KASP molecular markers related to oil content and fiber properties of upland cotton, KASP primers and application thereof
By developing KASP molecular markers and primers related to oil content in upland cotton, the problem of time-consuming and labor-intensive identification of cotton oil content has been solved, enabling rapid and accurate oil content identification and efficient breeding, thus promoting the progress of high-oil cotton breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INST OF COTTON RES CHINESE ACAD OF AGRI SCI
- Filing Date
- 2025-06-27
- Publication Date
- 2026-04-21
AI Technical Summary
Existing methods for identifying cotton oil content are time-consuming, labor-intensive, and inaccurate, limiting the efficient use of seed resources. Traditional methods are insufficient to meet the needs of breeding high-oil cotton.
We developed KASP molecular markers and primers related to oil content traits in upland cotton, screened KASP1–KASP9 through whole-genome resequencing, and designed specific KASP primers for PCR detection to achieve rapid and accurate oil content identification and breeding assistance.
This technology enables rapid and accurate identification of cotton oil content, improves the efficiency of high-oil cotton breeding, and assists in the construction of genetic maps and molecular marker-assisted breeding.
Smart Images

Figure CN120648842B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of molecular biology and plant molecular breeding technology, and in particular to KASP molecular markers, KASP primers and their applications related to oil content traits in upland cotton. Background Technology
[0002] Cotton is not only an important fiber crop but also a significant oilseed crop. As one of the main products of cotton production, cottonseed has a significant yield advantage. Studies show that approximately 150 kg of cottonseed can be produced simultaneously for every 100 kg of cotton fiber harvested. In terms of yield per unit area, cottonseed yield is significantly higher than traditional oilseed crops; the protein and oil produced from cottonseed per acre (0.067 hectares) are equivalent to the yield of 1.5 acres of soybeans. The oil content of cottonseed kernels after hulling can reach 25%-39%. In my country, cotton is the fifth largest oilseed crop after peanuts, rapeseed, soybeans, and sesame.
[0003] Molecular markers are widely used in crop genetic map construction, gene mapping, and marker-assisted breeding. Among them, competitive allele-specific PCR (Kompetitive Allele Specific PCR) is mainly used in SNP or Indel gene genotyping studies and is gradually becoming a major technical means for genetic map construction, gene mapping, and marker-assisted breeding.
[0004] my country possesses abundant cotton germplasm resources, including both traditional and wild germplasm. However, existing research primarily focuses on a few dominant germplasm resources, leaving the majority of these resources underutilized. Traditional phenotypic identification methods are time-consuming, labor-intensive, and inaccurate, becoming a bottleneck for the efficient utilization of seed resources. Therefore, developing KASP molecular markers for high-oil cotton is of great significance for high-oil cotton breeding. Summary of the Invention
[0005] The purpose of this invention is to provide KASP molecular markers, KASP primers, and their applications related to the oil content of upland cotton, in order to solve the problems existing in the prior art.
[0006] To achieve the above objectives, the present invention provides the following solution:
[0007] One of the technical solutions of this invention is a KASP molecular marker related to the oil content of upland cotton, including KASP1 to KASP9;
[0008] The KASP1 is located on the cotton D03 chromosome, at position 33428933 of the cotton genome sequence, and exhibits a T / C base polymorphism.
[0009] The KASP2 is located on the cotton D03 chromosome, at position 33429750 of the cotton genome sequence, and exhibits a base polymorphism T / A.
[0010] The KASP3 is located on the cotton D03 chromosome, at position 33430553 of the cotton genome sequence, and exhibits a base polymorphism A / T.
[0011] The KASP4 is located on the cotton D03 chromosome, at position 33430776 of the cotton genome sequence, and exhibits a base polymorphism A / G.
[0012] The KASP5 is located on the cotton D03 chromosome, at position 33431444 of the cotton genome sequence, and exhibits a C / T base polymorphism.
[0013] The KASP6 is located on the cotton D03 chromosome, at position 33432250 of the cotton genome sequence, and exhibits a T / C base polymorphism.
[0014] The KASP7 is located on the cotton D03 chromosome, at position 33432704 of the cotton genome sequence, and exhibits a base polymorphism A / T.
[0015] The KASP8 is located on the cotton D03 chromosome, at position 33433207 of the cotton genome sequence, and exhibits a base polymorphism G / C.
[0016] The KASP9 is located on the cotton D03 chromosome, at position 33434083 of the cotton genome sequence, and exhibits the base polymorphism G / A.
[0017] The second technical solution of the present invention is to specifically detect the KASP molecular marker using KASP primers, including primers as shown in SEQ ID NO.3 to SEQ ID NO.29.
[0018] The third technical solution of the present invention is a product that specifically detects the KASP molecular marker, including the KASP primers.
