RPA-CRISPR / Cas13a detection system for early metastasis of colorectal cancer and application of RPA-CRISPR / Cas13a detection system

The RPA-CRISPR/Cas13a detection system was used to detect the internal m7G modification of SDK1 mRNA and CRC cfRNA, which solved the problem of insufficient sensitivity and specificity in the diagnosis of early colorectal cancer metastasis in existing technologies, achieved accurate support for early diagnosis and treatment, and improved patient prognosis.

CN120648805APending Publication Date: 2025-09-16AFFILIATED HOSPITAL OF NANTONG UNIV
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202510986565.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-17
Publication Date
2025-09-16

AI Technical Summary

Technical Problem

The existing clinical risk scoring system has limitations in predicting distant metastasis of colorectal cancer, and the sensitivity and specificity of existing biomarkers are limited, making it difficult to support early diagnosis and optimization of treatment strategies.

Method used

To develop an RPA-CRISPR/Cas13a detection system for detecting internal m7G modification of SDK1 mRNA and CRC cfRNA, combining fluorescence detection and blue light irradiation detection methods to provide higher sensitivity and specificity for early metastasis diagnosis.

Benefits of technology

It has achieved accurate detection of early lymph node metastasis of colorectal cancer, improved the sensitivity and specificity of diagnosis, provided technical support for early treatment, and improved patients' prognosis and quality of life.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120648805A_ABST
    Figure CN120648805A_ABST
Patent Text Reader

Abstract

The invention discloses an RPA-CRISPR / Cas13a detection system for early metastasis of colorectal cancer and application of the RPA-CRISPR / Cas13a detection system, and relates to the technical field of biological medicines. The RPA-CRISPR / Cas13a detection system comprises an RPA primer combination and a crRNA (Complementary Ribonucleic Acid) combination, the RPA primer combination comprises an RPA primer pair for detecting m7G modification in SDK1mRNA and an RPA primer pair for detecting CRC cfRNA (Cyclic Redundancy Check Factor Ribonucleic Acid), the crRNA combination comprises crRNA of which the nucleotide sequence is as shown in SEQ ID NO. 14 and crRNA of which the nucleotide sequence is as shown in SEQ ID NO. 19. The detection system can be used for detecting m7G modification in SDK1mRNA and CRC cfRNA, so that technical support is provided for prediction of early metastasis of colorectal cancer.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to an RPA-CRISPR / Cas13a detection system for early metastasis of colorectal cancer and applications thereof. Background Art

[0002] Colorectal cancer is the third most common cancer (accounting for 9.6% of all cancer cases) and the second most common cause of cancer mortality (accounting for 9.3% of all cancer deaths). According to AJCC stage stratification, the 5-year survival rate for stage I colon and rectal cancer is >90%, but it drops to 12%-16% for stage IV disease. Approximately 60% of patients with stage IV colorectal cancer will develop liver metastases, with the lung being the second most common site of metastasis. The tumor-node-metastasis (TNM) staging system is currently widely used in clinical practice due to its prognostic power and the simplicity of N staging. Currently, only clinical risk scores based on standard pathological and clinical variables can be used to stratify patients with resected distant metastases. However, clinical risk scores have limitations. They are often derived from single-institution patient cohorts and are subject to local practice patterns and biases, making them difficult to validate across institutions, particularly in long-term follow-up and in patients receiving neoadjuvant chemotherapy. Furthermore, their prognostic reliability is insufficient to influence clinical decision-making. Furthermore, existing histopathological and molecular classifications are incomplete in predicting distant metastases, limiting the optimization of treatment strategies. Identifying cancer-related biomarkers is of great significance for early diagnosis, improving patient prognosis, and assessing the risk of recurrence. Although numerous biomarkers have been extensively studied and analyzed, there are only a few biomarkers associated with colorectal cancer lymph node metastasis. Currently, only a few are recognized, such as DNA mismatch repair deficiency (MSI phenotype) and KRAS and BRAF mutations. However, not all colorectal cancers will develop MSI, KRAS, and BRAF mutations. Since the sensitivity and specificity of these markers for the diagnosis of colorectal cancer lymph node metastasis are still limited, the development of new and more effective serum markers has become urgent.

[0003] Sidekick Cell Adhesion Molecule 1 (SDK1) is encoded by the SDK gene and is a type I transmembrane molecule. Its extracellular segment contains six immunoglobulin (Ig)-like domains. This protein belongs to the immunoglobulin superfamily (IgSF), many members of which mediate cell-to-cell adhesion. Researchers have found that in vertebrates, SDKs can mediate cell-cell adhesion with homology specificity: SDK1 binds to SDK1, and SDK2 binds to SDK2. More than 170 chemical modifications have been detected in almost all types of cellular RNA. mRNA 7G modification is a positively charged RNA chemical modification. In 1975, it was found that this modification is commonly located at the 5' end of mRNA, namely the 5' cap structure of mRNA (m 7 G-cap) It is formed by RNA guanine-7 methyltransferase at the initiation stage of transcription, which can protect mRNA from extranuclear cleavage and decay, and regulate pre-mRNA splicing and mRNA translation. 7 G is an important modification at the 5' end of mature mRNA in eukaryotes and is closely related to the regulation of mRNA output, translation and splicing. 7 G is also present in tRNA and rRNA. The METTL1-WDR4 complex is located at position 46 of the human tRNA ring (m 7 G46) deposition m 7 G tagging stabilizes tRNA and regulates translation efficiency METTL1-WDR4-mediated m 7 G can also weaken ribosome pauses, enhance mRNA translation, regulate the self-renewal and differentiation of embryonic stem cells, and promote tumor progression. In 2019, He Chuan et al. found that m 7 G modification also exists in the mRNA, that is, m 7 G modification can be detected by different methods, including enzyme treatment and liquid chromatography tandem mass spectrometry (LC-MS / MS), m 7 G methylated RNA immunoprecipitation sequencing (MeRIP-seq), chemically assisted dm 7 G sequencing, m 7 G mutation analysis sequencing, and m 7 G individual nucleotide resolution cross-linking and immunoprecipitation sequencing (miCLIP-seq). Studies have shown that there is mRNA inside the SDK1 gene 7 G modification, and the m inside the SDK1 gene mRNA 7 G modification promotes lymph node metastasis in colorectal cancer. 7 The G modification is particularly sensitive to mild reduction with sodium borohydride (NaBH4) and has been used in m 7 G modification creates a basic site at the RNA position.

