Composition for detecting ovarian lesions and use thereof

Abstract

The invention provides a composition for detecting ovarian lesions and application thereof.The composition comprises nucleic acid used for detecting the methylation state of a target gene, the methylation state of the target gene is represented by methylation of a target sequence of the target gene, and the target sequence of the target gene is represented by methylation of the target sequence of the target gene. The target gene comprises one or more than two of an EPS8L1 gene, an EMX2OS gene and a CAPN2 gene. The invention also provides a kit comprising the composition, and application of the composition in preparation of the kit for detecting ovarian lesions.

Description

Technical Field

[0001] The present application belongs to the field of molecular biology and relates to gene detection, and specifically to a nucleic acid composition for detecting methylation of genes related to ovarian lesions and its corresponding kit and use. Background Art

[0002] Ovarian cancer, a malignant tumor of the female reproductive system with an increasing incidence and one of the highest mortality rates, poses a serious challenge to women's health. Among the various types of ovarian cancer, epithelial ovarian cancer accounts for approximately 90%, with serous ovarian cancer accounting for as high as 70%, and the prognosis is generally poor. Survival rates for patients with early-stage ovarian cancer are relatively high. However, because the ovaries are deep within the pelvic cavity, early lesions are often difficult to detect. Most patients have already progressed to the mid-to-late stage by the time they experience noticeable symptoms, and approximately 70% of patients are diagnosed in the late stage. Even more worrying is that even with treatment, up to 70% of patients will relapse within two to three years, resulting in an extremely high mortality rate. Therefore, early diagnosis of ovarian cancer is invaluable in improving patient survival and prognosis.

[0003] In clinical practice, serum carbohydrate antigen 125 (CA125) is a commonly used marker for the diagnosis and recurrence monitoring of epithelial ovarian cancer. While widely used, it has significant limitations. While many ovarian cancer patients experience elevated CA125 levels, this is not the case for all. According to statistics, approximately 80% of patients with advanced ovarian cancer have elevated CA125 levels, while this percentage drops to 50% in the early stages of the disease. More troublingly, some non-cancerous conditions, such as pelvic inflammatory disease and endometriosis, can also cause elevated CA125 levels. Therefore, the specificity of the CA125 blood test is relatively low, making it prone to false-positive results in non-cancerous conditions, limiting its accuracy in the early diagnosis of ovarian cancer. Furthermore, the CA125 blood test has other limitations. First, its low sensitivity for early ovarian cancer detection makes it difficult to effectively identify early lesions, resulting in many patients missing the optimal treatment window by the time of diagnosis. Second, the test is primarily intended for patients diagnosed with ovarian cancer or those at high risk with a family history of ovarian cancer. It is not suitable for routine screening of healthy women. Furthermore, the CA125 blood test cannot be used as the sole basis for diagnosing ovarian cancer. It needs to be combined with other examinations and evaluation results to make a final diagnosis, which increases the complexity and uncertainty of the diagnosis.

[0004] Magnetic resonance imaging (MRI), as an advanced medical imaging technique, plays a vital role in the diagnosis and differential diagnosis of ovarian cancer with its high resolution, multiplanar imaging, and non-invasive nature. However, MRI also has numerous limitations. First, its high equipment and operating costs increase the financial burden on patients and limit its widespread clinical application. Second, MRI examinations are lengthy, typically lasting 30 minutes to an hour, which can be challenging for patients who need to remain still in confined spaces. Furthermore, MRI uses a strong magnetic field and may not be suitable for patients with metal objects such as pacemakers and artificial joints, as well as for certain populations such as pregnant women. Most importantly, while MRI can demonstrate ovarian masses and abnormalities, it cannot provide a definitive diagnosis; the final diagnosis must be made in conjunction with clinical history, symptoms, other imaging studies, and possible tissue biopsy results.

[0005] In recent years, with the deepening of epigenetic research, DNA methylation, as an important epigenetic modification mechanism, has gradually been revealed to have a close relationship with the occurrence, development and prognosis of tumors. Changes in DNA methylation patterns are not only highly tissue-specific, that is, there are differences in the DNA methylation status in different tissues or organs, but can also be traced back to the primary site of the tumor by analyzing the methylation characteristics of circulating tumor DNA (ctDNA) in the blood or other body fluids. This discovery provides new ideas and methods for the early screening of ovarian cancer. Therefore, by developing detection methods for specific DNA methylation sites, such as methylation-specific PCR and high-throughput sequencing, it is possible to accurately detect the methylation status of ovarian cancer-related genes, providing strong support for the early detection and early treatment of ovarian cancer patients. Summary of the Invention

[0006] In view of the various limitations of current ovarian cancer diagnostic technologies, including but not limited to the insufficient specificity and limited sensitivity of serum markers (such as CA125), and the high cost, operational complexity, and limited applicability of imaging examinations (such as MRI) to specific populations, this application aims to provide a composition for detecting ovarian lesions. The composition provided in this application is capable of sensitively and specifically detecting ovarian cancer. This application also provides a kit comprising the composition and its use in detecting ovarian cancer. The kit provided in this application has good sensitivity for detecting ovarian cancer and specificity for benign ovarian diseases, and can detect ovarian cancer conveniently, quickly, and effectively.

[0007] In one aspect of the present application, a composition for detecting ovarian lesions comprises: a nucleic acid for detecting the methylation status of a target gene, wherein the methylation status of the target gene is characterized by the methylation of a target sequence of the target gene, and the target gene comprises one or more of the EPS8L1 gene, the EMX2OS gene, and the CAPN2 gene.

[0008] In one embodiment, the ovarian lesions include benign lesions and malignant lesions.

[0009] In one embodiment, the target genes include any two of the EPS8L1 gene, the EMX2OS gene, and the CAPN2 gene.

[0010] In one embodiment, the target sequence of the EPS8L1 gene is as shown in any one of SEQ ID NOs: 1 to 4, or the target sequence of the EPS8L1 gene includes a sequence as shown in any one of SEQ ID NOs: 1 to 4.

[0011] In one embodiment, the target sequence of the EMX2OS gene is as shown in any one of SEQ ID NOs: 5 to 8 or the target sequence of the EMX2OS gene includes the sequence as shown in any one of SEQ ID NOs: 5 to 8.

[0012] In one embodiment, the target sequence of the CAPN2 gene is as shown in any one of SEQ ID NOs: 9 to 12, or the target sequence of the CAPN2 gene includes a sequence as shown in any one of SEQ ID NOs: 9 to 12.

[0013] In one embodiment, the nucleic acid for detecting the methylation status of the target gene includes a primer, wherein the primer is a fragment of at least 9 nucleotides in the target sequence of the target gene, and the fragment contains at least one CpG dinucleotide sequence.

[0014] In one embodiment, the fragment of at least 9 nucleotides is a sequence of SEQ ID NO: 13 and SEQ ID NO: 14, or a sequence of SEQ ID NO: 15 and SEQ ID NO: 16, or a sequence of SEQ ID NO: 17 and SEQ ID NO: 18, or a sequence of SEQ ID NO: 19 and SEQ ID NO: 20, or a sequence of SEQ ID NO: 21 and SEQ ID NO: 22, or a sequence of SEQ ID NO: 23 and SEQ ID NO: 24.

[0015] In one embodiment, the nucleic acid for detecting the methylation status of the target gene includes a probe, which is a fragment of at least 15 nucleotides that hybridizes to the target sequence of the target gene under moderately stringent or highly stringent conditions, and the fragment contains at least one CpG dinucleotide sequence.

[0016] In one embodiment, the fragment of at least 15 nucleotides is a sequence of SEQ ID NO: 25, or a sequence of SEQ ID NO: 26, or a sequence of SEQ ID NO: 27, or a sequence of SEQ ID NO: 28, or a sequence of SEQ ID NO: 29, or a sequence of SEQ ID NO: 30.

[0017] In one embodiment, the nucleic acid for detecting the methylation status of a target gene further comprises a blocker that preferentially binds to a target sequence in an unmethylated state.

[0018] In one embodiment, the composition further comprises a reagent for converting the unmethylated cytosine base at position 5 of the target sequence of the target gene into uracil.

[0019] In another aspect of the present application, an oligonucleotide for detecting ovarian lesions is provided, wherein the oligonucleotide comprises a fragment of at least 9 nucleotides of a sequence as shown in any one of SEQ ID NOs: 1 to 4 or its complementary sequence and contains at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides of a sequence as shown in any one of SEQ ID NOs: 5 to 8 or its complementary sequence and contains at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides of a sequence as shown in any one of SEQ ID NOs: 9 to 12 or its complementary sequence and contains at least one CpG dinucleotide sequence.

[0020] In one embodiment, the oligonucleotide comprises the sequences shown in SEQ ID NO:13 and SEQ ID NO:14.

[0021] In one embodiment, the oligonucleotide comprises the sequences of SEQ ID NO:15 and SEQ ID NO:16.

[0022] In one embodiment, the oligonucleotide comprises the sequences of SEQ ID NO:17 and SEQ ID NO:18.

[0023] In one embodiment, the oligonucleotide comprises the sequences of SEQ ID NO: 19 and SEQ ID NO: 20.

[0024] In one embodiment, the oligonucleotide comprises the sequences of SEQ ID NO:21 and SEQ ID NO:22.

[0025] In one embodiment, the oligonucleotide comprises the sequences of SEQ ID NO:23 and SEQ ID NO:24.

[0026] In one embodiment, the oligonucleotide further comprises a fragment of at least 15 nucleotides and comprising at least one CpG dinucleotide sequence in the sequence as shown in any one of SEQ ID NOs: 1 to 4 or its complementary sequence that hybridizes under moderately stringent or highly stringent conditions; and / or a fragment of at least 15 nucleotides and comprising at least one CpG dinucleotide sequence in the sequence as shown in any one of SEQ ID NOs: 5 to 8 or its complementary sequence; and / or a fragment of at least 15 nucleotides and comprising at least one CpG dinucleotide sequence in the sequence as shown in any one of SEQ ID NOs: 9 to 12 or its complementary sequence.