[0019] The fourth technical solution of the present invention, the application of the KASP primer or the product, includes any one of the following:
[0020] (1) Identification of high-oil-content upland cotton germplasm resources or varieties;
[0021] (2) Detection of high oil content upland cotton germplasm resources or variety purity;
[0022] (3) Molecular gene mapping of high-oil-content upland cotton;
[0023] (4) Molecular marker-assisted breeding of high-oil-content upland cotton.
[0024] Based on the above technical solution, the present invention has the following technical effects:
[0025] This invention discloses a KASP molecular marker for identifying cotton oil content developed through whole-genome resequencing and its application. To facilitate the development of KASP molecular markers for cotton oil content breeding, this invention developed KASP molecular markers for cotton oil content from 562 upland cotton germplasm materials based on whole-genome resequencing. Using these molecular markers for PCR detection, the oil content of cotton can be rapidly, accurately, and effectively identified. This supports marker-assisted breeding of high-oil cotton and accelerates breeding programs to improve cotton oil content. Attached Figure Description
[0026] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0027] Figure 1 Polymorphism map of KASP1 marker in 93 cotton germplasm resources.
[0028] Figure 2 Polymorphism map of KASP2 marker in 93 cotton germplasm resources.
[0029] Figure 3 Polymorphism map of KASP3 marker in 93 cotton germplasm resources.
[0030] Figure 4 Polymorphism map of KASP4 marker in 93 cotton germplasm resources.
[0031] Figure 5 Polymorphism map of KASP5 marker in 93 cotton germplasm resources.
[0032] Figure 6 Polymorphism map of KASP6 marker in 93 cotton germplasm resources.
[0033] Figure 7 Polymorphism map of KASP7 marker in 93 cotton germplasm resources.
[0034] Figure 8 Polymorphism map of KASP8 marker in 93 cotton germplasm resources.
[0035] Figure 9 Polymorphism map of KASP9 marker in 93 cotton germplasm resources. Detailed Implementation
[0036] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0037] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0038] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0039] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This application specification and embodiments are merely exemplary.
[0040] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0041] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.
[0042] This invention provides KASP molecular markers related to oil content traits in upland cotton, including KASP1 to KASP9;
[0043] The KASP1 is located on the cotton D03 chromosome, at position 33428933 of the cotton genome sequence, and exhibits a T / C base polymorphism.
[0044] The KASP2 is located on the cotton D03 chromosome, at position 33429750 of the cotton genome sequence, and exhibits a base polymorphism T / A.
[0045] The KASP3 is located on the cotton D03 chromosome, at position 33430553 of the cotton genome sequence, and exhibits a base polymorphism A / T.
[0046] The KASP4 is located on the cotton D03 chromosome, at position 33430776 of the cotton genome sequence, and exhibits a base polymorphism A / G.
[0047] The KASP5 is located on the cotton D03 chromosome, at position 33431444 of the cotton genome sequence, and exhibits a C / T base polymorphism.
[0048] The KASP6 is located on the cotton D03 chromosome, at position 33432250 of the cotton genome sequence, and exhibits a T / C base polymorphism.
[0049] The KASP7 is located on the cotton D03 chromosome, at position 33432704 of the cotton genome sequence, and exhibits a base polymorphism A / T.
[0050] The KASP8 is located on the cotton D03 chromosome, at position 33433207 of the cotton genome sequence, and exhibits a base polymorphism G / C.
[0051] The KASP9 is located on the cotton D03 chromosome, at position 33434083 of the cotton genome sequence, and exhibits the base polymorphism G / A.
[0052] Embodiments of the present invention also provide KASP primers for specific detection of the KASP molecular marker, including primers as shown in SEQ ID NO.3 to SEQ ID NO.29.
[0053] In some specific implementations, a FAM fluorescent adapter sequence is attached to the 5' end of the primers shown in SEQ ID NO.3, SEQ ID NO.6, SEQ ID NO.9, SEQ ID NO.12, SEQ ID NO.15, SEQ ID NO.18, SEQ ID NO.21, SEQ ID NO.24 and SEQ ID NO.27;
[0054] HEX fluorescent adapter sequences are attached to the 5' end of primers shown in SEQ ID NO.4, SEQ ID NO.7, SEQ ID NO.10, SEQ ID NO.13, SEQ ID NO.16, SEQ ID NO.19, SEQ ID NO.22, SEQ ID NO.25 and SEQ ID NO.28.
[0055] This invention also provides a product for the specific detection of the KASP molecular marker, including the KASP primers.
[0056] In some specific implementations, the product includes diagnostic reagents and kits.