[0004] Cell-free RNA (cfRNA) is a highly promising biomarker for longitudinal monitoring of a variety of diseases, including cancer, infectious diseases, bone marrow transplantation, obstetric disorders, neurodegenerative diseases, and liver disease. In the bloodstream, cfRNA can exist freely, bound to proteins or lipids, or encapsulated in membrane-bound microvesicles such as exosomes. This diverse existence confers cfRNA high stability, facilitating its transport and detection within the body. Under physiological and pathological conditions, RNA and DNA are actively or passively released during cell apoptosis or necrosis. Compared to whole blood cellular RNA, plasma cfRNA and whole blood cellular RNA provide complementary information. Whole blood RNA primarily reflects the status of circulating active blood cells, while cfRNA originates from tissues and blood cells and is a product of cell death and secretion. Therefore, cfRNA detection can help locate the source of tumors. cfRNA can be extracted from a variety of body fluids, including whole blood, plasma, serum, and urine. Plasma has relatively high cfRNA concentrations, making it the primary source of cfRNA extraction. However, cfRNA detection also faces several challenges: its low concentration makes it susceptible to interference from microbial contamination, environmental DNA and RNA contamination, and endogenous DNA in the sample. Furthermore, plasma contamination by cellular genomic RNA is also a concern. Therefore, strict measures must be taken when collecting, processing, and storing blood samples to ensure the integrity of cfRNA and the accuracy of detection.

[0005] Recombinase polymerase amplification (RPA) is a novel isothermal amplification technology. It can operate at relatively low temperatures (37°C-42°C), has a short reaction time, does not require complex and expensive instrumentation, is simple to operate, and has the potential to replace PCR. CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) was first discovered in the bacterial immune system and is a revolutionary gene editing technology. With the discovery of CRISPR system-associated proteins such as Cas9, Cas12a, Cas13a, and Cas14a, the CRISPR system has been widely used in nucleic acid detection. The Cas13 protein is the RNA-guided component of the bacterial adaptive immune system, directly targeting single-stranded (ss) RNA substrates. Cas13 complexes with CRISPR RNA (crRNA) containing a programmable spacer sequence to form a nuclease-inactive ribonucleoprotein complex (RNP). When the RNP binds to a complementary target RNA, it activates the HEPN (higher eukaryotic and prokaryotic nucleotide-binding domain) motif of Cas13, which can then cleave any surrounding ssRNA. Target RNA binding and subsequent Cas13 cleavage activity can be detected by a fluorophore-quencher pair linked by ssRNA, which fluoresces upon active Cas13 cleavage.

[0006] Based on this, the present invention intends to construct a dual detection method based on RPA and CRISPR / Cas13a for detecting mRNA inside SDK1mRNA. 7 G modification and CRC cfRNA to develop new auxiliary diagnostic products for early lymph node metastasis of colorectal cancer. Summary of the Invention

[0007] The purpose of the present invention is to provide an RPA-CRISPR / Cas13a detection system for early metastasis of colorectal cancer and its application to solve the problems existing in the above-mentioned prior art. The detection system can be used to detect SDK1 mRNA internal m 7 G modification and CRC cfRNA, thus providing technical support for the prediction of early metastasis of colorectal cancer.

[0008] To achieve the above object, the present invention provides the following solutions:

[0009] The present invention provides an RPA-CRISPR / Cas13a detection system for early metastasis of colorectal cancer, comprising an RPA primer combination and a crRNA combination;

[0010] The RPA primer combination includes detection of SDK1 mRNA internal m 7 G-modified RPA primer pairs and RPA primer pairs for detecting CRC cfRNA;

[0011] The detection of SDK1 mRNA internal m 7 The G-modified RPA primer pair includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.5 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.6;

[0012] The RPA primer pair for detecting CRC cfRNA includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.11 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.12;

[0013] The crRNA combination includes a crRNA with a nucleotide sequence as shown in SEQ ID NO.14 and a crRNA with a nucleotide sequence as shown in SEQ ID NO.19.

[0014] Furthermore, the RPA-CRISPR / Cas13a detection system also includes a probe RNA Reporter, whose nucleotide sequence is UUUUUU.

[0015] Furthermore, the RPA-CRISPR / Cas13a detection system also includes Cas13a nuclease.

[0016] The present invention also provides the use of a reagent for detecting a biomarker combination in the preparation of a detection product for predicting early metastasis of colorectal cancer, wherein the biomarker combination includes SDK1 mRNA internal mRNA 7 G modification and CRC cfRNA;

[0017] The nucleotide sequence of the CRC cfRNA is shown in SEQ ID NO.1;

[0018] The SDK1 mRNA internal m 7 The nucleotide sequence corresponding to the G modification is shown in SEQ ID NO.2.

[0019] Furthermore, the reagent includes the above-mentioned RPA-CRISPR / Cas13a detection system.

[0020] Furthermore, the detection product is a kit.