[0027] In one embodiment, the oligonucleotide comprises the sequence of SEQ ID NO:25.

[0028] In one embodiment, the oligonucleotide comprises the sequence of SEQ ID NO:26.

[0029] In one embodiment, the oligonucleotide comprises the sequence of SEQ ID NO:27.

[0030] In one embodiment, the oligonucleotide comprises the sequence of SEQ ID NO:28.

[0031] In one embodiment, the oligonucleotide comprises the sequence of SEQ ID NO:29.

[0032] In one embodiment, the oligonucleotide comprises the sequence of SEQ ID NO:30.

[0033] In one embodiment, the oligonucleotide further comprises a blocker that preferentially binds to the target sequence in an unmethylated state.

[0034] In another aspect of the present application, a kit is provided, comprising the above-mentioned composition and the oligonucleotide.

[0035] In one embodiment, the kit further comprises at least one other component selected from the group consisting of nucleoside triphosphates, a DNA polymerase, and a buffer required for the function of the DNA polymerase.

[0036] In one embodiment, the sample used for detection in the kit comprises: cell lines, histological sections, tissue biopsy / paraffin-embedded tissue, body fluids, feces, colon effluent, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, or a combination thereof.

[0037] In one embodiment, the kit further includes: instructions.

[0038] In another aspect of the present application, there is provided use of the above-mentioned composition or oligonucleotide in preparing a kit for detecting ovarian lesions.

[0039] In one embodiment, the process of detecting ovarian lesions by the kit for detecting ovarian lesions is as follows:

[0040] Isolating a DNA sample comprising a target sequence of a target gene or a fragment thereof from a biological sample to be tested;

[0041] determining the methylation status of the target sequence of the target gene;

[0042] The state of the biological sample is judged by the detection result of the methylation state of the target sequence of the target gene, thereby realizing the detection of ovarian lesions.

[0043] In one embodiment, the kit for detecting ovarian lesions is detected by the following method:

[0044] Extracting genomic DNA from the biological sample to be tested;

[0045] Treating the extracted genomic DNA with a reagent to convert the unmethylated cytosine base at position 5 into uracil or other bases;

[0046] contacting the genomic DNA treated with the reagent with a DNA polymerase and a primer of a target sequence of a target gene to perform a DNA polymerization reaction;

[0047] detecting the amplified product with a probe; and

[0048] Based on the presence or absence of the amplified product, the methylation status of at least one CpG dinucleotide of the target sequence of the target gene is determined.

[0049] In one embodiment, the reagent for treating the extracted genomic DNA is selected from a bisulfite reagent.

[0050] In another aspect of the present application, there is provided use of one or more of the EPS8L1 gene, the EMX2OS gene, and the CAPN2 gene in preparing a kit for detecting ovarian lesions.

[0051] In one embodiment, the target sequence of the EPS8L1 gene is as shown in any one of SEQ ID NOs: 1 to 4, or the target sequence of the EPS8L1 gene includes a sequence as shown in any one of SEQ ID NOs: 1 to 4.

[0052] In one embodiment, the target sequence of the EMX2OS gene is as shown in any one of SEQ ID NOs: 5 to 8 or the target sequence of the EMX2OS gene includes the sequence as shown in any one of SEQ ID NOs: 5 to 8.

[0053] In one embodiment, the target sequence of the CAPN2 gene is as shown in any one of SEQ ID NOs: 9 to 12, or the target sequence of the CAPN2 gene includes a sequence as shown in any one of SEQ ID NOs: 9 to 12.

[0054] The beneficial effects of this application are:

[0055] This application is based on the EPS8L1 gene, EMX2OS gene, and CAPN2 gene, which are related markers for ovarian lesions. By detecting target sequences with abnormal methylation of these markers and detecting the methylation status of CpG dinucleotides in the target sequences of these marker genes and their fragments, ovarian tissue lesions can be distinguished, achieving effective detection of ovarian lesions. A molecular biology method based on DNA methylation detection is used for screening asymptomatic people, providing an innovative, efficient, and non-invasive detection method for in vitro diagnosis of ovarian lesions. DETAILED DESCRIPTION

[0056] The present application is described in detail below. Although specific embodiments of the present application are shown, it should be understood that the present application can be implemented in various forms and should not be limited by the embodiments set forth herein. Rather, these embodiments are provided to enable a more thorough understanding of the present application and to fully convey the scope of the present application to those skilled in the art.

[0057] Unless otherwise indicated, the implementation of this application will adopt conventional molecular biology (including recombinant technology), microbiology, cell biology, biochemistry and genetics techniques, which are all within the scope of conventional technical means in this area. Such techniques are described in detail in the literature such as Molecular Cloning: A Laboratory Manual, Second Edition (Sambrook et al., 1989); Oligonucleotide Synthesis (MJ Gait, 1984 edition); Animal Cell Culture (RI Freshney, 1987 edition); Methods in Enzymology series (Academic Press, Inc., USA); Current Protocols in Molecular Biology (FM Ausubel et al., 1987 edition, and regular updates); PCR: The Polymerase Chain Reaction (Mullis et al., 1994 edition). The primers, probes, blockers and kits used in this application can be prepared using standard techniques well known in the art.

[0058] Unless otherwise defined, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0059] In one embodiment, this embodiment provides a composition for detecting ovarian lesions, the composition comprising: a nucleic acid for detecting the methylation status of a target gene, wherein the methylation status of the target gene is characterized by methylation of a target sequence of the target gene, and the target gene comprises one or more of the EPS8L1 gene, the EMX2OS gene, and the CAPN2 gene.

[0060] The methylation status of CpG dinucleotides within the target sequences of the target genes EPS8L1, EMX2OS, and CAPN2 is tested to differentiate ovarian tissue lesions. Specifically, the methylation levels of the three target genes are tested, and the sample is considered positive based on whether the methylation status of a single target gene is greater than a certain threshold. Alternatively, the methylation status of two or three target genes is combined to determine whether the sample is positive. If the test results of two target genes are both positive, the sample is considered positive.

[0061] In this application, ovarian lesions include benign lesions and malignant lesions. Benign and malignant lesions specifically refer to the biological state of ovarian tissue, which is classified based on significant changes in the morphology, physiology and genetic characteristics of tissue cells. Benign lesions refer to ovarian tissue in which cell proliferation is active but the cell morphology remains normal, there is no invasive or metastatic growth, it does not invade surrounding tissues or organs, and it is usually not life-threatening. Benign lesions include but are not limited to ovarian cysts, ovarian fibromas, ovarian teratomas, etc. Malignant lesions refer to abnormal proliferation of cells in ovarian tissue, abnormal cell morphology, invasive and metastatic growth capabilities, the ability to invade surrounding tissues or organs, and even spread to other parts of the body through the blood or lymphatic system, posing a serious threat to life. Malignant lesions usually refer to ovarian cancer, including but not limited to ovarian epithelial carcinoma, ovarian germ cell tumors, ovarian sex cord stromal tumors, etc.

[0062] In this application, a target sequence refers to a short fragment used to identify and act on a specific DNA or RNA sequence in fields such as gene editing, molecular biology research, and diagnostic testing. It is a specific nucleotide sequence in the EPS8L1, EMX2OS, and CAPN2 genes, the methylation status of which can serve as a biomarker for detecting ovarian lesions. The methylation status of the target sequence is detected using specific nucleic acid molecules that can specifically bind to the target sequence, thereby revealing its methylation pattern.

[0063] In this application, target gene methylation refers to the process of selectively making the DNA sequence of target gene (or part of gene) methylated by specific technical means.This modification is generally related to under the effect of DNA methyltransferase (DNMT), methyl group is added to the cytosine base in DNA chain, particularly on the cytosine 5 carbon position of CpG dinucleotide, thereby changing the expression pattern of the gene or silencing the gene, so it is closely related to the occurrence of tumor.Abnormal methylation includes hypermethylation of tumor suppressor genes and DNA repair genes, hypomethylation of repetitive sequence DNA, imprinting loss of some genes, and it is relevant to the occurrence of multiple tumors.

[0064] In the present application, methylation status refers to the methylation degree of cytosine base on target gene DNA sequence, and is usually measured by detecting the methylation density of CpG island or other specific regions. DNA methylation mainly occurs on the 5 carbon atoms of cytosine (C), particularly on CpG sites (cytosine-phosphate-guanine sites). CpG island is a DNA fragment rich in CpG sites, usually a hot spot area where methylation occurs. Methylation status can be complete methylation (i.e. all cytosine bases are methylated), partial methylation (partial cytosine bases are methylated) or unmethylated (no cytosine base is methylated). When analyzing the methylation status of CpG dinucleotide sequences in this sample, those skilled in the art can use quantitative determination method to determine the methylation level (such as percentage, number, ratio, proportion or degree) of specific CpG dinucleotide sequences.

[0065] In the present application, a variety of different methods can be used for detecting DNA methylation changes.The method for detecting DNA methylation includes, for example, utilizing southern or polymerase chain reaction (PCR) to analyze the methylation-sensitive restriction endonuclease (MSRE) assay, methylation-specific or methylation-sensitive PCR (MS-PCR), methylation-sensitive single nucleotide primer extension (Ms-SnuPE), high resolution melting (HRM) analysis, bisulfite sequencing, pyrophosphate sequencing, methylation-specific single-stranded conformation analysis (MS-SSCA), combined bisulfite restriction analysis (COBRA), methylation-specific denaturing gradient gel electrophoresis (MS-DGGE), methylation-specific melting curve analysis (MS-MCA), methylation-specific denaturing high performance liquid chromatography (MS-DHPLC), methylation-specific microarray (MSO).These determinations can be PCR analysis, utilizing fluorescently labeled quantitative analysis or southern imprint analysis.

