LMTIA primer and Proofman probe combination for detecting radix ophiopogonis component, detection method, kit and application of LMTIA primer and Proofman probe combination

Abstract

The invention discloses an LMTIA primer and Proofman probe combination for detecting radix ophiopogonis components, a detection method, a kit and application thereof, and belongs to the technical field of molecular biology nucleic acid detection. The invention designs an LMTIA primer group for identifying components of radix ophiopogonis, and the LMTIA primer group comprises a primer MaiDF12, a primer MaiDB13, a primer MaiD-LF and a probe MaiD-Pr of Proofman. According to the present invention, the detection method for identifying the radix ophiopogonis component is constructed based on the LMTIA technology, and the method has advantages of simple operation, high sensitivity, strong specificity, short reaction time and great development potential, can meet the current requirement of rapid radix ophiopogonis detection, and provides a certain guarantee for the consumer rights and interests of the masses. The Proofman-LMTIA method established by the invention can be used for detecting the radix ophiopogonis component in traditional Chinese medicines, health-care products and the like.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology nucleic acid detection, and in particular to a LMTIA primer and Proofman probe combination for detecting ophiopogon components, a detection method, a kit and applications thereof. Background Art

[0002] Ophiopogon japonicus (Ophiopogon japonicus), a perennial herb of the genus Ophiopogonis in the Liliaceae family, was listed as a top-grade herb in the Shennong's Herbal Classic. As a traditional Chinese medicinal herb, it possesses sweet, slightly bitter, and cold properties, and enters the Heart, Lung, and Stomach meridians. It nourishes yin, promotes fluid production, moistens the lungs, and clears the heart. It is commonly used to treat dry coughs caused by lung dryness and yin deficiency-induced coughs, and possesses high medicinal value and health benefits. Modern research indicates that the entire plant is rich in various active ingredients exhibiting a wide range of pharmacological effects, making it a natural health and wellness treasure. Its increasing popularity in recent years suggests its significant development value and potential in applications such as medicine and food, and in health foods. The Ophiopogon japonicus currently available in the market is primarily Sichuan Ophiopogon japonicus. Santai County, Mianyang, Sichuan, as the authentic production area, has a history of over 500 years. It is a representative variety of Sichuan authentic medicinal herbs, and due to its short growing cycle, high yield, and low price, it enjoys a high market share. Furthermore, because Hubei Ophiopogon japonicus (Liriope spicata var. prolifera) and Wild Ophiopogon japonicus (Liriope spicata) closely resemble Ophiopogon japonicus in appearance and command lower market prices, they are often used by unscrupulous manufacturers to replace or adulterate Ophiopogon japonicus. Since the 1995 edition of the Chinese Pharmacopoeia, Ophiopogon japonicus and Wild Ophiopogon japonicus have been distinguished and listed separately, with regulations stipulating that Wild Ophiopogon japonicus should be used in greater quantities than Ophiopogon japonicus when used as a medicinal herb. This also indicates a difference in quality between Ophiopogon japonicus and Wild Ophiopogon japonicus.