[0021] The present invention also provides a detection product for predicting early metastasis of colorectal cancer, including reagents for detecting a combination of biomarkers;

[0022] The biomarker combination includes SDK1 mRNA internal m 7 G modification and CRC cfRNA;

[0023] The nucleotide sequence of the CRC cfRNA is shown in SEQ ID NO.1;

[0024] The SDK1 mRNA internal m 7 The nucleotide sequence corresponding to the G modification is shown in SEQ ID NO.2.

[0025] Furthermore, the reagent includes the above-mentioned RPA-CRISPR / Cas13a detection system.

[0026] Furthermore, the detection product is a kit.

[0027] Furthermore, the detection product is a fluorescence detection kit.

[0028] The present invention discloses the following technical effects:

[0029] This paper innovatively developed an RPA-CRISPR / Cas13a detection system for early metastasis of colorectal cancer, which is specifically used to detect the internal mRNA of SDK1 mRNA. 7 G modification and CRC cfRNA. Compared with conventional serological marker detection methods, this detection system shows more excellent sensitivity and specificity. The present invention introduces two detection methods, fluorescence detection (FD) and blue light irradiation detection (BLID), to read RPA-CRISPR / Cas13a signals, providing an important reference for clinical technicians to select the most appropriate detection method in different laboratory environments. The RPA-CRISPR / Cas13a detection method developed by the present invention is expected to be widely used in the screening and diagnosis of colorectal cancer, helping patients to achieve early treatment, thereby significantly improving the patient's prognosis and quality of life. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0031] Figure 1 Schematic diagram of the screening process of cfRNA sequences;

[0032] Figure 2 SDK1 mRNA internal m 7 Agarose gel results of RPA after different primer pairs modified with G; NC represents a negative control;

[0033] Figure 3The agarose gel results of different primer pairs after RPA of CRC cfRNA are shown; NC represents a negative control;

[0034] Figure 4 SDK1 mRNA internal m 7 Cas13a cleavage results of different primer pairs modified with G;

[0035] Figure 5 Cas13a cleavage results of different primer pairs for CRC cfRNA;

[0036] Figure 6 Schematic diagram of the workflow of the RPA-CRISPR / Cas13a detection method;

[0037] Figure 7 Detection of different concentrations of SDK1 mRNA internal mRNA by Cas13a 7 Statistical graph of G modified fluorescence intensity; among them, 1: 1×10 1 ng / μL; 2: 1×10 0 ng / μL; 3: 1×10 -1 ng / μL; 4: 1×10 -2 ng / μL; 5: 1×10 -3 ng / μL; 6: 1×10 - 4 ng / μL; 7: 1×10 -5 ng / μL;

[0038] Figure 8 This is a statistical graph of the fluorescence intensity of CRC cfRNA detected by Cas13a at different concentrations; 1:1×10 1 ng / μL; 2: 1×10 0 ng / μL; 3: 1×10 -1 ng / μL; 4: 1×10 -2 ng / μL; 5: 1×10 -3 ng / μL; 6: 1×10 -4 ng / μL; 7: 1×10 -5 ng / μL;

[0039] Figure 9 Detection of different concentrations of SDK1 mRNA internal mRNA by Cas13a 7 Statistical graph of G modification and CRC cfRNA concentration fluorescence intensity; where 1:1×10 1 ng / μL; 2: 1×10 0 ng / μL; 3: 1×10 -1 ng / μL; 4: 1×10 -2ng / μL; 5: 1×10 - 3 ng / μL; 6: 1×10 -4 ng / μL; 7: 1×10 -5 ng / μL;

[0040] Figure 10 The results of BLID assay after cleavage by Cas13a at different target concentrations are shown;

[0041] Figure 11 RNAm 7 The chemical structure of G;

[0042] Figure 12 Schematic diagram of tissue sample and serum sample processing;

[0043] Figure 13 The internal mRNA of SDK1 mRNA in 27 pairs of colorectal cancer and adjacent tissues 7 G. Heat map of modification detection results;

[0044] Figure 14 The internal mRNA of SDK1 mRNA in 27 pairs of colorectal cancer and adjacent tissues 7 G is a scatter plot of the modification detection results;

[0045] Figure 15 The internal mRNA of SDK1 mRNA in 27 pairs of colorectal cancer and adjacent tissues 7 G is a histogram of modified fluorescence intensity;

[0046] Figure 16 The results of BLID assay after Cas13a cleavage in 27 pairs of colorectal cancer and adjacent adjacent tissues are shown;

[0047] Figure 17 Detection of SDK1 mRNA internal mRNA in 20 control serum samples by Cas13a 7 Statistical graph of fluorescence intensity of G modification;

[0048] Figure 18 Detection of SDK1 mRNA internal mRNA in 25 colorectal cancer serum samples by Cas13a 7 Statistical graph of fluorescence intensity of G modification;

[0049] Figure 19 Cas13a cleavage of SDK1 mRNA internal mRNA in 20 control serum samples 7 Macroscopic fluorescence image of G modification under blue light irradiation;

[0050] Figure 20 Cas13a cleavage of SDK1 mRNA internal mRNA in 25 colorectal cancer serum samples 7Macroscopic fluorescence image of G modification under blue light irradiation;

[0051] Figure 21 Macroscopic fluorescence images of CRC cfRNA cleaved by Cas13a in 20 control serum samples and 25 colorectal cancer serum samples under blue light illumination;

[0052] Figure 22 is the internal mRNA of SDK1 mRNA in control serum and colorectal cancer serum 7 Statistical graph of the relative amount of G levels;

[0053] Figure 23 Figure 1 is the fluorescence detection result of control serum and colorectal cancer serum;

[0054] Figure 24 The figure is the receiver operating characteristic curve of the results of 27 pairs of tissue samples;

[0055] Figure 25 The figure is the receiver operating characteristic curve of the results of 25 serum samples;

[0056] Figure 26 This is the receiver operating characteristic curve obtained by analyzing the results of lymph node metastasis samples after grouping 25 serum samples;

[0057] Figure 27 This is the receiver operating characteristic curve obtained by analyzing the results of samples without lymph node metastasis after grouping 25 serum samples. DETAILED DESCRIPTION

[0058] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0059] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0060] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0061] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.