[0066] In this application, nucleic acid refers to a class of nucleic acid molecules that are specifically designed to specifically identify and bind to a target gene specific sequence (usually CpG islands or other methylation-sensitive sites). These nucleic acid molecules indirectly reflect the expression regulation of the target gene by detecting the methylation state of cytosine bases on the target gene sequence. These nucleic acid molecules can be DNA, RNA or derivatives thereof, such as locked nucleic acid (LNA), peptide nucleic acid (PNA), etc., and they have base sequences complementary to the target DNA sequence. In order to enhance specificity and stability, these nucleic acid molecules may be chemically modified, such as methylation, phosphorothioate, fluorescent labeling, etc. Some nucleic acid molecules may be designed with signal amplification mechanisms, such as fluorescence resonance energy transfer (FRET), electrochemiluminescence, etc., to improve detection sensitivity.

[0067] In this application, characterization refers to indirectly reflecting or describing the overall methylation status or activity level of the target gene by detecting the methylation status of a specific target sequence of the target gene.

[0068] In this application, detection covers any form of observation process of markers or their changes in biological samples (such as changes in the methylation state of markers, changes in the expression level of nucleic acid or protein sequences), regardless of whether these markers or their changes are actually captured. In short, the act of searching for markers or their changes in a sample constitutes "detection", even if it is ultimately determined that the marker does not exist or is below the detection threshold. This determination can be a precise quantitative analysis, an approximate quantitative analysis, or a non-quantitative observation, and may involve comparative analysis with one or more reference samples. It should be clear that the ovarian cancer detection in this application is not limited to the diagnosis of ovarian cancer cells, but also covers the identification of ovarian cancer precursor cells, which are starting or about to transform into ovarian cancer cells, or have a higher tendency to become cancerous. In addition, the scope of ovarian cancer detection also includes the assessment of potential lethal risk or the possibility of disease progression.

[0069] In certain embodiments, the target genes include any two of the EPS8L1 gene, the EMX2OS gene, and the CAPN2 gene. By detecting the methylation status of the specific target sequences of the two target genes, a joint determination of whether the sample is positive or negative is achieved. Specifically, if and only if the methylation detection results of the two target genes exceed the preset threshold, that is, both show a positive reaction, the sample is finally determined to be positive; conversely, if the methylation detection results of the two target genes do not reach the preset threshold, that is, both are negative, the sample is determined to be negative. Specific combination examples of joint determination include: a combination of the EPS8L1 gene and the EMX2OS gene, a combination of the EPS8L1 gene and the CAPN2 gene, and a combination of the EMX2OS gene and the CAPN2 gene.

[0070] In certain embodiments, the target sequence of the EPS8L1 gene is as shown in any one of SEQ ID NOs: 1 to 4 or the target sequence of the EPS8L1 gene includes the sequence shown in any one of SEQ ID NOs: 1 to 4. Specifically:

[0071] The target sequence (5'-3') of the EPS8L1 gene is as follows (SEQ ID NO: 1):

[0072] CTTTGAGCCTTTTGAGCCTGTGTGTCTCGTTCTGCGCCCTGGATTTCCCCCTCCCTGGACCCCTCAGTGGACCCAGTCTTGGTGTCCCCGTCGCCCTCCGCAGGCCACGCAGGAGGAGTTGCAGCGCGACCGCTCGCCCGCCGCTGAGACCCCGCCCCTGCAGCGCCGCCCGTCAGTCCGCG CAGTGATCAGCACCGTAGAGCGGGGCGCGGGCCGCGGACGACCCCAGGCGAAGCCCATTCCCGAGGCAGAGGAGGCGCAGAGGCCTGAGCCGGTGGGGACCTCGAGCAACGCTGACTCGGCCTCCCCGGACCTGGGTCCCCGGGGTCCTGACCTGGCGGTTCTGCAGGCGGAGCGGGAAGTG.

[0073] The reverse complementary sequence (5'-3') of the target sequence of the EPS8L1 gene is as follows (SEQ ID NO: 2):

[0074] CACTTCCCGCTCCGCCTGCAGAACCGCCAGGTCAGGACCCCGGGGACCCAGGTCCGGGGAGGCCGAGTCAGCGTTGCTCGAGGTCCCCACCGGCTCAGGCCTCTGCGCCTCCTCTGCCTCGGGAATGGGCTTCGCCTGGGGTCG TCCGCGGCCCGCGCCCCGCTCTACGGTGCTGATCACTGCGCGGACTGACGGGGCGGCGCTGCAGGGGCGGGGTCTCAGCGGCGGGCGAGCGGTCGCGCTGCAACTCCTCCTGCGTGGCCCTGCGGAGGGCGACGGGGACACCAAG.

[0075] The target sequence of the EPS8L1 gene after bisulfite treatment (5'-3') is as follows (SEQ ID NO: 3):

[0076] TTTTGAGTTTTTTGAGTTTGTGTGTTTCGTTTTGCGTTTTGGATTTTTTTTTTTTGGATTTTTAGTGGATTTAGTTTTGGTGTTTTCGTCGTTTTTCGTAGGGTTACGTAGGAGGAGTTGTAGCGCGATCGTTCGTTCGTCGTTGAGATTTCGTTTTTGTAGCGTCGTTCGTTAGTTCGCG TAGTGATTAGTATCGTAGAGCGGGGCGGGTCGCGGACGATTTTAGGCGAAGTTTATTTTCGAGGTAGAGGAGGCGTAGAGGTTTGAGTCGGTGGGGATTTCGAGTAACGTTGATTCGGTTTTTTCGGATTTGGGTTTTCGGGGTTTTGATTTGGCGGTTTTGTAGGCGGAGCGGGAAGTG.

[0077] The complementary sequence of the target sequence of the EPS8L1 gene after bisulfite treatment (5'-3') is as follows (SEQ ID NO: 4):

[0078] TATTTTTCGTTTCGTTTGTAGAATCGTTAGGTTAGGATTTCGGGGATTTAGGTTCGGGGAGGTCGAGTTAGCGTTGTTCGAGGTTTTTATCGGTTTAGGTTTTTGCGTTTTTTGTTTCGGGAATGGGTTTCGTTTGGGGTCGTTCGCGGTTCGCGTTTCGTTTTACGGTGTTGATTATTGC GCGGATTGACGGGCGGCGTTGTAGGGGCGGGGTTTAGCGGCGGGCGAGCGGTCGCGTTGTAATTTTTTGCGTGGTTTTGCGGAGGGCGACGGGGATATTAAGATTGGGTTTATTGAGGGGTTTAGGGAGGGGGAAATTTAGGGCGTAGAACGAGATATATAGGTTTAAAAGGTTTAAAG.

[0079] In certain embodiments, the target sequence of the EMX2OS gene is as shown in any one of SEQ ID NOs: 5 to 8 or the target sequence of the EMX2OS gene includes a sequence as shown in any one of SEQ ID NOs: 5 to 8. Specifically:

[0080] The target sequence (5'-3') of the EMX2OS gene is as follows (SEQ ID NO: 5):

[0081] CACGCAGCGCTTGCCCTGCCCGAGCTTCGGCTCACTGGCAGCGGCGAGGCCACCGACCACCCTCCGCTTCCAGTCCTAAACTCGGGGCTGGAGACCGCAGGAGCTAAACCAGGAAGAAGAAAGAGGGCAGGGCCTGAGGCCGGGA AGAGCGGCCCGGGGGTCAACGGTGAGCGGGTGCATACGAGGCAAGAGCCAGAGTGACATTAAGTGGGGCCGCCCGGGCAAACCTTGCGCGTGCACCCCGGCCCACCTGCAGGGCATTCTCCCCTGCCTTTTCTCCTTGGCTTGAGT.

[0082] The reverse complementary sequence (5'-3') of the target sequence of the EMX2OS gene is as follows (SEQ ID NO: 6):

[0083] ACTCAAGCCAAGGAGAAAAGGCAGGGGAGAATGCCCTGCAGGTGGGCCGGGGTGCACGCGCAAGGTTTGCCCGGGCGGCCCCACTTAATGTCACTCTGGCTCTTGCCTCGTATGCACCCGCTCACCGTTGACCCCCGGGCCGCTCT TCCCGGCCTCAGGCCCTGCCCTCTTTCTTCTTCCTGGTTTAGCTCCTGCGGTCTCCAGCCCCGAGTTTAGGACTGGAAGGCGGAGGGTGGTCGGTGGCCTCGCCGCTGCCAGTGAGCCGAAGCTCGGGCAGGGCAAGCGCTGCGTG.

[0084] The target sequence of the EMX2OS gene after bisulfite treatment (5'-3') is as follows (SEQ ID NO: 7):

[0085] TACGTAGCGTTGTTTTGTTCGAGTTTCGGTTTATTGGTAGCGGCGAGGTTATCGATTATTTTTCGTTTTTTAGTTTTAAATTCGGGGTTGGAGATCGTAGGAGTTAAATTAGGAAGAAGAAAGAGGGTAGGGTTTGAGGTCGGGA AGAGCGGTTCGGGGGTTAACGGTGAGCGGGTGTATACGAGGTAAGAGTTAGAGTGATATTAAGTGGGGTCGTTCGGGTAAATTTTGCGCGTGTATTTCGGTTTTATTTGTAGGGTATTTTTTTTTGTTTTTTTTTTGGTTTTGAGT.

[0086] The complementary sequence of the target sequence of the EMX2OS gene after bisulfite treatment (5'-3') is as follows (SEQ ID NO: 8):

[0087] ATTTAAGTTAAGGAGAAAAGGTAGGGGAGAATGTTTTGTAGGTGGGTCGGGGTGTACGCGTAAGGTTTGTTCGGGCGGTTTTATTTAATGTTATTTTGGTTTTTGTTTCGTATGTATTCGTTTATCGTTGATTTTCGGGTCGTTTT TTTCGGTTTAGGTTTTGTTTTTTTTTTTTTTTGGTTTAGTTTTTGCGGTTTTTAGTTTCGAGTTTAGGATTGGAAGGCGGAGGGTGGTCGGTGGTTTCGTCGTTGTTAGTGAGTCGAAGTTCGGGTAGGGTAAGCGTTGCGTG.