[0003] Yu Guomei and others have pointed out that the quality of raw medicinal materials is the source of control in the pharmaceutical production process, and their quality status will directly affect the quality of the drug. The quality evaluation of medicinal materials, especially the accurate and rapid identification of the origin of medicinal materials, has become a key link in the quality control of traditional Chinese medicine production. Currently, there are a variety of methods for identifying Ophiopogon japonicus and Radix Ophiopogonis japonicus in China, including microscopic identification, trait identification, thin-layer chromatography, gas chromatography, near-infrared spectroscopy, PCR-RFLP, and fingerprinting studies. However, these identification methods all have limitations: microscopic identification is significantly influenced by subjective factors and may lack objectivity due to individual differences. Identification is also more difficult due to similar medicinal materials or changes in morphology, making it difficult to implement in practice. Gas chromatography requires a large amount of organic reagents, complex sample pretreatment, and a relatively long process. Characteristic identification relies heavily on the operator's practical experience, making it difficult to scale up and unsuitable for finished products. Fingerprinting technology has a limited scope of application. Thin-layer chromatography suffers from insufficient specificity in practice, and identification results are easily influenced by the professional qualifications of the inspector. It is highly subjective and has limited ability to identify adulterated ingredients in products, making accurate identification difficult. High-performance liquid chromatography is complex and inefficient. Near-infrared spectroscopy requires specialized spectroscopic equipment, requiring high calibration and maintenance requirements. PCR-PFLP is time-consuming and complex, making it unsuitable for grassroots testing. Compared to domestic research, international research focuses primarily on the following areas: International research focuses on the chemical composition analysis and pharmacological effects of Ophiopogon japonicus, identification of closely related species, and geographical origin research. Therefore, the establishment of a technical system for the precise identification of Radix Ophiopogonis and Radix Liriope is of far-reaching significance. On the one hand, it can open up new paths for the authenticity identification of traditional Chinese medicines and significantly improve the efficiency and capacity of TCM quality control. On the other hand, it can ensure the quality of medicinal materials, enhance clinical efficacy, and protect consumer rights, which has strategic value in promoting the modernization of traditional Chinese medicine and accelerating its internationalization.

[0004] Ladder melting temperature isothermal amplification (LMT) is a novel nucleic acid isothermal amplification technique proposed by Wang Deguo et al., building on the experience gained with PCR and LAMP. This technique achieves more efficient and stable nucleic acid amplification, breaking away from the DNA requirement, making it suitable for rapid diagnosis and on-site testing. Compared to other traditional techniques, it offers significant advantages: rapid reaction speed, no need for temperature changes, short target sequences, high sensitivity, and the wide applicability of the BST DNA polymerase used. Furthermore, Proofman probe technology, based on the principle of primer-specific binding, cleaves the fluorescent group under the catalysis of an ultra-fidelity DNA polymerase, enabling specific and quantitative detection of the target sequence. Currently, this technique has been successfully applied in a variety of fields, including the identification of honeysuckle, honey from Chinese honeybees, American ginseng and ginseng, Achyranthes bidentata and Achyranthes bidentata, detection of Bupleurum chinense and Bupleurum chinense, detection of soy-derived ingredients in dairy products, detection of Listeria monocytogenes contamination in foods, and detection of pork-derived ingredients in meat products. Summary of the Invention

[0005] The purpose of the present invention is to provide a combination of LMTIA primers and Proofman probes for detecting Ophiopogon japonicus components, a detection method, a kit and its application, so as to solve the problems existing in the above-mentioned prior art. The present invention innovatively integrates Proofman probes and LMTIA technology to develop a rapid detection method for Ophiopogon japonicus source genes, thereby improving the speed, accuracy, sensitivity and specificity of Ophiopogon japonicus component detection, while reducing environmental pollution, and providing a new and efficient detection idea for the quality control of Ophiopogon japonicus medicinal materials, thereby providing certain technical support for the identification of Ophiopogon japonicus products on the market, thereby effectively protecting the legitimate rights and interests of consumers and maintaining market order.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a primer set for identifying components of Ophiopogon japonicus using the LMTIA technique, comprising the following primers and probes:

[0008] MaiDF12: 5'-CGCGCCAAGACCTTTTGCGCCAAGGAACAATGCTTT-3';

[0009] MaiDB13: 5'-GTCTTGGCGCGTTTTACGTATGGAAGGATCACGCTG-3';

[0010] MaiD-LF: 5'-GGCACGCGACGCTCTC-3';

[0011] MaiD-Pr: 5'-BHQ2-GGCACGCGACGCC-6-FAM-3'.

[0012] The present invention also provides a kit for identifying components of Radix Ophiopogonis using the LMTIA technique, comprising the primer set.

[0013] The present invention also provides the use of the primer set or the kit in identifying the Radix Ophiopogonis components in traditional Chinese medicines and health products.

[0014] The present invention also provides a detection method for identifying Ophiopogon japonicus components based on LMTIA technology, comprising the following steps: obtaining genomic DNA of a sample to be tested, using the genomic DNA as a template, performing an LMTIA reaction using the primer set, and judging whether the sample to be tested contains Ophiopogon japonicus components based on the presence or absence of an amplification curve.