[0062] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0063] The present invention has developed a detection product based on RPA-CRISPR / Cas13a, which is specifically used to detect mRNA inside SDK1 mRNA. 7 G modification and CRC cfRNA. First, the present invention performs bioinformatics analysis on the dataset in the GEO database. From the cfRNA sequencing data of 50 cancer tissues and 50 adjacent tissues of patients’ plasma, the most abundant cfRNA sequence is selected and used as the representative cfRNA sequence of colorectal cancer patients and named CRC cfRNA. Then, the internal mRNA of SDK1 mRNA is cleaved by chemical reduction method. 7 G was reduced. Based on the screened CRC cfRNA sequences and SDK1, RPA primers and crRNA were designed respectively. The RPA-CRISPR / Cas13a system was used to detect the internal mRNA of SDK1 mRNA. 7 G modification and CRC cfRNA, the platform combines the high efficiency of RPA with the precise cutting activity of Cas13a. At the same time, the platform covers two result reading methods: fluorescence detection (FD) and blue light irradiation detection (BLID), which can accurately detect SDK1 mRNA internal mRNA in cancer tissues and adjacent tissues. 7 G modification and CRC cfRNA gene provide an innovative solution for the auxiliary diagnosis of early lymph node metastasis of colorectal cancer. The details are as follows:

[0064] Example 1

[0065] Screening of cfRNA sequences:

[0066] In order to screen out CRC cfRNA sequences with potential research value from a large amount of data, the present invention adopts a systematic and rigorous screening process (such as Figure 1 As shown). First, the GSE174302 dataset was downloaded from the GEO database. This dataset contains SRA (Sequence Read Archive) data related to colorectal cancer (CRC) and normal controls (NC). After downloading, the original SRA format data was converted to fasta format, and preprocessed and quality controlled in fastq trim format. Next, the feature counts function in the Subread toolkit was used to generate a gene count matrix based on the gene annotation information provided by the GENCODE Consortium. Based on these count data, the top five genes with the highest expression levels were selected from all samples, including CAVIN2, MT-ND6, MAP3K7CL, LIMS1, and CD226, and their sequence information was extracted. In order to further integrate and analyze the sequence data of these genes, R language was used for data processing. The data of different samples of the same gene were integrated into a text file, and irrelevant information was deleted. At the same time, the repeated sequences were counted and sorted to determine the frequency of occurrence of each gene sequence in different samples. During this process, text files for CAVIN2, MT-ND6, MAP3K7CL, LIMS1, and CD226 genes were merged to more comprehensively analyze their expression and repetitive patterns across samples. Through these steps, a series of cfRNA sequences with potential research value were successfully screened and integrated, and the sequence with the highest number of repetitive sequences was selected as the CRC cfRNA sequence (Supplementary A).

[0067] The nucleotide sequence of the CRC cfRNA sequence screened in this example (SEQ ID NO. 1) is as follows:

[0068] ACTACTAATCAACGCCCATCCTCATACAAAGCCCCCGCGCCAATAGGAGCCTCCCG AATCAACCTGAGGGGTCTCCTTCATAAATTATTCAGCTTAAAACACTATTAAAGTTTACC ACAACCACCCCCCATCATCCTCTTTCACCCAC.

[0069] Example 2

[0070] 1. RNA Sample Preparation

[0071] 1.1 Sample collection and blood sample pretreatment

[0072] The tissue and serum samples used in the present invention were all obtained from the Affiliated Hospital of Nantong University.

[0073] Tissue sample processing and storage method: Colorectal cancer tissue (the central part of the tumor) and adjacent tissues removed within 1 hour of surgery were immersed in enzyme-free cryopreservation tubes pre-filled with 1 mL of tissue RNA stabilization solution (RNAlater). After being placed in a 4°C refrigerator for 24 hours, they were transferred to a -80°C refrigerator for long-term storage.

[0074] Serum samples need to be processed according to the following steps: After blood is collected in the yellow coagulant tube, the processing must be completed within 2 hours. First, centrifuge at 3000 rpm at 25°C for 10 minutes, carefully remove the supernatant and transfer it to a new 1.5 mL RNase-free EP tube. Next, centrifuge the 1.5 mL RNase-free EP tube at 12000 rpm at 4°C for 15 minutes, remove the supernatant again and transfer it to another new 1.5 mL RNase-free EP tube. Subsequently, place the 1.5 mL RNase-free EP tube in liquid nitrogen for quick freezing for 1 minute, and finally transfer the sample to a -80°C freezer for long-term storage.

[0075] 1.2 Tissue RNA extraction

[0076] The entire process was performed on ice (in a fume hood). Prepare 2 mL grinding tubes, ceramic grinding beads (4 mm), 1.5 mL RNase-free EP tubes, RNase-free pipette tips, and DEPC water.

