Molecular marker for identifying waterfowl shank length character based on C2CD2 gene and identification method and application thereof
Through molecular marker technology based on the C2CD2 gene, specific amplification primers and PCR amplification were used to identify the tibia length trait of poultry, which solved the problem of low heritability of the tibia length trait, achieved early breeding and performance judgment, and improved breeding efficiency and tibia length level.
Patent Information
- Application Number
- CN202510942467.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-09
- Publication Date
- 2025-09-16
AI Technical Summary
In existing technologies, the heritability of the tibia length trait is low, resulting in slow progress in poultry breeding and making it difficult to achieve efficient breeding through traditional methods.
Through molecular markers based on the C2CD2 gene, using specific amplification primer design and PCR amplification technology, combined with Acc I enzyme digestion and electrophoresis detection, the tibia length trait of poultry is identified and individuals with excellent tibia length traits are screened.
It has achieved the early judgment of poultry shank length performance through molecular screening, improved breeding efficiency and accuracy, reduced breeding costs, improved individual shank length levels, and promoted the progress of genetic breeding.
Smart Images
Figure CN120648813A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of molecular marker technology and specifically relates to a method based on C2CD2 Genetic identification of molecular markers for tibia length traits in waterfowl and their identification methods and applications. Background Art
[0002] Tibia length trait is a key indicator for measuring the skeletal development of poultry, and has a profound impact on their growth performance, reproductive potential and breeding benefits. The C2CD2 protein contains a typical C2 domain, which can bind to Ca²⁺ through conserved amino acid residues. After Ca²⁺ binds to the C2 domain, it can induce conformational changes in the protein, allowing it to bind to phospholipid membranes or other signaling molecules, thereby regulating downstream signaling pathways. Calcium signaling plays a key regulatory role in the development of poultry tibia length. It participates in the dynamic balance of the tibial growth plate by affecting chondrocyte differentiation, bone matrix metabolism and growth factor signaling pathways. It can be seen that C2CD2 Genes play a key role in the development of tibia length traits. Analyzing the relationship between the two is of great significance for the selection and efficient breeding of waterfowl varieties.
[0003] Tibia length, as one of the characteristic traits of bone development, has a lower-to-medium heritability in the paternal family and is controlled by micro-effect polygenes as an economic trait. Therefore, when tibia length measurement is used as the main selection basis, the breeding process often progresses slowly. However, gene molecular marker technology can provide accurate molecular basis for breeding by locating gene loci related to tibia length, thereby improving breeding efficiency and accuracy. Therefore, selection C2CD2 The gene was selected as a candidate gene, and the upstream of its transcription start site was selected as the research segment to screen molecular markers that can be used for tibia length trait selection as a direct technical means for poultry breeding. Based on the above content, a method based on C2CD2 Genetic identification of molecular markers for tibia length traits in poultry and their identification methods and applications. Summary of the Invention
[0004] The purpose of the present invention is to provide a method based on C2CD2 Genetic identification of molecular markers for tibia length traits in waterfowl and their identification methods and applications.
[0005] The present invention achieves the above-mentioned purpose through the following technical solutions: The present invention provides a C2CD2 A molecular marker for genetically identifying the tibia length trait of waterfowl, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein the 684th base of the nucleotide sequence is A or G.
[0006] The present invention also provides an application of a molecular marker in identifying the tibia length trait of waterfowl.
[0007] As a further optimized solution of the present invention, the waterfowl is a goose.
[0008] As a further optimization scheme of the present invention, if the molecular marker type of the poultry to be tested is GG type, the tibia length trait of the poultry is optimal; If the molecular marker type of the bird to be tested is AA type, the tibia length trait of the bird is poor; If the molecular marker type of the poultry to be tested is AG type, the tibia length trait of the poultry is average.
[0009] The present invention also provides a method for identifying the tibia length trait of waterfowl using molecular markers, comprising the following steps: (1) Extract total DNA from poultry blood or any tissue; (2) Using molecular markers to identify sites upstream and downstream C2CD2 The nucleotide sequence is used as a template to design specific amplification primers, and then the total DNA is used as a template to perform PCR amplification using the specific amplification primers to obtain the amplified product; (3) Sequencing and genotyping the amplified products to obtain the molecular marker type of the duck to be tested; (4) Determine the tibia length trait of poultry based on the type of molecular markers.
[0010] As a further optimization scheme of the present invention, the length of the upstream amplification product and the length of the downstream amplification product of the molecular marker site are both greater than 100 bp, and the length difference between the upstream amplification product and the downstream amplification product of the molecular marker site is greater than 20 bp.