[0015] Preferably, the LMTIA reaction system includes: 10 μM primers MaiDF12, MaiDB13, MaiD-LF 0.36 μL, 10 μM probe MaiD-Pr 0.1 μL, 5×mix premix 2 μL, 10 U / μL Bst polymerase 0.4 μL, DNA template 2 μL, and ddH2O to 10 μL.

[0016] Preferably, in the LMTIA reaction system, the molar ratio of MaiDF12, MaiDB13, MaiD-LF and probe MaiD-Pr is 8:8:2:5.

[0017] Preferably, the procedure of the LMTIA reaction is: isothermal amplification at 61° C. for 20 min.

[0018] Preferably, the judgment method is: if an amplification curve appears in the amplification result, the sample to be tested contains the Ophiopogon japonicus component; if no amplification curve appears in the amplification result, the sample to be tested does not contain the Ophiopogon japonicus component.

[0019] The present invention discloses the following technical effects:

[0020] This invention establishes a method for rapid, effective, and accurate identification of components of the traditional Chinese medicine Ophiopogon japonicus. The method selects a highly specific fragment of the Ophiopogon japonicus gene as a target sequence and designs LMTIA primers based on this target sequence. Combined with a Proofman probe, key reaction parameters are optimized to successfully establish a Proofman-LMTIA detection system for Ophiopogon japonicus. This method has been applied to the detection of Ophiopogon japonicus components in traditional Chinese medicines. After optimization, the established Proofman-LMTIA method has an optimal reaction temperature of 61°C. The method also demonstrates high specificity, with no cross-reaction with genomic DNA from Ophiopogon japonicus and Ophiopogon japonicus from Hubei Province. Its sensitivity reaches 10 pg / μL. This method was applied to real-world samples, achieving a 100% detection rate for Ophiopogon japonicus components in six traditional Chinese medicines listed with Ophiopogon japonicus in their ingredient lists. These data demonstrate the method's simplicity, high sensitivity, strong specificity, and short reaction time. It holds great potential for rapid Ophiopogon japonicus detection and can meet current demands for rapid Ophiopogon japonicus detection, while also providing a degree of protection for consumer rights. The results demonstrate the applicability of the established Proofman-LMTIA method to the detection of Ophiopogon japonicus components in traditional Chinese medicines and health supplements. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0022] Figure 1 This is the LMTIA amplification plot of the first set of primers for Ophiopogon japonicus; DEPC water: negative control; RFU is relative fluorescence unit;

[0023] Figure 2 This is the LMTIA amplification plot of the second set of primers for Ophiopogon japonicus; DEPC water: negative control; RFU is relative fluorescence unit;

[0024] Figure 3 This is the LMTIA amplification plot of the third set of primers for Ophiopogon japonicus; DEPC water: negative control; RFU is relative fluorescence unit;

[0025] Figure 4 Amplification plots of Proofman-LMTIA with Ophiopogon japonicus primers at 59°C, 61°C, 63°C, and 65°C; B and H: 59°C; A and D: 61°C; E and G: 63°C; C and F: 65°C; M: DEPC water; RFU is relative fluorescence unit.

[0026] Figure 5Figure 2 is the Proofman-LMTIA amplification plot of the Radix Ophiopogonis primers at 60°C, 61°C, and 62°C; F, G, and H: 60°C; C, D, and E: 61°C; A, B, and I: 62°C; J: DEPC water; RFU is relative fluorescence unit;

[0027] Figure 6 The following is the Proofman-LMTIA amplification plot of the sensitivity of the Ophiopogon japonicus primers; 1ng: 1ng / μL Ophiopogon japonicus DNA; 100pg: 100pg / μL Ophiopogon japonicus DNA; 10pg: 10pg / μL Ophiopogon japonicus DNA; 1pg: 1pg / μL Ophiopogon japonicus DNA; 100fg: 100fg / μL Ophiopogon japonicus DNA; 10fg: 10fg / μL Ophiopogon japonicus DNA; DEPC H2O: negative control; RFU is relative fluorescence unit;