[0088] In certain embodiments, the target sequence of the CAPN2 gene is as shown in any one of SEQ ID NOs: 9 to 12 or the target sequence of the CAPN2 gene includes a sequence as shown in any one of SEQ ID NOs: 9 to 12. Specifically:

[0089] The target sequence (5'-3') of the CAPN2 gene is as follows (SEQ ID NO: 9):

[0090] CTCGGTCACCGGAGCCGAGGAGGTAACGGCCGGCGCGGATGTGCAGGGGTCCTGCTGTCCTGACACGATGGCCACAGGCACAGTTTGTGGTGATGCCCAGGGGCCCGCGCGGCCCCACGGTGGTCCAGTTTACACTCGGGCCCCGCACTCCTGAAGTTCCGCGCGGGAGGAGAAGGGCGTCCCTTTCGCAGCTCGGGCGCCGGGTGCGCCGCGCTGCCACCTGGTGGCCGCAGTGGCCGGCGCCAGGGGCCCTGGTTTTACTTGTTTTAGATGTTACCCTGTTTTACAGTTACAACCTTACTATTTTGATAAGCTAAAAATAATAAAACAATGCATCTTCATAGTGTTTTATACTCTATAAGGTGCTTTCTCTTTTGATCTCGTAAAAGTATTCGTGCCC。

[0091] The reverse complementary sequence (5'-3') of the target sequence of the CAPN2 gene is as follows (SEQ ID NO:10):

[0092] GGGCACGAATACTTTTACGAGATCAAAAGAGAAAGCACCTTATAGAGTATAAAACACTATGAAGATGCATTGTTTTATTATTTTTAGCTTATCAAAATAGTAAGGTTGTAACTGTAAAACAGGGTAACATCTAAAACAAGTAAAACCAGGGCCCCTGGCGCCGGCCACTGCGGCCACCAGGTGGCAGCGCGGCGCACCCGGCGCCCGAGCTGCGAAAGGGACGCCCTTCTCCTCCCGCGCGGAACTTCAGGAGTGCGGGGCCCGAGTGTAAACTGGACCACCGTGGGGCCGCGCGGGCCCCTGGGCATCACCACAAACTGTGCCTGTGGCCATCGTGTCAGGACAGCAGGACCCCTGCACATCCGCGCCGGCCGTTACCTCCTCGGCTCCGGTGACCGAG。

[0093] The sequence of the target sequence of the CAPN2 gene after bisulfite treatment (5'-3') is as follows (SEQ ID NO:11):

[0094] TTCGGTTATCGGAGTCGAGGAGGTAACGGTCGGCGCGGATGTGTAGGGGTTTTGTTGTTTTGATACGATGGTTATAGGTATAGTTTGTGGTGATGTTTAGGGGTTCGCGCGGTTTTACGGTGGTTTAGTTTATATTCGGGTTTCGTATTTTTGAAGTTTCGCGCGGGAGGAGAAGGGCGTTTTTTTCGTAGTTCGGGCGTCGGGTGCGTCGCGTTGTTATTTGGTGGTCGTAGTGGTCGGCGTTAGGGGTTTTGGTTTTATTTGTTTTAGATGTTATTTTGTTTTATAGTTATAATTTTATTATTTTGATAAGTTAAAAATAATAAAATAATGTATTTTTATAGTGTTTTATATTTTATAAGGTGTTTTTTTTTTTGATTTCGTAAAAGTATTCGTGTTT。

[0095] The complementary sequence of the target sequence of the CAPN2 gene after bisulfite treatment (5'-3') is as follows (SEQ ID NO: 12):

[0096] GGGTACGAATATTTTTACGAGATTAAAAGAGAAAGTATTTTATAGAGTATAAAATATTATGAAGATGTATTGTTTTATTATTTTTAGTTTATTAAAATAGTAAGGTTGTAATTGTAAAATAGGGTAATATTTAAAATAAGTAAAATTAGGGTTTTTGGCGTCGGTTATTGCGGTTATTAGGTGGTAGCGCGGCGTATTCGGCGTTCGAGTTGCGAAAGGGACGTTTTTTTTTTTTCGCGCGGAATTTTAGGAGTGCGGGGTTCGAGTGTAAATTGGATTATCGTGGGGTCGCGCGGGTTTTTGGGTATTATTATAAATTGTGTTTGTGGTTATCGTGTTAGGATAGTAGGATTTTTGTATATTCGCGTCGGTCGTTATTTTTTCGGTTTCGGTGATCGAG。

[0097] In the present application, the target sequence of the EPS8L1 gene is not limited to the sequences shown in the specifically listed SEQ ID NOs: 1 to 4, but includes a series of sequence variants that differ therefrom in sequence but substantially maintain the same function. These variants may be derived from natural variation, genetic polymorphism or artificial mutagenesis, etc. The sequence variant may contain one, two or three or more nucleotide mutations (including point mutations, insertions or deletions) compared to the sequence shown in any one of SEQ ID NOs: 1 to 4. These mutations should not significantly affect the binding ability of the target sequence of the EPS8L1 gene to the detection probe or its function as a biomarker. The sequence variant may have a sequence identity of up to 95%, 96%, 97%, 98% or 99% compared to the sequence shown in any one of SEQ ID NOs: 1 to 4, and this identity is calculated by an alignment algorithm (such as BLAST, ClustalW, etc.), reflecting the degree of similarity between the sequences. The sequence variants may also be obtained by deleting one or more nucleotides, adding one or more nucleotides, or replacing one or more nucleotides based on the sequence shown in any one of SEQ ID NOs: 1 to 4. These modified sequences are still considered to have substantially the same function as long as they maintain at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with the original sequence. The target sequence of the EMX2OS gene is not limited to the sequences shown in the specific SEQ ID NOs: 5 to 8, but includes a series of sequence variants that differ in sequence but retain substantially the same function. These variants may be caused by natural variation, genetic polymorphism or artificial mutagenesis. The sequence variants may contain one, two or three or more nucleotide mutations (including point mutations, insertions or deletions) compared to the sequences shown in any one of SEQ ID NOs: 5 to 8. These mutations should not significantly affect the binding ability of the target sequence of the EMX2OS gene to the detection probe or its function as a biomarker. The sequence variants may have a sequence identity of up to 95%, 96%, 97%, 98% or 99% compared to the sequence shown in any one of SEQ ID NOs: 5 to 8, which is calculated by an alignment algorithm (such as BLAST, ClustalW, etc.) and reflects the degree of similarity between the sequences. The sequence variants may also be obtained by deleting one or more nucleotides, adding one or more nucleotides, or replacing one or more nucleotides based on the sequence shown in any one of SEQ ID NOs: 5 to 8. As long as these modified sequences maintain at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with the original sequence, they are still considered to have substantially the same function as the target sequence.The target sequences of the CAPN2 gene are not limited to the sequences specifically listed in SEQ ID NOs: 9 to 12, but include a range of sequence variants that differ in sequence but retain substantially the same function. These variants may arise from natural variation, genetic polymorphism, or artificial mutagenesis. The sequence variants may contain one, two, or three or more nucleotide mutations (including point mutations, insertions, or deletions) compared to any of the sequences set forth in SEQ ID NOs: 9 to 12. These mutations should not significantly affect the binding ability of the target sequence of the CAPN2 gene to the detection probe or its function as a biomarker. The sequence variants may have up to 95%, 96%, 97%, 98%, or 99% sequence identity with any of the sequences set forth in SEQ ID NOs: 9 to 12, as calculated using an alignment algorithm (e.g., BLAST, ClustalW, etc.), reflecting the degree of similarity between the sequences. The sequence variant may also be obtained by deleting one or more nucleotides, adding one or more nucleotides, or replacing one or more nucleotides on the basis of the sequence shown in any one of SEQ ID NOs: 9 to 12. As long as these modified sequences maintain at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with the original sequence, they are still considered to have substantially the same function as the target sequence.

[0098] In this application, identity refers to the degree of similarity between two or more sequences (such as nucleotide sequences, amino acid sequences, etc.), which is usually calculated by a sequence alignment algorithm. This degree of similarity is expressed as a percentage, reflecting the proportion of the number of nucleotides or amino acids shared between the sequences to the total sequence length. When calculating identity, a recognized sequence alignment algorithm should be used, such as BLAST (Basic Local Alignment Search Tool), ClustalW, FASTA, MAFFT, Needleman-Wunsch algorithm or Smith-Waterman algorithm. These algorithms can identify the similarity between sequences and calculate the corresponding identity percentage. For the determination of "identity", one or more thresholds usually need to be set. These thresholds are used to distinguish whether there is substantial similarity or difference between sequences. For example, the identity threshold can be set to 90%, 95%, 98% or 99%, etc. For example, two nucleotide sequences, SeqA and SeqB, are found to have 95% sequence identity after calculation by the alignment algorithm. That is, 95% of the nucleotides in SeqA match the nucleotides at the corresponding positions in SeqB. At this time, it can be considered that SeqA and SeqB have 95% nucleotide sequence identity.

[0099] In certain embodiments, the nucleic acid for detecting the methylation status of the target gene comprises a primer, wherein the primer is a fragment of at least 9 nucleotides in the target sequence of the target gene, and the fragment comprises at least one CpG dinucleotide sequence.

[0100] In the application, primer (Primer) is a kind of artificially synthesized short chain oligonucleotide sequence, is generally used for starting the replication process of DNA or RNA chain.In the experiment of detecting the methylation state of target gene, primer has played a vital role.They can be combined with the specific region (i.e. target sequence) of target gene, thus guide subsequent amplification or sequencing reaction.Described primer is the fragment of at least 9 nucleotide in the target sequence of described target gene, and preferably length is at least 10,11,12,13,14,15,16,17,18,19,20,21,22 or more nucleotide.This length range guarantees the abundant combination and stable amplification of primer and target gene target sequence.The sequence of described primer comprises at least one CpG dinucleotide sequence, and CpG dinucleotide sequence has important biological function in DNA, particularly in gene expression regulation and methylation state detection, the primer comprising CpG dinucleotide sequence can more accurately identify the methylation state of target gene.