[0077] Add approximately 50 mg of tissue and 1 mL of Trizol to a grinding tube, homogenize in a low-temperature freezing grinder, precool the centrifuge to 4°C in advance, centrifuge at 12,000 rpm for 5 minutes, and transfer all the suspension to a 1.5 mL RNase-free EP tube. Add 200 μL of chloroform (chloroform: Trizol = 1:5) to a 1.5 mL RNase-free EP tube; vortex mix for 15 seconds; let stand on ice for 5 minutes; centrifuge at 12,000 rpm at 4°C for 15 minutes; aspirate the top aqueous phase and transfer it to a new 1.5 mL RNase-free EP tube; add isopropanol (isopropanol: aqueous phase = 1:1), manually invert and mix, let stand on ice for 15 minutes; centrifuge at 12,000 rpm at 4°C for 10 minutes, a gel-like RNA precipitate can be seen at the bottom of the tube, carefully aspirate and discard the supernatant; add 1 mL of 75% ethanol pre-cooled at -20°C, manually shake until the precipitate floats, then centrifuge at 7,500 rpm at 4°C for 10 minutes; carefully aspirate and discard the supernatant, open the lid and invert in a fume hood at room temperature for 10 minutes until the RNA precipitate becomes transparent; add 50 μL Elute RNA with DEPC water; use DEPC water as a blank control to detect the concentration of RNA stock solution. Store in a -80℃ refrigerator and aliquot as much as possible to avoid repeated freezing and thawing.

[0078] 1.3 Serum RNA extraction

[0079] Serum RNA was extracted using the BLOG free RNA extraction kit from Bio-Tech. The steps are as follows:

[0080] First, according to the requirements of the kit, add an appropriate amount of anhydrous ethanol to the washing solution A and B and mix them thoroughly; take a 1.5mL RNase-free EP tube, add 200μL serum sample and 4μL RNA Carrier, mix by inversion, then add 200μL lysis solution and 20μL digestion solution, vortex mix and place in a 65℃ water bath for 10min; add 900μL anhydrous ethanol, mix by manual inversion (translucent suspended matter does not affect the extraction effect); place the adsorption column in the collection tube, and take 700μL of the above solution and add it to the adsorption column, centrifuge at 4℃, 12000rpm for 1min, and discard the waste liquid in the collection tube; repeat this operation until all the solution is transferred to the adsorption tube; place the adsorption column in the recovery tube Add 500 μL of wash solution A to the collection tube, let it stand for 2 minutes, centrifuge at 12,000 rpm at 4°C for 1 minute, and discard the waste liquid in the collection tube. Return the adsorption column to the collection tube, add 500 μL of wash solution B, centrifuge at 12,000 rpm at 4°C for 1 minute, and discard the waste liquid in the collection tube. Return the adsorption column to the collection tube, centrifuge at 12,000 rpm for 3 minutes, and transfer 30 μL of the eluate per sample to a 1.5 mL RNase-free EP tube and preheat at 65°C for 2 minutes. Transfer the adsorption column to a new 1.5 mL RNase-free EP tube, add 30 μL of the preheated eluate, let it stand for 2 minutes, centrifuge at 12,000 rpm at 4°C for 2 minutes, and collect the RNA solution. Use DEPC water as a blank control to determine the concentration of the RNA stock solution and store in a refrigerator at -80°C.

[0081] 2. Screening of RPA and crRNA Primers

[0082] 2.1 Primer design

[0083] The SDK1 gene sequence was obtained from NCBI (https: / / www.ncbi.nlm.nih.gov / ). The cfRNA sequence was screened using bioinformatics. Three pairs of RPA primers were designed for the SDK1 sequence 4307861-4308631 using Primer Premier 5, and four pairs of RPA primers were designed for the cfRNA sequence. The specificity of the RPA primers was preliminarily evaluated on NCBI using "Primer-BLAST" and then synthesized by Aidi (see Table 1 for RPA primer sequences). Three pairs of crRNA primers were designed for the SDK1 sequence 4307861-4308631 using chopchop, and four pairs of crRNA primers were designed for the cfRNA sequence. These primers were synthesized by Aidi (see Table 2 for crRNA primer sequences).

[0084] Table 1 RPA primer sequences

[0085]

[0086]

[0087] Table 2 crRNA primer sequences

[0088]

[0089] SDK1 mRNA internal m 7 The nucleotide sequence corresponding to the G fragment (SEQ ID NO.2) is as follows:

[0090] CAAGCAACGGACCGAGGACGGCTGGCCGCCCCACCTGTGGGCTGGAGCCCTCACAAGAGCACCCTCAATGAAGGGTTTTAAGTTCGTGTCCTTTTCTGCATAAATCCTCATGGCCGCAATCAAAG G AATCACCTGGAACCTATTTAACTAAATCGCTTTTTCACAACAGGTCAAGCACAGCAGGGTCCCTCCTGCATTTGCCTGGAGTGAGATAGTCGCAGCCGGTCAGGCCCCGCCTCTGGGCACAGCCTGTTCCCGTCGGAACCGCCCGCAGTTGGATACGTGGCCCCCACCAGCCCCAAGTTGACCAACTCCATCTAGGTTCCTGGACTTGTCCTTC, m shown underlined 7 G methylation modification site.

[0091] 2.2 Primer screening

[0092] The optimal RPA primers were screened by comparing the amplification efficiency; the optimal crRNA primers were screened by comparing the fluorescence intensity generated by Cas13a cleavage.

[0093] (1) Screening of optimal primers for RPA reaction

[0094] Use the RPA kit of Keer Bio for reverse transcription. In a 1.5 mL enzyme-free EP tube, add one RPALyophilized Bead, 1 μL upstream primer and 1 μL downstream primer, 2 μL MgCl2 2+Prepare a 280 mM tube containing 2 μL of template RNA and 19 μL of enzyme-free water. Cap the tube and mix thoroughly by inverting five times. Centrifuge briefly and incubate at 41°C for 30 minutes. Run the RPA-amplified product on a 2% agarose gel and analyze it using a gel imager. Select primers with clear bands and the highest amplification efficiency for the next step of the experiment.

