligase, and 1 μL of buffer. Incubate at 4°C for 16 h.

[0060] 8) Transformation: The ligation product obtained in step 7) above was transformed into E. coli DH5α strain using the heat shock method. Selected clones were amplified by PCR and verified by sequencing using the forward primer TG1 and the reverse primer GUS-R (SEQ ID No. 6): ataaaagagaaaagggtcctaacc.

[0061] The correctly aligned plasmid was transferred into Agrobacterium tumefaciens EHA105 strain, which was used to transform Nipponbare. The T0 generation transgenic rice was obtained by hygromycin screening, namely the STTM-miR529b transgenic strain, named STTM-miR529b.

[0062] 3. Identification of genetically modified rice

[0063] T2 transgenic plants were amplified by PCR, verified by sequencing, and sequenced. The amplification primers were hygromycin-labeled primers: HYG-F (SEQ ID No. 7): CGAGAGCCTGACCTATTGCAT; HYG-R (SEQ ID No. 8): CTGCTCCATACAAGCCAACCAC. Positive plants were used for subsequent experiments.

[0064] Example 2

[0065] The seedling group method was used to identify the brown planthopper resistance of STTM-miR529b transgenic rice and its transgenic receptor NIP. The identification work was assisted by Wuhan Hetaiqing Biotechnology Co., Ltd.

[0066] The brown planthopper sources used for identification were collected from rice fields under natural conditions and cultured on the brown planthopper-susceptible rice material "Taichung No. 1" from the Plant Genetics Center of Wuhan University.

[0067] Seeds of the test material were sown in a plastic cup 12 cm in diameter and 15 cm high. When the seedlings reached the four-leaf stage, eight brown planthoppers were inoculated per seedling with second- to third-instar brown planthopper nymphs. The identified varieties were infested with brown planthoppers until the specific varieties died. The damage level of each identified plant was assessed and graded. The individual plant grading criteria for rice seedling resistance assessment are as follows:

[0068] Table 1 Evaluation criteria for individual plant grading of resistance identification at the rice seedling stage

[0069]

[0070] The T2 generation homozygous transgenic lines of STTM-miR529b were tested for brown planthopper resistance. The results showed that after the test materials were inoculated with brown planthoppers, the transgenic recipient plants NIP showed a death phenotype until the brown planthoppers fed on them. Figure 2A), when the resistance score was 9, only a few plants in the two T2 transgenic lines of STTM-miR529b plants, STTM-miR529b-1 and STTM-miR529b-2, showed wilting or yellowing of leaves, with resistance scores of 4.4 and 3.5, respectively. The lower the resistance grade identification score, the stronger the plant resistance. Data are the means and standard deviations of three independent biological replicates. Data were analyzed using ANOVA test, and the P values ​​for comparisons between experimental and control groups are shown in the figure ( Figure 2 B).

[0071] The experimental results showed that silencing miR529b expression could significantly enhance the resistance of Nipponbare plants to brown planthoppers, indicating that miR529b does regulate rice resistance to brown planthoppers.

[0072] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. Application of silencing miR529b in positively regulating rice resistance to brown planthoppers.

2. The use according to claim 1, characterized in that The nucleotide sequence of miR529b is shown in SEQ ID No.

1.

3. The use according to claim 1 or 2, characterized in that The application comprises the following steps: 1) Artificially synthesizing a 48-nt specific hairpin loop structure nucleotide sequence as shown in SEQ ID No. 2, with target miRNA binding sites added at both ends. Each miRNA binding sequence includes three non-complementary bases, and the three non-complementary bases are CTA. The resulting hairpin structure nucleotide sequence is shown in SEQ ID No. 3; 2) ligating the sequence SEQ ID No. 3 obtained in step 1) with the pBWA(V)HS vector to obtain the ligated vector pBWA(V)HS-STTM529b; 3) Transforming Escherichia coli with the ligated vector pBWA(V)HS-STTM529b obtained in step 2) and extracting the plasmid; 4) Transforming the plasmid obtained in step 3) into Agrobacterium to obtain transformed bacteria; 5) Transforming rice with the transformed bacteria obtained in step 4) to obtain brown planthopper-resistant transgenic rice STTM-miR529b with silenced miR529b.

4. The use according to claim 3, characterized in that The connecting vector pBWA(V)HS-STTM529b is characterized in that the primers for amplifying the sequence shown in SEQ ID No.3 in step 1) are forward primer TG1 and reverse primer TG2, the nucleotide sequence of the forward primer TG1 is shown in SEQ ID No.4, the nucleotide sequence of the reverse primer TG2 is shown in SEQ ID No.5, and the template sequence is SEQ ID No.

2.

5. The use according to claim 3 or 4, characterized in that The system used to amplify the hairpin sequence is: 12 μL of 100 μM forward primer TG, 22 μL of 100 μM reverse primer TG, 1 μL of spacer template, 25 μL of PfuPCRMix, and 20 μL of ddH2O; the hairpin structure sequence is shown in SEQ ID No.

3.

6. The use according to claim 3, characterized in that The operating program for amplifying the target sequence is: 1) 94°C for 5 min; 2) 30 cycles: 94°C for 30 s, 50°C for 45 s, 72°C for 3 s; 3) 72°C for 10 min; 4) storage at 4°C; the target sequence is the sequence shown in SEQ ID No.

3.

7. The use according to claim 3, characterized in that The pBWA(V)HS vector and the hairpin structure nucleotide sequence SEQ ID No. 3 were digested with BsaI / Eco31I enzymes and then ligated using T4 DNA ligase to obtain the recombinant vector pBWA(V)HS-STTM529b.

8. The use according to claim 3, characterized in that The Escherichia coli is Escherichia coli DH5α; the Agrobacterium is Agrobacterium EHA105.

9. Use of the silent miR529b according to claim 1 in the forward breeding of rice resistant to brown planthopper.

Images