[0101] When bisulfite is used to convert the test sample DNA, the nucleic acid used to detect the methylation status of the target gene includes a fragment of at least 9 nucleotides in the sequence after bisulfite conversion of the target sequence of the target gene, preferably a fragment of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or more nucleotides, wherein the nucleotide fragment contains at least one CpG dinucleotide sequence.

[0102] Specifically, the fragment of at least 9 nucleotides is the sequence shown in SEQ ID NO: 13 and SEQ ID NO: 14, or the sequence shown in SEQ ID NO: 15 and SEQ ID NO: 16, or the sequence shown in SEQ ID NO: 17 and SEQ ID NO: 18, or the sequence shown in SEQ ID NO: 19 and SEQ ID NO: 20, or the sequence shown in SEQ ID NO: 21 and SEQ ID NO: 22, or the sequence shown in SEQ ID NO: 23 and SEQ ID NO: 24.

[0103] In certain embodiments, the nucleic acid for detecting the methylation status of the target gene includes a probe, which is a fragment of at least 15 nucleotides that hybridizes to the target sequence of the target gene under moderately stringent or highly stringent conditions, and the fragment contains at least one CpG dinucleotide sequence.

[0104] In this application, a probe, as an efficient analytical reagent, refers to a chemical substance or device that can specifically identify or label a target molecule and is suitable for direct detection. When referring to a nucleic acid sequence, it generally refers to a carefully designed nucleic acid sequence that can hybridize with a specific target sequence under specified conditions, thereby being used to detect the presence of the target sequence. The probe can be single-stranded or double-stranded DNA and can be of variable length, but its length is generally between tens to hundreds or even thousands of base pairs (bp). The probe has the ability to hybridize with the target sequence, which is based on the high accuracy of molecular denaturation, annealing, and base complementary pairing. During the hybridization process, the probe hydrogen bonds with the complementary unlabeled single-stranded DNA or RNA in the sample to be tested to form a stable double-stranded complex (hybrid). Through the hybridization reaction, the probe can detect the presence of the target sequence, which is usually achieved by observing the formation of a hybrid. The presence of the hybrid indicates the presence of the target sequence in the sample to be tested. It will be understood by those skilled in the art that in certain specific cases, the probe can also be used as a primer to initiate the replication process of the DNA or RNA chain. Similarly, primers can also be used as probes to detect the presence of the target sequence under certain conditions. This interoperability depends on the specific experimental design and application requirements. Probes must contain at least one CpG dinucleotide sequence, which is key to detecting methylation status. CpG dinucleotides are common methylation sites in the genome, and their methylation status is important for gene expression and disease development. By designing probes containing CpG dinucleotide sequences, the methylation status of target genes can be specifically detected.

[0105] In this application, the terms "moderate stringency" and "high stringency" refer to conditions under which a probe hybridizes to its target sequence, typically in a complex mixture of nucleic acids. Moderate stringency refers to hybridization conditions that allow a certain degree of nonspecific hybridization under specified hybridization conditions, but the primary goal is to ensure specific binding between the target sequence and the probe. High stringency refers to stringent hybridization conditions that allow only specific binding between the target sequence and the probe, while virtually preventing any nonspecific hybridization. These conditions typically include a moderate temperature, salt concentration, and pH. Moderate stringency conditions typically involve lower temperatures and ionic strengths, while high stringency conditions involve higher temperatures and lower ionic strengths. These conditions are chosen to ensure specific binding between the probe and the target sequence while minimizing the possibility of nonspecific hybridization. For detailed guidance on nucleic acid hybridization, see Tijssen, "A Review of Hybridization Principles and Nucleic Acid Assay Strategies," in Biochemistry and Molecular Biology Techniques - Nucleic Acid Probe Hybridization. Generally, stringent conditions are approximately 5-10°C below the melting point (Tm) of the specific nucleic acid at a defined ionic strength and pH. At the Tm temperature (under defined ionic strength, pH, and nucleic acid concentration), 50% of the probes complementary to the target hybridize uniformly to the target sequence. Stringent conditions can also be achieved by adding destabilizing agents. For selective or specific hybridization, a positive signal is twice, preferably 10 times, the background hybridization. Exemplary stringent hybridization conditions are as follows: hybridization in a solution of 50% formamide, 5x SSC, and 1% SDS at 42°C, or hybridization in a solution of 5x SSC and 1% SDS at 65°C, followed by a wash in a solution of 0.2x SSC and 0.1% SDS at 65°C.

[0106] When bisulfite is used to convert the test sample DNA, the nucleic acid used to detect the methylation status of the target gene includes a fragment of at least 15 nucleotides, preferably a fragment of at least 16, 17, 18, 19, 20, 21, 22 or more nucleotides, which hybridizes to the target sequence of the target gene after bisulfite conversion under moderate or high stringency conditions, wherein the nucleotide fragment contains at least one CpG dinucleotide sequence.

[0107] Specifically, the fragment of at least 15 nucleotides is the sequence of SEQ ID NO: 25, or the sequence of SEQ ID NO: 26, or the sequence of SEQ ID NO: 27, or the sequence of SEQ ID NO: 28, or the sequence of SEQ ID NO: 29, or the sequence of SEQ ID NO: 30.

[0108] In certain embodiments, the nucleic acid for detecting the sequence of the target EPS8L1 gene after bisulfite conversion includes primers and probes, wherein the primers are sequences shown in SEQ ID NO: 13 and SEQ ID NO: 14, and the probe is SEQ ID NO: 25. Specifically:

[0109] EPS8L1-1F: TACGTAGGAGGAGTTGTAGC (SEQ ID NO: 13);

[0110] EPS8L1-1R:AATCACTACGCGAACTAACG (SEQ ID NO:14);

[0111] EPS8L1-1P: CGATCGTTCGTTCGTCGTTGAG (SEQ ID NO: 25).

[0112] In certain embodiments, the nucleic acid for detecting the sequence of the target EPS8L1 gene after bisulfite conversion includes primers and probes, wherein the primers are sequences such as SEQ ID NO: 15 and SEQ ID NO: 16, and the probe is such as SEQ ID NO: 26. Specifically:

[0113] EPS8L1-2F: GGACGATTTTAGGCGAAG (SEQ ID NO: 15);

[0114] EPS8L1-2R: CCAAATCCGAAAAAAACCG (SEQ ID NO: 16);

[0115] EPS8L1-2P: CGAGGTAGAGGAGGCGTAGAGG (SEQ ID NO: 26).

[0116] In certain embodiments, the nucleic acid for detecting the sequence of the target EMX2OS gene after bisulfite conversion includes primers and probes, wherein the primers are sequences such as SEQ ID NO: 17 and SEQ ID NO: 18, and the probe is such as SEQ ID NO: 27. Specifically:

[0117] EMX2OS-1F: GGTTGGAGATCGTAGGAGTT (SEQ ID NO: 17);

[0118] EMX2OS-1R:TCGTATACACCCGCTCAC(SEQ ID NO:18);

[0119] EMX2OS-1P: CCCGACCTCAAACCCTACCC (SEQ ID NO: 27).

[0120] In certain embodiments, the nucleic acid for detecting the sequence of the target EMX2OS gene after bisulfite conversion includes primers and probes, wherein the primers are sequences such as SEQ ID NO: 19 and SEQ ID NO: 20, and the probe is such as SEQ ID NO: 28. Specifically:

[0121] EMX2OS-2F: GTTTGAGGTCGGGAAGAG (SEQ ID NO: 19);

[0122] EMX2OS-2R: GACCCCACTTAATATCACTC(SEQ ID NO:20);

[0123] EMX2OS-2P: CCCGACCTCAAACCCTACCC (SEQ ID NO: 28).

[0124] In certain embodiments, the nucleic acid for detecting the sequence of the target CAPN2 gene after bisulfite conversion includes primers and probes, wherein the primers are sequences such as SEQ ID NO: 21 and SEQ ID NO: 22, and the probe is such as SEQ ID NO: 29. Specifically:

[0125] CAPN2-1F:GGGTTTTGTTGTTTTGATAC (SEQ ID NO:21);

[0126] CAPN2-1R: CCGAATATAAACTAAACCACCG (SEQ ID NO: 22);

[0127] CAPN2-1P: CCGAACCCCTAAACATCACCA (SEQ ID NO: 29).

[0128] In certain embodiments, the nucleic acid for detecting the sequence of the target CAPN2 gene after bisulfite conversion includes primers and probes, wherein the primers are sequences such as SEQ ID NO: 23 and SEQ ID NO: 24, and the probe is such as SEQ ID NO: 30. Specifically:

[0129] CAPN2-2F: GGGCGTTTTTTCGTAGTTC (SEQ ID NO: 23);

[0130] CAPN2-2R: AAACCAAAACCCCTAACG (SEQ ID NO: 24);

[0131] CAPN2-2P: CGGGTGCGTCGCGTTGTTAT (SEQ ID NO: 30).

[0132] In certain embodiments, the 5' end of the probe of the present application is chemically bonded to a fluorescent reporter group, and the 3' end is connected to a quencher group, wherein the fluorescent reporter group is selected from FAM, Cy5 or VIC, and the quencher group is selected from BHQ1, BHQ2 or BHQ3. When the probe is intact, the fluorescent signal emitted by the reporter group will be absorbed by the quencher group. During the PCR amplification process, the 5'-3' nuclease activity of the Taq enzyme will hydrolyze the probe, separating the fluorescent reporter group and the quencher group, thereby detecting the fluorescent signal. The intensity of the fluorescent signal is also proportional to the concentration of the amplified dsDNA.

[0133] In certain embodiments, the nucleic acid for detecting the methylation status of a target gene further comprises a blocker that preferentially binds to a target sequence in an unmethylated state.