[0095] (2) Screening of optimal crRNA primers

[0096] Place the EP tube containing the crRNA primer powder in a centrifuge and briefly centrifuge to remove the powder from the bottom of the tube. Dissolve the primer in enzyme-free water according to the concentration provided by the primer synthesis company and dilute the primer to 500 nM. Finally, aliquot the dissolved primer and store in a -80°C freezer.

[0097] mRNA uncapping:

[0098] The mRNA was decapped using the New England BioLABs mRNA Decapping Enzyme kit. The specific steps are as follows:

[0099] Prepare the reaction system shown in Table 3 on ice.

[0100] Table 3 mRNA decapping reaction system

[0101]

[0102] The reaction system was gently pipetted up and down to mix, followed by brief centrifugation. The reaction system was incubated at 37°C for 30 min. After the reaction was complete, 1 μL of 500 mM EDTA was added and incubated at 37°C for 5 min to terminate the reaction.

[0103] NaBH4 reduction:

[0104] 4 mg RNA and 15 μL 0.5 M Tris-HCl were added to a 1.5 mL RNase-free EP tube (MOCK reaction) and incubated on ice for 40 min; 4 mg RNA and 15 μL 0.5 M Tris-HCl, 15 μL 1 M NaBH4, 3.75 mM m 7GTP was added to a 1.5 mL RNase-free EP tube (reduction reaction), gently pipetted up and down to mix, and incubated on ice for 40 minutes. To the MOCK reaction, 15 μL of 1 M NaBH4, 60 μL of 3 M sodium acetate (pH 5.5), and 240 μL of nuclease-free water were added and incubated at 90°C for 30 minutes. After the reaction, 30 mg of glycogen and 990 μL of pre-chilled anhydrous ethanol were added to the MOCK reaction to precipitate the RNA. To the reduction reaction, 60 μL of 3 M sodium acetate, 30 mg of glycogen, and 990 μL of ice-cold anhydrous ethanol were added. Both the MOCK and reduction reactions were precipitated at -20°C for at least 1 hour. The NaBH4-treated RNA sample was purified by ethanol precipitation.

[0105] 3. RPA amplification reaction system and condition optimization

[0106] Double RPA amplification system: In a 1.5 mL enzyme-free EP tube, add one RPALyophilized Bead, 1 μL upstream primer and 1 μL downstream primer, 2 μL Mg 2+ Solution (280mM), 2μL template RNA and 19μL enzyme-free water. 7 The concentration ratio of the G-modified primer and the primer for detecting CRC cfRNA was 4:10.

[0107] 3.1 Optimization of RPA reaction temperature and time

[0108] RNA from colorectal cancer tissue samples was used as the target, and ddH2O was used as a negative control. First, the RPA reaction temperature was optimized. Using the optimal primers screened above, six sets of RPA amplifications were performed at 37°C, 38°C, 39°C, 40°C, 41°C, and 42°C, respectively, with all other reaction conditions remaining the same. After completion, the amplified products were subjected to 2% agarose gel electrophoresis. The optimal RPA reaction temperature was determined by comparing band intensities and the presence of nonspecific amplification bands. Finally, the RPA amplification time was optimized under the optimal RPA primers and reaction temperature. Amplification times were set to 20 minutes, 25 minutes, 30 minutes, and 35 minutes, respectively. After completion, the products were analyzed by 2% agarose gel electrophoresis to determine the optimal amplification time.

[0109] DNA agarose gel electrophoresis: After the RPA reaction is completed, add Tris-saturated phenol / chloroform / isopropanol (25:24:1) DNA extraction solution, mix with the DNA solution in a 1:1 ratio, and mix well with a vortex instrument. Centrifuge at 12000 rpm for 5 minutes. Take 8 μL of supernatant and add 1.6 μL DNA loading buffer, mix gently, centrifuge briefly, and use for agarose gel electrophoresis detection.

[0110] Dilute 10× TBE to 1× TBE. Prepare a 2% agarose gel: Weigh 2g of agarose and add it to 100mL of 1× TBE. Microwave for 3 minutes. Once the agarose is completely dissolved, immediately add the green-like blue nucleic acid dye (approximately 4μL of nucleic acid dye per 100mL of agarose) and mix gently to avoid bubbles. Add the prepared agarose gel to a gel casting tank, insert a comb vertically, and let it solidify for 30 minutes. After the agarose solidifies, remove the comb vertically. Place the agarose gel in an electrophoresis tank and add the prepared sample and 5μL of marker to the sample wells. After adding the sample, close the lid, connect the power cord to 120V, and run the electrophoresis for 40 minutes. Develop the gel using a gel imager.

[0111] 3.2 Establishment of the CRISPR / Cas13a cleavage system

[0112] After RPA amplification under optimal reaction conditions, the CRISPR / Cas13a reaction was performed using crRNA. The total volume of the CRISPR / Cas13a system was 25 μL, including 5 μL 5× Cleavage Buffer, 1 μL 25U RNase Inhibitor, 1 μL 1 μM Lwacas13a, 2.5 μL T7 RNA polymerase, 7.5 μL NTP Mix, 2.5 μL 500 nM crRNA primer, 1 μL 10 μM RNA reporter, 1 μL RNA template, and 5 μL DEPC water. Incubation was performed using an ABI 7500 real-time fluorescence PCR instrument set at 37°C for 60 minutes, with fluorescence signals collected every 1 minute. After the reaction, the experimental results were exported and analyzed using Microsoft Excel and GraphPad Prism 9 software for data analysis and plotting.