[0011] As a further optimization solution of the present invention, the sequence of the specific amplification primer is: SEQ ID NO.2: F1: AGGTAGAACCGAAACATGGCA; SEQ ID NO. 3: R1: AAGCCTTGCTGGAAATCGGT.
[0012] As a further optimization scheme of the present invention, the method of genotyping detection is to use Acc I to digest the PCR amplification product to obtain the digestion product, and then detect the digestion product by electrophoresis. If the digestion product: If it contains one band, it is type AA; If it contains two bands, it is GG type; If it contains three bands, it is AG type.
[0013] The present invention also provides a method for screening poultry with excellent tibia length traits using molecular markers, extracting total DNA from poultry tissue cells, typing the poultry genotype using molecular markers, and selecting poultry individuals with a genotype of GG, which are poultry varieties with excellent tibia length traits.
[0014] The beneficial effects of the present invention are: The present invention provides C2CD2 Genetic identification of molecular markers for poultry tibia length traits, and their identification methods and applications. By identifying the type of existence of this molecular marker in the poultry genome, the tibia length performance of individual poultry can be judged through molecular screening at an early stage, providing a direct technical means for the selection and breeding of poultry tibia length performance, and achieving the effect of early selection and breeding of poultry with excellent tibia length traits. This is not only beneficial to reducing breeding costs, but also can genetically improve the individual tibia length level and accelerate the progress of genetic selection and breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] Figure 1 The following are the enzyme digested agarose gel electrophoresis images of PCR amplification products of some samples; Figure 2 For geese C2CD2 Figure 1 shows the genotype sequencing results of gene polymorphic sites. DETAILED DESCRIPTION
[0016] The present application is described in further detail below. It is necessary to point out that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technicians in this field can make some non-essential improvements and adjustments to the present application based on the above application content.
[0017] Unless otherwise specified, the methods used in this example are conventional methods known to those skilled in the art, and the reagents and other materials used are commercially available products unless otherwise specified. Example 1 A method for identifying the tibia length trait of waterfowl using molecular markers 1. Obtain poultry C2CD2 Gene polymorphic sites 1.1 Genomic DNA extraction and detection 108 Wanxi white geese were selected as experimental materials, and blood was collected from the wing vein of the birds. The total DNA in the blood samples of the wing vein of the birds was extracted using the blood DNA extraction kit produced by Sangon Biotechnology Co., Ltd., and the specific instructions for use of the kit were referred to.
[0018] DNA concentration and OD value were measured using a NanoDrop 200 spectrophotometer. DNA was analyzed by 1.5% agarose gel electrophoresis, and the extracted genomic DNA was of good quality, with a single, clear main band.
[0019] 1.2 Primer Design Log in to the National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov / ) and download the C2CD2The complete genome sequence, with accession number NC_089873.1, was found in the genome database C2CD2 The upstream sequence of the gene is shown in SEQ ID NO.1. C2CD2 The gene DNA sequence is used as a template to design specific amplification primers. It should be noted that during the primer design process, the SNP site should be placed in the middle position as much as possible to ensure that the length of the upstream amplification product of the SNP site and the length of the downstream amplification product are both greater than 100 bp, and the length difference between the upstream amplification product and the downstream amplification product of the SNP site is greater than 20 bp, to avoid the occurrence of hairpin structures, primer dimers and mismatches, and to optimize the primer sequence; The specific amplification primer sequences are as follows: SEQ ID NO.2: F1: AGGTAGAACCGAAACATGGCA; SEQ ID NO.3: R1: AAGCCTTGCTGGAAATCGGT; The PCR product amplified by this primer is 673 bp in length, and the amplified sequence is shown in SEQ ID NO. 4, which contains C2CD2 The molecular marker site of the A / G mutation is -3888bp upstream of the transcription start site of the gene.
[0020] 1.3 PCR amplification Using synthesized sequencing-specific primer pairs C2CD2 The target fragment of the gene is subjected to PCR amplification reaction, and the PCR amplification system is: ; The conditions for PCR amplification were as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 58-62°C for 30 s, extension at 72°C for 45 s, 30-35 cycles, and final extension at 72°C for 5 min.
[0021] 1.4. Detection of PCR amplification products Electrophoresis on a 1% agarose gel at 100V for 40 minutes revealed a band of approximately 673 bp, consistent with the predicted length. The PCR amplification product was recovered using a DNA recovery kit from Dalian Takara Biotech Co., Ltd. and sent to Shanghai Biotech for sequencing. The sequence, shown as SEQ ID NO. 4, was consistent with the predicted result.