[0057] This invention also provides applications of the KASP primers or the product, including any of the following:
[0058] (1) Identification of high-oil-content upland cotton germplasm resources or varieties;
[0059] (2) Detection of high oil content upland cotton germplasm resources or variety purity;
[0060] (3) Molecular gene mapping of high-oil-content upland cotton;
[0061] (4) Molecular marker-assisted breeding of high-oil-content upland cotton.
[0062] In some specific implementation schemes, the following steps are included:
[0063] DNA was extracted from the upland cotton sample to be tested and used as a template. The sample was then amplified using the primers or the product. After amplification, genotyping was performed using INTELLICS. The oil content of the upland cotton sample was determined based on the genotyping results.
[0064] In some specific implementation schemes, the method for determining the oil content of the sample to be tested based on the genotyping results is as follows: if the fluorescence signal data of the amplification product of the upland cotton sample to be tested is close to the vertical axis after analysis by INTELLICS genotyping software, it is determined to be homozygous high-oil cotton; if the fluorescence signal data of the amplification product of the upland cotton sample to be tested is close to the horizontal axis, it is determined to be homozygous low-oil cotton; if the fluorescence signal data of the amplification product of the upland cotton sample to be tested is located between the vertical and horizontal axes, it is determined to be heterozygous.
[0065] In some specific implementations, the amplification reaction system is 0.8 μl, comprising: 20-50 ng of dried upland cotton sample DNA, 0.0013 μl each of two 100 μM F primers, 0.0033 μl of 100 μM R primers, 0.3945 μl of 2×KASPMaster Mix, and 0.3996 μl of ultrapure water;
[0066] The reaction procedure was as follows: pre-denaturation at 94℃ for 15 min; first step amplification reaction, denaturation at 94℃ for 20 s, annealing and extension at 65℃~57℃ for 60 s, 10 cycles, with the annealing and extension temperature decreasing by 0.8℃ in each cycle; second step amplification reaction, denaturation at 94℃ for 20 s, annealing and extension at 57℃ for 60 s, 30 cycles.
[0067] This invention developed a molecular marker for high-oil cotton from 562 upland cotton accessions based on whole-genome resequencing. This KASP marker can rapidly and accurately identify high-oil cotton germplasm resources, providing molecular markers for genetic map construction, gene localization, and molecular-assisted breeding.
[0068] Example 1
[0069] KASP molecular markers for high-oil cotton developed based on whole-genome resequencing and their applications
[0070] Based on 562 natural populations of upland cotton, KASP molecular markers for high-oil cotton were developed using the following methods:
[0071] (1) Extraction of DNA from cotton
[0072] ① Add one steel ball to a 2mL centrifuge tube and take 2cm of cotton leaf tissue. 2 Around 100°C, the mixture is rapidly frozen with liquid nitrogen and then quickly ground.
[0073] ② Add 700 μL of 2×CTAB buffer (containing 2% β-mercaptoethanol and 1 / 1000 RNase A) preheated at 65℃, and incubate at 65℃ for 1 h, inverting and mixing every 15 min during the process.
[0074] ③ Add 600 μL of nucleic acid extraction buffer (chloroform:isoamyl alcohol ratio of 24:1), invert and mix 6-8 times, centrifuge at 12000 r / min for 10 min, and transfer the upper aqueous phase of about 600 μL to a new 1.5 mL centrifuge tube;
[0075] ④ Repeat the previous step once, take 500 μL, add twice the volume (1 mL) of anhydrous ethanol that has been pre-cooled to -20℃, centrifuge at 12000 r / min for 2 min, and discard the supernatant.
[0076] ⑤ Wash once with 750 μL of 75% ethanol, centrifuge at 12000 r / min for 1 min, and discard the supernatant;
[0077] ⑥ Repeat the previous step, discard the supernatant, and blow dry in the clean bench;
[0078] ⑦ Add 100 μL of sterile water and dissolve overnight at 4°C. Then measure the quality and concentration of the DNA and store it at -20°C for later use.
[0079] (2) KASP primer design
[0080] SNP source: Genome-wide association analysis was performed on cottonseed oil content using multi-environmental oil content phenotypic data and resequencing genotype data from 562 upland cotton varieties, identifying multi-environmentally stable SNP loci. Based on gene expression patterns, allelic effects, functional annotation, and haplotype analysis results, GH_D03G0938 was determined to be the most stable SNP.
[0081] (Long-Chain Acyl-CoA Synthetase 4, LACS4) is a key candidate gene for regulating cottonseed oil content. This gene encodes a long-chain acyl-CoA synthase. SNP development was conducted based on the GhLACS4 gene sequence SNP.