[0113] RNAReporter:FAM-UUUUUU-BHQ1.

[0114] 3.3 Limit of Detection (LOD) of the RPA-CRISPR / Cas13a Detection Method

[0115] After the plasma free RNA of colorectal cancer patients was extracted and purified, the RNA concentration was measured by Nanodrop and adjusted to 1×10 3 ng / μL, using ddH2O as diluent, after multiple 10-fold dilutions, the RNA concentration gradient was obtained in the range of 10 1 ng / μL-10 -5ng / μL. mRNA was then decapped and reduced with NaBH4. Finally, different concentrations of RNA were used as targets to evaluate the limit of detection (LOD) of the RPA-CRISPR / Cas13a assay. Each sample dilution was subjected to RPA amplification (41°C, 30 minutes) and CRISPR / Cas13a detection.

[0116] 2. Experimental Results

[0117] 1. Primer screening results

[0118] Among the three pairs of RPA primers designed for the 4307861-4308631 sequence of the SDK1 gene and the four pairs of RPA primers designed for the CRC cfRNA sequence, the SDK1-F1R1 and cfRNA-F2R2 primers showed the best amplification efficiency and no nonspecific amplification ( Figure 2-Figure 3 However, due to the similar size of their amplified products, it was difficult to distinguish the bands by agarose gel electrophoresis. Subsequent experiments revealed no statistically significant difference in fluorescence values ​​when the three pairs of RPA primers for SDK1 bound to their respective three crRNAs. Given the significant size difference between the amplified products of SDK1-F2R2 and cfRNA-F2R2, subsequent experiments used these two primer pairs for dual RPA amplification.

[0119] m4307861-4308631 within the SDK1 gene 7 Three pairs of crRNA primers were designed for the G-modified sequence and four pairs of crRNA primers for the CRC cfRNA sequence. The experimental results showed that the combination of SDK1-NTY-2 and cfRNA-crRNA4 produced a stronger fluorescent signal and better visualization effect ( Figure 4-Figure 5 ), and was therefore selected as the optimal crRNA combination for subsequent experiments. This selection not only optimized the sensitivity of the test, but also ensured the reliability and distinguishability of the results.

[0120] 2. Establishment of RPA-CRISPR / Cas13a Detection Method

[0121] The detailed workflow of the RPA-CRISPR / Cas13a detection method is as follows Figure 6 As shown in the figure, sample pretreatment was first performed to extract RNA from the tissue, and the unused RNA was stored at -80°C. Then, the mRNA was decapped using an mRNA decapping kit, and then the mRNA inside the SDK1 mRNA was reduced by NaBH4. 7 G modification is reduced.

[0122] Then, RPA-CRISPR / Cas13a detection was carried out. The optimal reaction conditions for dual RPA amplification were: incubation at 41°C for 20 minutes. Afterwards, the dual RPA amplification products were added to two EP tubes containing the Cas13a reaction system. The two systems had the same composition except for the different crRNAs (SDK1-crRNA and cfRNA-crRNA, respectively). After reacting at 37°C for 1 hour, the results can be read by different methods. The present invention uses the FD method and the BLID method for fluorescence detection using a qPCR instrument.

[0123] CRISPR / Cas13a reaction system: 5 μL 5× Cleavage Buffer, 1 μL 25U RNase Inhibitor, 1 μL 1 μM Lwacas13a, 2.5 μL T7 RNA polymerase, 7.5 μL NTP Mix, 2.5 μL 500 nM crRNA primer, 1 μL 10 μM RNA reporter, 1 μL RNA template, 5 μL DEPC water. Incubate using an ABI 7500 real-time fluorescence PCR instrument at 37°C for 60 minutes, collecting fluorescence signals every 1 minute.

[0124] Double RPA amplification system: In a 1.5 mL enzyme-free EP tube, add one RPALyophilized Bead, 1 μL upstream primer and 1 μL downstream primer, 2 μL Mg 2+ solution (280 mM), 2 μL template RNA and 19 μL enzyme-free water.

[0125] 3. Objective determination of the detection limit of the RPA-CRISPR / Cas13a detection method

[0126] The minimum detection limit of the detection method was determined to be 1×10 -2 ng / μL( Figure 7-10 The results showed that the RPA-CRISPR / Cas13a detection method has high sensitivity in low-concentration RNA detection.

[0127] Example 3

[0128] RPA-CRISPR / Cas13a detects the presence of specific SDK1 mRNA internal mRNA in CRC tissues 7 G methylation:

[0129] To verify the internal mRNA of SDK1 7To investigate the specificity of G modification in the detection of colorectal cancer, the present invention selected stage IIIa colorectal cancer tissue as the target and included 27 pairs of stage IIIa CRC cancer tissue and its corresponding adjacent cancer tissue. Figure 11 RNAm 7 The chemical structure of G.

[0130] First, RNA was extracted from tissue samples, and then Figure 12 The scheme on the left pre-processes the extracted RNA. The RPA-CRISPR / Cas13a detection method constructed in Example 2 is used to detect the internal mRNA of SDK1 mRNA. 7 G performed the detection experiment and set H2O as a negative control. When analyzing the test results, the results obtained by the FD method and the BLID method were compared with clinical information to comprehensively evaluate the RPA-CRISPR / Cas13a platform in detecting SDK1 mRNA internal mRNA. 7 The clinical efficacy of the FD method and the BLID method in detecting SDK1 mRNA internal m 7 G modification in terms of clinical detection capabilities, the results are shown in Figure 13-16 .