[0134] Blockers are intended to enhance the amplification specificity of PCR amplification primers. The 5' end of the blocker nucleotide sequence overlaps with the 3' end of the forward or reverse primer by 5 nucleotides or more. The blocker and the forward or reverse primer are complementary to the same strand of the target gene target sequence DNA. The melting temperature of the blocker is 5°C or higher than that of the forward or reverse primer. The blocker nucleotide sequence contains at least one CpG dinucleotide sequence and is complementary to the sequence of the unmethylated target gene target sequence DNA after bisulfite conversion. Therefore, when the genomic DNA of the biological sample to be tested is a mixture of methylated and unmethylated DNA, especially when the amount of methylated DNA is far less than that of unmethylated DNA, the unmethylated DNA, after bisulfite conversion, will preferentially bind to the blocker, thereby preventing the DNA template from binding to the PCR reaction, and thus preventing PCR amplification. The methylated DNA, however, does not bind to the blocker and instead binds to the primers, resulting in PCR amplification. The amplified fragments are then directly or indirectly detected.

[0135] In certain embodiments, the composition for detecting ovarian lesions further comprises a reagent for converting the unmethylated cytosine base at position 5 of the target sequence of the target gene into uracil. The reagent is capable of converting the unmethylated cytosine base at position 5 (C5) in the target sequence of the target gene into uracil (U) under specific conditions, and the reagent can be a bisulfite, typically sodium bisulfite. Under weakly acidic conditions, bisulfite (HSO 3-) can bind to the 6-position of unmethylated cytosine (C), while methylated cytosine (5-methylcytosine, 5-mC) does not bind. Subsequently, through alkaline treatment, the unmethylated cytosine bound to bisulfite is deaminated and desulfited, and ultimately converted to uracil (U).

[0136] DNA methylation is a common epigenetic modification that affects gene expression by adding a methyl group to the cytosine base of the DNA molecule. Under normal circumstances, cytosine bases in DNA can be either methylated or unmethylated. However, in certain disease states, such as ovarian cancer, the methylation status of specific genes may change. To detect changes in this methylation status, a method has been developed that converts unmethylated cytosine bases into uracil. This conversion process is typically achieved using a bisulfite reagent. Bisulfite reacts with unmethylated cytosine, converting it to uracil, while methylated cytosine is unaffected by this conversion.

[0137] In another embodiment, an oligonucleotide for detecting ovarian lesions is provided, wherein the oligonucleotide comprises a fragment of at least 9 nucleotides of a sequence as shown in any one of SEQ ID NOs: 1 to 4 or its complementary sequence and comprising at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides of a sequence as shown in any one of SEQ ID NOs: 5 to 8 or its complementary sequence and comprising at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides of a sequence as shown in any one of SEQ ID NOs: 9 to 12 or its complementary sequence and comprising at least one CpG dinucleotide sequence.

[0138] Specifically, the oligonucleotide targeting the EPS8L1 gene includes a fragment of at least 9 nucleotides in the sequence shown in any one of SEQ ID NOs: 1 to 4 or its complementary sequence and contains at least one CpG dinucleotide sequence.

[0139] An oligonucleotide targeting the EMX2OS gene comprises a fragment of at least 9 nucleotides of a sequence as shown in any one of SEQ ID NOs: 5 to 8 or a complementary sequence thereof and contains at least one CpG dinucleotide sequence.

[0140] An oligonucleotide targeting the CAPN2 gene comprises a fragment of at least 9 nucleotides of a sequence as shown in any one of SEQ ID NOs: 9 to 12 or a complementary sequence thereof and contains at least one CpG dinucleotide sequence.

[0141] In certain embodiments, the oligonucleotide for detecting ovarian lesions comprises a fragment of at least 9 nucleotides in the sequence after bisulfite conversion of the sequence shown in any one of SEQ ID NOs: 1 to 4 or its complementary sequence and comprising at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides in the sequence after bisulfite conversion of the sequence shown in any one of SEQ ID NOs: 5 to 8 or its complementary sequence and comprising at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides in the sequence after bisulfite conversion of the sequence shown in any one of SEQ ID NOs: 9 to 12 or its complementary sequence and comprising at least one CpG dinucleotide sequence.

[0142] Specifically, oligonucleotides targeting the sequence after bisulfite conversion of the EPS8L1 gene include sequences shown as SEQ ID NO: 13 and SEQ ID NO: 14, or sequences shown as SEQ ID NO: 15 and SEQ ID NO: 16.

[0143] Oligonucleotides targeting the sequence of the EMX2OS gene after bisulfite conversion include sequences such as SEQ ID NO: 17 and SEQ ID NO: 18, or sequences such as SEQ ID NO: 19 and SEQ ID NO: 20.

[0144] Oligonucleotides targeting the sequence after bisulfite conversion of the CAPN2 gene include sequences such as SEQ ID NO: 21 and SEQ ID NO: 22, or sequences such as SEQ ID NO: 23 and SEQ ID NO: 24.

[0145] In certain embodiments, the oligonucleotides for detecting ovarian lesions further include a fragment of at least 15 nucleotides of the sequence as shown in any one of SEQ ID NOs: 1 to 4 or its complementary sequence and comprising at least one CpG dinucleotide sequence that hybridizes under moderately stringent or highly stringent conditions; and / or a fragment of at least 15 nucleotides of the sequence as shown in any one of SEQ ID NOs: 5 to 8 or its complementary sequence and comprising at least one CpG dinucleotide sequence; and / or a fragment of at least 15 nucleotides of the sequence as shown in any one of SEQ ID NOs: 9 to 12 or its complementary sequence and comprising at least one CpG dinucleotide sequence.

[0146] Specifically, the oligonucleotide targeting the EPS8L1 gene includes a fragment of at least 15 nucleotides that hybridizes to the sequence shown in any one of SEQ ID NOs: 1 to 4 or its complementary sequence under moderately stringent or highly stringent conditions and contains at least one CpG dinucleotide sequence.

[0147] The oligonucleotide targeting the EMX2OS gene comprises a fragment of at least 15 nucleotides that hybridizes to the sequence shown in any one of SEQ ID NOs: 5 to 8 or its complementary sequence under moderately stringent or highly stringent conditions and contains at least one CpG dinucleotide sequence.

[0148] The oligonucleotide targeting the CAPN2 gene includes a fragment of at least 15 nucleotides that hybridizes to the sequence shown in any one of SEQ ID NOs: 9 to 12 or its complementary sequence under moderately stringent or highly stringent conditions and contains at least one CpG dinucleotide sequence.

[0149] In certain embodiments, the oligonucleotides for detecting ovarian lesions further include a fragment that hybridizes under moderately stringent or highly stringent conditions to at least 15 nucleotides of the sequence of any one of SEQ ID NOs: 1 to 4 or its complementary sequence after bisulfite conversion and contains at least one CpG dinucleotide sequence; and / or a fragment that hybridizes under moderately stringent or highly stringent conditions to at least 15 nucleotides of the sequence of any one of SEQ ID NOs: 5 to 8 or its complementary sequence after bisulfite conversion and contains at least one CpG dinucleotide sequence; and / or a fragment that hybridizes under moderately stringent or highly stringent conditions to at least 15 nucleotides of the sequence of any one of SEQ ID NOs: 9 to 12 or its complementary sequence after bisulfite conversion and contains at least one CpG dinucleotide sequence.

[0150] Specifically, the oligonucleotide targeting the EPS8L1 gene includes a sequence such as SEQ ID NO: 25 or SEQ ID NO: 26;

[0151] An oligonucleotide targeting the EMX2OS gene, comprising a sequence such as SEQ ID NO: 27 or SEQ ID NO: 28;

[0152] The oligonucleotide targeting the CAPN2 gene includes a sequence such as SEQ ID NO: 29 or SEQ ID NO: 30.

[0153] In certain embodiments, oligonucleotides for detecting ovarian lesions include a blocking agent that preferentially binds to a target sequence in an unmethylated state.

[0154] In another embodiment, a kit comprises the composition and the oligonucleotide described above, and further comprises at least one other component selected from the group consisting of nucleoside triphosphates, DNA polymerase, and a buffer required for the function of the DNA polymerase.

[0155] Typically, the kit also includes a container for holding a patient biological sample. Furthermore, the kit also includes instructions, such as instructions for use and interpretation of the test results. Samples for testing include: cell lines, histological sections, tissue biopsies / paraffin-embedded tissues, body fluids, stool, colonic effluent, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, or a combination thereof.

[0156] It is understood that the present application also relates to the use of the above-mentioned composition and oligonucleotide in the preparation of a kit for detecting ovarian lesions.

[0157] Specifically, it relates to the use of EPS8L1 gene, EMX2OS gene and / or CAPN2 gene in preparing a kit for detecting ovarian lesions.

[0158] Use of a fragment of at least 9 nucleotides of a sequence as shown in any one of SEQ ID NOs: 1 to 4 or its complementary sequence and comprising at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides of a sequence as shown in any one of SEQ ID NOs: 5 to 8 or its complementary sequence and comprising at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides of a sequence as shown in any one of SEQ ID NOs: 9 to 12 or its complementary sequence and comprising at least one CpG dinucleotide sequence in the preparation of a kit for detecting ovarian lesions.

[0159] Use of sequences as shown in SEQ ID NO:13 and SEQ ID NO:14, and / or sequences as shown in SEQ ID NO:15 and SEQ ID NO:16, and / or sequences as shown in SEQ ID NO:17 and SEQ ID NO:18, sequences as shown in SEQ ID NO:19 and SEQ ID NO:20, and / or sequences as shown in SEQ ID NO:21 and SEQ ID NO:22, and / or sequences as shown in SEQ ID NO:23 and SEQ ID NO:24 in the preparation of a kit for detecting ovarian lesions.