[0022] 1.5 Genotyping The PCR amplification product was digested with Acc I to obtain the digestion product, and the digestion product was detected by electrophoresis. The results were as follows: Figure 1 According to the image results, different genotypes were screened as shown below: (1) If it contains one band, it is AA type; (2) If it contains two bands, it is GG type; (3) If it contains three bands, it is AG type.
[0023] 1.6. Enzyme Digestion and Sequencing Verification The agarose gel electrophoresis diagram of gene enzyme digestion typing was statistically analyzed to obtain three types of AA, GG, and AG. One individual was selected for each of the three types for sequencing comparison. The results are as follows Figure 2 As shown in the figure, A mutated into G in the sequencing result, and the arrow marked the mutation position, which was consistent with the enzyme digestion typing result.
[0024] 2. Molecular markers and their association analysis with tibia length traits 2.1. Gene and genotype frequencies To determine the association between the molecular markers of the present invention and important phenotypic traits of waterfowl, 108 Wanxi white geese described in 1.1 were used as test materials. The individual shin lengths were counted, and the genotyping method described in 1.5 was used to perform genotyping on the 108 Wanxi white geese. The results are shown in Table 1: Table 1 Gene and genotype frequency statistics ; As can be seen from Table 1, the chi-square test results show that the molecular marker sites of A / G mutation are in Hardy-Weinberg equilibrium in this population ( P >0.05).
[0025] 2.2 Statistical Analysis SAS (9.2) software was used to analyze the correlation between the A / G mutation molecular marker locus and the tibia length trait. The tibia length trait and genotype of 108 Wanxi white geese were subjected to association analysis. The results are shown in Table 2. Table 2 Wanxi White Goose C2CD2 Statistics of tibia length of each genotype ; As can be seen from Table 2, the tibia length trait of individuals with the GG genotype is significantly better than that of individuals with the AG and AA genotypes, and the tibia length trait of the AA genotype is the worst. This result shows that the molecular marker described in the present invention is correlated with the tibia length trait of waterfowl, and it is feasible to use this molecular marker to type and detect the tibia length trait of waterfowl.
[0026] The above-described embodiments merely illustrate several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.
Claims
1. A method based on C2CD2 A molecular marker for genetic identification of the tibia length trait of waterfowl, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1, wherein the 684th base of the nucleotide sequence is A or G.
2. Use of the molecular marker according to claim 1 in identifying the tibia length trait of waterfowl.
3. The use according to claim 2, characterized in that The waterfowl is a goose.
4. The use according to claim 2, characterized in that If the molecular marker type of the poultry to be tested is GG type, the tibia length trait of the poultry is optimal; If the molecular marker type of the bird to be tested is AA type, the tibia length trait of the bird is poor; If the molecular marker type of the poultry to be tested is AG type, the tibia length trait of the poultry is average.
5. A method for identifying the tibia length trait of waterfowl using the molecular marker according to claim 1, characterized in that: The following steps are involved: (1) Extract total DNA from poultry blood or any tissue; (2) The upstream and downstream of the site where the molecular marker is located C2CD2 Using the nucleotide sequence as a template, designing specific amplification primers, and then using the total DNA as a template, performing PCR amplification using the specific amplification primers to obtain an amplified product; (3) Sequencing and genotyping the amplified products to obtain the molecular marker type of the duck to be tested; (4) Determine the tibia length trait of poultry based on the type of molecular markers.
6. The method for identifying the tibia length trait of waterfowl using molecular markers according to claim 5, characterized in that: The length of the upstream amplification product and the length of the downstream amplification product of the site where the molecular marker is located are both greater than 100 bp, and the length difference between the upstream amplification product and the downstream amplification product of the site where the molecular marker is located is greater than 20 bp.
7. The method for identifying the tibia length trait of waterfowl using molecular markers according to claim 5, characterized in that: The sequences of the specific amplification primers are: SEQ ID NO.2: F1: AGGTAGAACCGAAACATGGCA; SEQ ID NO. 3: R1: AAGCCTTGCTGGAAATCGGT.
8. The method for identifying the tibia length trait of waterfowl using molecular markers according to claim 5, characterized in that: The genotyping method is to use Acc I to digest the PCR amplification product to obtain the digestion product, and then detect the digestion product by electrophoresis. If the digestion product: If it contains one band, it is type AA; If it contains two bands, it is GG type; If it contains three bands, it is AG type.
9. A method for screening poultry with excellent tibia length trait using the molecular marker according to claim 1, characterized in that: The total DNA of poultry tissue cells is extracted, and the genotype of the poultry is typed and detected using the molecular markers. The poultry individuals with the genotype of GG are selected, which are poultry varieties with excellent tibia length traits.