[0082] KASP primers were designed for SNP sites and flanking sequences using Bactprimer 3 software. Each KASP marker consisted of two specific primers and one universal primer. A FAM fluorescent adapter sequence (SEQ ID NO.1: GAAGGTGACCAAGTTCATGCT) was ligated to the 5' end of primer F1, and a HEX fluorescent adapter sequence (SEQ ID NO.2: GAAGGTCGGAGTCAAC GGATT) was ligated to the 5' end of primer F2.
[0083] Primer information for the KASP molecular marker is shown in Table 1.
[0084] Table 1 Primer information for KASP molecular markers
[0085]
[0086]
[0087] (3) The KASP reaction test PCR reaction system is 0.8 μl: after drying 20 ng-50 ng of sample DNA, add 0.0013 μl of each of two 100 μM F primers, 0.0033 μl of 100 μM R primers, 0.3945 μl of 2×KASPMaster Mix, and 0.3996 μl of ultrapure water.
[0088] The PCR reaction conditions were as follows: pre-denaturation at 94℃ for 15 min; first step amplification reaction: denaturation at 94℃ for 20 s, annealing and extension at 65℃~57℃ for 60 s, 10 cycles, with the annealing and extension temperature decreasing by 0.8℃ in each cycle; second step amplification reaction: denaturation at 94℃ for 20 s, annealing and extension at 57℃ for 60 s, 30 cycles.
[0089] After the PCR reaction was completed, the fluorescence signal of the reaction system was scanned using ARAYA; then, data analysis and genotyping were performed using INTELLICS.
[0090] PCR amplification was performed using the KASP primer set (1-9) with molecular markers. The results of identifying the target SNP genotype were determined as follows: if the fluorescence signal data of the amplified product of the cotton sample was close to the vertical axis according to the INTELLICS genotyping software, it was identified as homozygous high-oil-content cotton; if the fluorescence signal data of the amplified product of the cotton sample was close to the horizontal axis, it was identified as homozygous low-oil-content cotton; if the fluorescence signal data of the amplified product of the cotton sample was between the vertical and horizontal axes, it was identified as heterozygous.
[0091] Table 2 Genotypes and phenotypes of natural upland cotton populations (partial results shown)
[0092]
[0093]
[0094]
[0095] Example 2
[0096] Using the KASP markers mentioned above, genotyping was performed on 93 cotton samples, which ultimately allowed for accurate genotyping of high-oil and low-oil cotton (Table 3).
[0097] Table 3 Phenotypic and genotypic information of natural populations of upland cotton; KASP primer list
[0098]
[0099]
[0100]
[0101] The results are shown in Table 3. KASP analysis effectively distinguished cotton varieties with different oil contents among the 93 natural upland cotton populations, and the detection results were consistent with the resequencing results. The analysis shows that this high-throughput detection system makes large-scale population screening in high-oil cotton breeding more efficient, enabling precise selection of target traits and improving breeding efficiency.
[0102] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.
Claims
1. KASP primers for specifically detecting KASP molecular markers associated with the oil content trait in Gossypium hirsutum, characterized in that, It consists of primers as shown in SEQ ID NO.3 to SEQ ID NO.
29.
2. The KASP primer of claim 1, wherein, FAM fluorescent adapter sequences are attached to the 5' end of primers shown in SEQ ID NO.3, SEQ ID NO.6, SEQ ID NO.9, SEQ ID NO.12, SEQ ID NO.15, SEQ ID NO.18, SEQ ID NO.21, SEQ ID NO.24 and SEQ ID NO.27; HEX fluorescent adapter sequences are attached to the 5' end of primers shown in SEQ ID NO.4, SEQ ID NO.7, SEQ ID NO.10, SEQ ID NO.13, SEQ ID NO.16, SEQ ID NO.19, SEQ ID NO.22, SEQ ID NO.25 and SEQ ID NO.
28.
3. A product for specifically detecting a KASP molecular marker associated with the oil content trait in Gossypium hirsutum, characterized in that, Includes the KASP primers as described in claim 1 or 2.
4. The product of claim 3, wherein, The product is a testing reagent or kit.
5. Use of a KASP primer according to claim 1 or a product according to claim 3, characterised in that, It can be any of the following: (1) Identification of high-oil-content upland cotton germplasm resources or varieties; (2) Detection of high oil content upland cotton germplasm resources or variety purity; (3) Molecular marker-assisted breeding of high-oil-content upland cotton.
6. Use according to claim 5, characterized in that, Includes the following steps: DNA was extracted from the upland cotton sample to be tested as a template, and amplification was performed using the primers described in claim 1 or the product described in claim 3. After amplification, genotyping was performed using INTELLICS. Based on the genotyping results, it was determined whether the upland cotton sample to be tested was a high-oil-content upland cotton.
Citation Information
Patent Citations
Biomarker for identifying upland cotton variety with high cottonseed oil content and application of biomarker
CN119144760A