[0160] Use of a fragment of at least 15 nucleotides of a sequence as shown in any one of SEQ ID NOs: 1 to 4 or its complementary sequence and comprising at least one CpG dinucleotide sequence; and / or a fragment of at least 15 nucleotides of a sequence as shown in any one of SEQ ID NOs: 5 to 8 or its complementary sequence and comprising at least one CpG dinucleotide sequence; and / or a fragment of at least 15 nucleotides of a sequence as shown in any one of SEQ ID NOs: 9 to 12 or its complementary sequence and comprising at least one CpG dinucleotide sequence in the preparation of a kit for detecting ovarian lesions.

[0161] Use of a sequence as shown in any one of SEQ ID NOs: 25 to 30 in preparing a kit for detecting ovarian lesions.

[0162] In another embodiment, a method for detecting ovarian lesions is provided, comprising the following steps:

[0163] 1) Isolating the target sequence or fragment of the target gene in the biological sample to be tested;

[0164] 2) determining the methylation status of the target sequence of the target gene;

[0165] 3) The status of the biological sample is judged by the detection result of the methylation status of the target sequence of the target gene, thereby realizing the detection of ovarian lesions.

[0166] In some embodiments, the method further comprises the following steps:

[0167] 1) Extracting genomic DNA from the biological sample to be tested;

[0168] 2) treating the DNA sample obtained in step 1) with a reagent to convert the unmethylated cytosine base at position 5 into uracil or other bases, that is, converting the unmethylated cytosine base at position 5 of the target sequence of the target gene into uracil or other bases, wherein the converted base has a different hybridization property from the unmethylated cytosine base at position 5 and is detectable;

[0169] 3) contacting the DNA sample treated in step 2) with a DNA polymerase and a primer for the target sequence of the target gene, so that the treated target sequence of the target gene is amplified to produce an amplified product or is not amplified; if the treated target sequence of the target gene undergoes a DNA polymerization reaction, an amplified product is produced; if the treated target sequence of the target gene does not undergo a DNA polymerization reaction, it is not amplified;

[0170] 4) Detecting the amplified product with a probe;

[0171] 5) determining the methylation status of at least one CpG dinucleotide of the target sequence of the target gene based on the presence or absence of the amplified product.

[0172] In certain embodiments, a typical primer includes a fragment of the target sequence of the target gene, wherein the fragment of the target sequence of the target gene comprises a fragment of at least 9 nucleotides that is identical, complementary, or hybridizes under moderately stringent or stringent conditions to any one of SEQ ID NOs: 1 to 12.

[0173] Specifically, the primers are sequences of SEQ ID NO: 13 and SEQ ID NO: 14, or sequences of SEQ ID NO: 15 and SEQ ID NO: 16, or sequences of SEQ ID NO: 17 and SEQ ID NO: 18, or sequences of SEQ ID NO: 19 and SEQ ID NO: 20, or sequences of SEQ ID NO: 21 and SEQ ID NO: 22, or sequences of SEQ ID NO: 23 and SEQ ID NO: 24.

[0174] In certain embodiments, a typical probe comprises a fragment of the target sequence of the target gene, wherein the fragment of the target sequence of the target gene comprises a fragment of at least 15 nucleotides that is identical, complementary, or hybridizes under moderately stringent or stringent conditions to any one of SEQ ID NOs: 1 to 12.

[0175] Specifically, the probe is the sequence of SEQ ID NO: 25, or the sequence of SEQ ID NO: 26, or the sequence of SEQ ID NO: 27, or the sequence of SEQ ID NO: 28, or the sequence of SEQ ID NO: 29, or the sequence of SEQ ID NO: 30.

[0176] In the present application, the contacting or amplifying includes using at least one of the following methods: using a thermostable DNA polymerase as the amplification enzyme, using a polymerase lacking 5'-3' exonuclease activity, using polymerase chain reaction (PCR), and generating amplification product nucleic acid molecules with a detectable label.

[0177] In this application, a series of methods within the framework of polymerase chain reaction (PCR) technology are used to accurately determine the methylation status of at least one CpG dinucleotide in the target sequence of the target gene. These methods cover advanced means such as "fluorescence-based real-time PCR technology", methylation-sensitive single nucleotide primer extension reaction (Ms-SNuPE), methylation-specific PCR (MSP) and methylated CpG island amplification (MCA). Among them, "fluorescence-based real-time PCR" technology is particularly prominent as a high-throughput and quantitative methylation detection strategy. This technology uses the TaqMan principle to directly realize real-time monitoring of fluorescent signals during PCR amplification without the need for subsequent tedious operations. Specifically, the process begins with the pretreatment of genomic DNA, that is, the DNA is converted into a sequence difference pool reflecting the methylation status through sodium bisulfite reaction. Subsequently, specially designed "offset" PCR primers covering known CpG dinucleotides are used to initiate fluorescence-based PCR amplification. This process not only introduces sequence differences in the amplification stage, but also enables differentiation at the level of fluorescent signal detection. In the quantitative "fluorescence-based real-time PCR" mode, methylation-specific amplification is facilitated by specially designed fluorescent probes (such as TaqMan or Lightcycler probes), which are highly sensitive to sequence differences at the hybridization level. Of particular note, TaqMan probes incorporate a fluorescent reporter group and a quencher molecule and are designed for regions with high GC content, ensuring a high melting temperature and maintaining a stable hybridization state during PCR cycles. When Taq polymerase synthesizes a new strand during PCR and encounters the annealed TaqMan probe, its 5' to 3' endonuclease activity cleaves the probe, releasing the fluorescent reporter molecule, which is then captured and quantified by the real-time fluorescence detection system. Furthermore, the typical reagent combination required for performing "fluorescence-based real-time PCR" analysis includes, but is not limited to, custom PCR primers specific to the target gene sequence, nonspecific amplification inhibitors, optimized TaqMan or Lightcycler probes, PCR buffer and deoxynucleotide mix, and key components such as highly active Taq polymerase. The careful combination of these reagents ensures accurate and sensitive methylation status determination.

[0178] In certain embodiments, the methylation level of at least one CpG dinucleotide within the target sequence of the target gene is accurately defined by the critical cycle threshold (Ct value) of the real-time polymerase chain reaction (PCR). By analyzing the DNA in the biological sample with the real-time PCR technology, we can efficiently evaluate the methylation status of the target sequence of the target gene. This method not only simplifies the operation process, but also allows us to quickly and intuitively determine whether the sample is a positive result based on the critical Ct value of the PCR reaction. Therefore, this strategy constitutes a non-invasive and rapid means of screening for ovarian lesions, providing strong support for the early detection of ovarian lesions. By accurately measuring the Ct value, we can achieve a quantitative assessment of the methylation level of the sample, thereby providing a key basis for the potential diagnosis of ovarian lesions.

[0179] In certain embodiments, the biological sample is selected from a cell line, histological section, tissue biopsy / paraffin-embedded tissue, body fluid, stool, colon effluent, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, or a combination thereof.

[0180] The inventors of this application have discovered that the methylation status of the target sequences of the EPS8L1, EMX2OS, and CAPN2 genes in ovarian cancer tissue differs significantly from that in normal tissue: in ovarian cancer tissue, the target sequences of the EPS8L1, EMX2OS, and CAPN2 genes are methylated, whereas in normal tissue, the target sequences of the EPS8L1, EMX2OS, and CAPN2 genes are not methylated. Therefore, this application provides a method for detecting ovarian cancer by detecting the methylation status of the target sequences of the EPS8L1, EMX2OS, and CAPN2 genes in a sample. The method provided in this application is capable of non-invasive and rapid detection of ovarian cancer.

[0181] Example

[0182] This application provides general and / or specific descriptions of the materials and experimental methods used in the experiments. In the following examples, unless otherwise specified, % represents wt%, i.e., mass fraction. All reagents or instruments used without indicating the manufacturer are commercially available conventional reagents.

[0183] Example 1 Primer and probe test

[0184] Fifteen ovarian cancer tissues, nine ovarian cancer adjacent tissues, and 86 healthy subjects' plasma data were selected for next-generation sequencing:

[0185] Calculation of CpG differences: The average methylation level of each CpG site in cancer tissue and adjacent tissue was calculated separately, and adjacent CpG sites were merged to generate MergeBin: the merging rules were: delta (cancer tissue - adjacent tissue) > 0, the distance between adjacent CpG sites < = 30bp, and the number of CpG sites covered in MergeBin > = 5. MergeBin was filtered: the rules were as follows: a) 80% of the samples were required to meet the average deduplication depth in the MergeBin interval > 20X; b) the proportion of samples with methylation levels in the MergeBin of cancer tissue greater than the 80% percentile of adjacent tissue was > = 0.5, delta (cancer tissue - adjacent tissue) > = 0.02, and the average methylation level in the plasma of 86 healthy people was < 0.02, thus obtaining a batch of candidate markers; finally, real-time PCR verification was performed on ovarian cancer tissue, ovarian cancer plasma, and healthy human plasma to identify three specific markers: EPS8L1 gene, EMX2OS gene, and CAPN2 gene.

[0186] Primers and probes were designed based on the determined target sequences of EPS8L1 gene, EMX2OS gene and CAPN2 gene. The designed primer and probe sequences are shown in Table 2 above.

[0187] Table 2 Primers and probes targeting EPS8L1, EMX2OS and CAPN2 genes

[0188]

[0189]

[0190] Note: “F” indicates forward primer; “R” indicates reverse primer; “P” indicates probe.

[0191] Normal human white blood cell (WBC) cell line DNA is usually in a low / unmethylated state and can be used as a negative control. The amount of DNA used in this embodiment is 15.75 ng / reaction; fully methylated DNA is in a high / fully methylated state and can be used as a positive control. The amount of DNA used in this embodiment is 200 pg / reaction. The DNA sample is first subjected to bisulfite conversion, and the converted BisDNA is used as a template to perform real-time PCR amplification using the above-mentioned primer probes. Using the β-actin (ACTB) gene as an internal reference, a β-actin gene amplicon is created by using primers complementary to the β-actin gene sequence, and the β-actin gene amplicon is detected using a specific probe. Each sample is subjected to at least one real-time PCR, and in some specific embodiments, two or three real-time PCR tests are performed. The PCR system for the primer probe test is shown in Table 3 below.