[0131] Example 4

[0132] Verification of clinical application detection capabilities:

[0133] In order to verify the clinical application value of the RPA-CRISPR / Cas13a detection method, the present invention collected a total of 45 clinical serum samples from the Affiliated Hospital of Nantong University, including serum samples from 20 healthy subjects and 25 serum samples from colorectal cancer patients. The collected samples were pre-treated according to the established serum sample processing method, and the 5' decapping and NaBH4 reduction reactions of mRNA were performed in sequence. Subsequently, the RPA-CRISPR / Cas13a detection method constructed in Example 2 was used to detect the internal mRNA of SDK1 mRNA in all serum samples. 7 G and CRC cfRNA were detected, with ddH2O as a negative control group, aiming to systematically evaluate the performance of the platform in actual clinical sample detection.

[0134] This embodiment follows Figure 12 After pre-processing the sample using the pre-treatment method shown on the right, the RPA-CRISPR / Cas13a detection method was used for detection. Figures 17-23 ) showed that compared with serum samples of healthy subjects, the internal mRNA of SDK1 mRNA in serum samples of colorectal cancer patients was higher than that in serum samples of healthy subjects. 7The G modification level and CRC cfRNA content were significantly upregulated. This result strongly demonstrates the potential application value of this platform in the clinical detection of colorectal cancer, and can effectively distinguish healthy people from colorectal cancer patients, providing strong support for subsequent diagnosis and treatment.

[0135] The present invention is Figure 20 The results of tissue sample detection were analyzed by receiver operating characteristic curve analysis ( Figure 24 ), the results showed that when the cut-off value was set to Redox / mock = 1.25, the sensitivity of the detection method could reach 81.5%, the specificity was 81.4%, and the AUC value was 0.8313. Figure 22 and Figure 23 Specific SDK1 mRNA internal m 7 G and CRC cfRNA test results were analyzed, such as Figure 25 As shown in the figure, when the cut-off value is 1.44, that is, Redox / mock = 1.4377, the sensitivity is 80%, the specificity is 70%, and the AUC value is 0.734; when the fluorescence value of CRC cfRNA is 820176.81, the sensitivity is 84%, the specificity is 80%, and the AUC value is 0.842. In addition, the present invention stratified 25 colorectal cancer serum samples according to the presence or absence of lymph node metastasis and found that 11 of the 25 samples had lymph node metastasis. The receiver operating characteristic curve analysis ( Figure 26 ), when Redox / mock=2.60, the sensitivity was 63.6%, the specificity was 100%, and the AUC value was 0.8449; the receiver operating characteristic curve analysis was performed on 14 samples without lymph node metastasis ( Figure 27 ), and found that after excluding the lymph node metastasis samples, the AUC value dropped to 0.6464.

[0136] In summary, the present invention fully demonstrates the potential and reliability of this detection method in screening for early lymph node metastasis in colorectal cancer.

[0137] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. An RPA-CRISPR / Cas13a detection system for early metastasis of colorectal cancer, characterized in that: Includes RPA primer combination and crRNA combination; The RPA primer combination includes detection of SDK1 mRNA internal m 7 G-modified RPA primer pairs and RPA primer pairs for detecting CRC cfRNA; The detection of SDK1 mRNA internal m 7 The G-modified RPA primer pair includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.5 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.6; The RPA primer pair for detecting CRC cfRNA includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.11 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.12; The crRNA combination includes a crRNA with a nucleotide sequence as shown in SEQ ID NO.14 and a crRNA with a nucleotide sequence as shown in SEQ ID NO.

19.

2. The RPA-CRISPR / Cas13a detection system according to claim 1, wherein The RPA-CRISPR / Cas13a detection system also includes a probe RNAReporter, whose nucleotide sequence is UUUUUU.

3. The RPA-CRISPR / Cas13a detection system according to claim 2, wherein The RPA-CRISPR / Cas13a detection system also includes Cas13a nuclease.

4. Use of a reagent for detecting a combination of biomarkers in the preparation of a detection product for predicting early metastasis of colorectal cancer, characterized in that: The biomarker combination includes SDK1 mRNA internal m 7 G modification and CRC cfRNA; The nucleotide sequence of the CRC cfRNA is shown in SEQ ID NO.1; The SDK1 mRNA internal m 7 The nucleotide sequence corresponding to the G modification is shown in SEQ ID NO.

2.

5. The use according to claim 4, characterized in that The reagent includes the RPA-CRISPR / Cas13a detection system according to any one of claims 1 to 3.

6. The use according to claim 4, characterized in that The detection product is a test kit.

7. A detection product for predicting early metastasis of colorectal cancer, characterized in that: including reagents for detecting biomarker panels; The biomarker combination includes SDK1 mRNA internal m 7 G modification and CRC cfRNA; The nucleotide sequence of the CRC cfRNA is shown in SEQ ID NO.1; The SDK1 mRNA internal m 7 The nucleotide sequence corresponding to the G modification is shown in SEQ ID NO.

2.

8. The detection product according to claim 7, characterized in that: The reagent includes the RPA-CRISPR / Cas13a detection system according to any one of claims 1 to 3.

9. The detection product according to claim 7, characterized in that: The detection product is a test kit.

10. The detection product according to claim 9, characterized in that: The detection product is a fluorescence detection kit.

Citation Information

Patent Citations

  • Method and kit for detecting m<7>G (N7-methylguanosine) modification in RNA with single base resolution in whole transcriptome range

    CN108841934A

  • Mononucleotide precision tRNA methylation high-throughput sequencing method and application thereof

    CN110452957A

  • Function and application of tRNA m7G modification, WDR4 and METTL1 in body development

    CN114181945A

  • Application of m7G in SDK1 gene mRNA as early transfer early warning marker of CRC

    CN114561471A

  • Application of cfRNA in preparation of marker product for early diagnosis of colorectal cancer

    CN118755824A