[0192] Table 3 PCR system for primer and probe testing

[0193] Volume (μl) Final concentration TaqDNA Polymerase (Biochain) 1.2 / 4.2×buffer(Biochain) 11.9 1× Forward primer F (10 μM) 1.0 200nM Reverse primer R (10 μM) 1.0 200nM Probe P (10 μM) 1.0 200nM ACTB_F (10μM) 0.5 100nM ACTB_R (10μM) 0.5 100nM ACTB_P (10μM) 0.375 75nM BisDNA 4.0 / <![CDATA[H2O]]> 19.05 / Total 50.0 /

[0194] Note: “F” indicates forward primer; “R” indicates reverse primer; “P” indicates probe.

[0195] The PCR amplification program used was: 94°C, 20 min; 45 cycles (93°C, 30 s; 57°C, 35 s - read the fluorescence signal); 40°C, 5 s.

[0196] The results are shown in Table 4. As shown, when BisDNA of fully methylated DNA was used as a template, EPS8L1, EMX2OS and CAPN2 genes were all effectively amplified; however, when BisDNA of WBC was used as a template, except for the internal reference gene ACTB, the other target genes were not amplified.

[0197] Table 4 EPS8L1, EMX2OS and CAPN2 gene primer probe test results

[0198]

[0199] “NoCt” indicates that the Ct value was not detected.

[0200] Furthermore, by analyzing the primer probe test results of EPS8L1, EMX2OS and CAPN2 genes, the optimal target sequences for these three target genes were determined. The optimal target sequences are shown in Table 5 below:

[0201] Table 5 Optimal target sequences for EPS8L1, EMX2OS and CAPN2 genes

[0202]

[0203]

[0204] Note: “F” indicates forward primer; “R” indicates reverse primer; “P” indicates probe.

[0205] Example 2

[0206] Sixteen ovarian cancer tissue samples (10 ng / reaction) and 21 benign ovarian disease tissue samples (10 ng / reaction) were selected, including four fibroids, five cysts, seven teratomas, three serous cystadenomas, and two mucinous cystadenomas. Genomic DNA was extracted and converted to BisDNA using bisulfite. Methylation of the EPS8L1, EMX2OS, and CAPN2 genes was then assayed using the PCR reaction system described in Table 6 and the protocol described in Example 1. Finally, real-time PCR Ct values ​​for the target gene sequences of interest were determined for the 16 ovarian cancer tissue samples and 21 benign disease tissue samples. Ct values ​​for EPS8L1, EMX2OS, and CAPN2 methylation were used to calculate the Ct values. A Ct value ≥ 41 for each marker was considered negative, while a Ct value less than 41 for any two of the three markers was considered positive. The results are shown in Tables 7 and 8.

[0207] Table 6 PCR system with optimal primer combination

[0208]

[0209]

[0210] Note: “F” indicates forward primer; “R” indicates reverse primer; “P” indicates probe.

[0211] Table 7 Sensitivity detection of target genes in ovarian lesion tissues

[0212]

[0213] Table 8 Specific detection of target genes in ovarian lesion tissues

[0214]

[0215] As shown in Table 7, the sensitivity of EPS8L1, EMX2OS, and CAPN2 genes alone for detecting ovarian cancer tissue was 87.5%, 75.0%, and 87.5%, respectively. A positive interpretation of two of the three genes was considered positive, resulting in a final interpretation sensitivity of 100%. As shown in Table 8, methylation of the target gene sequences showed good specificity, with specificities exceeding 90% for EMX2OS and CAPN2, at 95.2% and 90.5%, respectively. A negative interpretation of two of the three genes was considered negative, with a specificity of 90.5%.

[0216] Example 3

[0217] 35 ovarian cancer plasma samples (3.5 mL), 31 normal human plasma samples (3.5 mL), and 30 benign ovarian disease plasma samples (3.5 mL) were selected, including 5 fibroids, 8 cysts, 8 teratomas, 7 serous cystadenomas, and 2 mucinous cystadenomas. Genomic DNA was extracted and converted to BisDNA via bisulfite. Methylation detection was performed using the PCR reaction system described in Example 1, in combination with EPS8L1, EMX2OS, and CAPN2 genes. Finally, the real-time PCR Ct values ​​for the target gene sequences of the 35 ovarian cancer plasma samples, 31 normal human plasma, and 30 benign ovarian disease samples were measured (Ct>=41 was negative). Positive results were interpreted as positive if two of the three genes tested positive, and negative results were interpreted as negative if two of the three markers tested negative.

[0218] Table 9 Combined detection of EPS8L1, EMX2OS and CAPN2 genes in plasma

[0219]

[0220] The results are shown in Table 9 below. The sensitivities of EPS8L1, EMX2OS, and CAPN2 genes alone for detecting ovarian cancer were 80.0%, 68.6%, and 77.1%, respectively. The overall sensitivity reached 91.4%, the specificity for normal subjects was 93.5%, and the specificity for benign ovarian disease was 83.3%.

[0221] The above experimental results show that methylated DNA of the target gene target sequence is a marker for benign and malignant ovarian lesions. Through the detection of methylated DNA of the target gene target sequence of the present invention, non-invasive in vitro detection of ovarian cancer can be achieved and the detection rate of ovarian cancer can be improved.

[0222] The above description is merely a preferred embodiment of the present application and is not intended to limit the present application in any other manner. Any person skilled in the art may utilize the above disclosed technical content to modify or modify the present application into equivalent embodiments with equivalent variations. However, any simple modifications, equivalent variations, and modifications to the above embodiments that do not depart from the technical content of the present application and are based on the technical essence of the present application shall still fall within the scope of protection of the present application.

Claims

1. A composition for detecting ovarian lesions, comprising: Nucleic acid used to detect the methylation status of target genes, Wherein, the methylation status of the target gene is characterized by the methylation of the target sequence of the target gene; The target gene includes one or more of the EPS8L1 gene, the EMX2OS gene and the CAPN2 gene.

2. The composition according to claim 1, wherein the target sequence of the EPS8L1 gene is as shown in any one of SEQ ID NOs: 1 to 4 or the target sequence of the EPS8L1 gene includes the sequence as shown in any one of SEQ ID NOs: 1 to 4; The target sequence of the EMX2OS gene is as shown in any one of SEQ ID NOs: 5 to 8, or the target sequence of the EMX2OS gene includes the sequence shown in any one of SEQ ID NOs: 5 to 8; The target sequence of the CAPN2 gene is as shown in any one of SEQ ID NOs: 9 to 12, or the target sequence of the CAPN2 gene includes the sequence as shown in any one of SEQ ID NOs: 9 to 12.

3. The composition according to claim 1 or 2, wherein the nucleic acid for detecting the methylation status of the target gene comprises: A primer, wherein the primer is a fragment of at least 9 nucleotides in the target sequence of the target gene, and the fragment contains at least one CpG dinucleotide sequence; Preferably, the fragment of at least 9 nucleotides is a sequence of SEQ ID NO: 13 and SEQ ID NO: 14, or a sequence of SEQ ID NO: 15 and SEQ ID NO: 16, or a sequence of SEQ ID NO: 17 and SEQ ID NO: 18, or a sequence of SEQ ID NO: 19 and SEQ ID NO: 20, or a sequence of SEQ ID NO: 21 and SEQ ID NO: 22, or a sequence of SEQ ID NO: 23 and SEQ ID NO:

24.

4. The composition according to claim 1 or 2, wherein the nucleic acid for detecting the methylation status of the target gene comprises: A probe, wherein the probe is a fragment of at least 15 nucleotides that hybridizes to a target sequence of the target gene under moderately stringent or highly stringent conditions, wherein the fragment comprises at least one CpG dinucleotide sequence; Preferably, the fragment of at least 15 nucleotides is the sequence of SEQ ID NO: 25, or the sequence of SEQ ID NO: 26, or the sequence of SEQ ID NO: 27, or the sequence of SEQ ID NO: 28, or the sequence of SEQ ID NO: 29, or the sequence of SEQ ID NO:

30. 5 . The composition according to claim 1 , further comprising a reagent for converting the unmethylated cytosine base at position 5 of the target sequence of the target gene into uracil.

6. An oligonucleotide for detecting ovarian lesions, comprising: A fragment of at least 9 nucleotides of a sequence as shown in any one of SEQ ID NOs: 1 to 4 or a complementary sequence thereof and comprising at least one CpG dinucleotide sequence; and / or A fragment of at least 9 nucleotides of the sequence shown in any one of SEQ ID NOs: 5 to 8 or its complementary sequence and comprising at least one CpG dinucleotide sequence; and / or A fragment of at least 9 nucleotides of a sequence as shown in any one of SEQ ID NOs: 9 to 12 or a complementary sequence thereof and comprising at least one CpG dinucleotide sequence.

7. The oligonucleotide according to claim 6, further comprising: A fragment that hybridizes to at least 15 nucleotides of the sequence as shown in any one of SEQ ID NOs: 1 to 4 or its complementary sequence under moderately stringent or highly stringent conditions and contains at least one CpG dinucleotide sequence; and / or A fragment of at least 15 nucleotides of a sequence as shown in any one of SEQ ID NOs: 5 to 8 or a complementary sequence thereof and comprising at least one CpG dinucleotide sequence; and / or A fragment of at least 15 nucleotides of a sequence as shown in any one of SEQ ID NOs: 9 to 12 or a complementary sequence thereof and comprising at least one CpG dinucleotide sequence.

8. A kit comprising the composition according to any one of claims 1 to 5 or the oligonucleotide according to claim 6 or 7.

9. Use of the composition according to any one of claims 1 to 5 or the oligonucleotide according to claim 6 or 7 in the preparation of a kit for detecting ovarian lesions.

10. Use of one or more of the EPS8L1 gene, the EMX2OS gene, and the CAPN2 gene in the preparation of a kit for detecting ovarian lesions.

Images