[0028] Figure 7 The following is a Proofman-LMTIA amplification plot of the primers specific for Ophiopogon japonicus; A and B: Ophiopogon japonicus; C: DEPC water and other test samples (Euphrasia officinalis, Hedyotis diffusa, Angelica sinensis, Angelica dahurica, Pinellia ternata, Anemarrhena asphodeloides, Lysimachia damiana, Ophiopogon japonicus, and Ophiopogon japonicus); RFU is relative fluorescence unit;

[0029] Figure 8 The Proofman-LMTIA amplification plot shows the detection limit of the Ophiopogon japonicus primers; 100%: Ophiopogon japonicus DNA positive control; 20%, 10%, 5%, 1%, 0.1%, 0.01%: Ophiopogon japonicus DNA was mixed with Hubei Ophiopogon japonicus DNA at a ratio of 20%, 10%, 5%, 1%, and 0.1% to be tested; DEPC H2O: negative control; RFU is relative fluorescence unit.

[0030] Figure 9 The following is a graph showing the Proofman-LMTIA test results for 6 actual samples; Ophiopogon japonicus: positive control; DEPC H2O: negative control; Quanlu Pills, Compound Green Olive Throat Relief Lozenges, Jinming Tablets, Jianmin Throat Tablets, Compound Pien Tze Huang Lozenges, and Juhong Pills: test samples; RFU is relative fluorescence unit. DETAILED DESCRIPTION

[0031] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0032] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0033] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0034] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0035] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0036] Example 1LMTIA primer set design and temperature optimization

[0037] 1. DNA Extraction and Quality Control

[0038] Weigh 100mg of each sample of Ophiopogon japonicus, Ophiopogon japonicus, and Ophiopogon japonicus, and extract plant genomic DNA using a Sangon Biotech kit. The extracted DNA samples were tested using an ultra-micro-nucleic acid and protein analyzer. Once the quality parameters reached the standard range (A260 / A280 ratio between 1.8 and 2.0), confirming that they met the experimental requirements, the samples were stored at -20°C until needed to prevent DNA degradation and facilitate subsequent LMTIA amplification experiments.

[0039] 2. LMTIA Primer and Proofman Probe Design

[0040] The Latin name of Ophiopogon japonicus (Ophiopogon japonicus) was entered into the Chinese Plant DNA Barcode Database and the National Center for Biotechnology Information (NCBI) in the United States. All nuclear gene ITS sequences found in the search results were saved to a file. Next, Ophiopogon-specific sequences were screened and primers and probes were designed. The specific process was as follows: DNAMAN v7.0.2 software was used to align Ophiopogon sequences at specific sites. Oligo 7 software was then used to screen for target sequence fragments that met the requirements. Specificity was then verified using the BLAST tool available on the NCBI website. Finally, primers for LMTIA amplification were designed using the Primer 3Plus online platform for the selected highly specific target sequences. Proofman probes were then designed based on these primers. The designed primers and probes were synthesized by Nanjing GenScript Biotechnology Co., Ltd.

[0041] LMTIA primer design and probe synthesis results:

[0042] ITS sequences of Ophiopogon japonicus retrieved from the Chinese Plant DNA Barcode Database and the National Center for Biotechnology Information (NCBI) were aligned to specific sites using DNAMAN v7.0.2 software. Oligo 7 software was used for analysis, and a fragment with a ladder-like melting temperature and a GC base content of 40% to 60% was identified, specifically (GCGCCAAGGAACAATGCTTTGTCGGAGAGCGTCGCGTGCCGGTCTTGGCGCGCAGCG TGATCCTTCCATACGT) (SEQ ID NO: 7). Specificity was then verified using the BLAST tool on the NCBI website. Finally, LMTIA amplification primers were designed for the selected highly specific target sequences using the Primer 3Plus online platform. Proofman probes were designed based on the primers. The designed primer and probe sequences are shown in Table 1. The designed primers and probes were synthesized by Nanjing GenScript Biotechnology Co., Ltd.

[0043] Table 1 Sequences of primers and Proofman probes for LMTIA of Ophiopogon japonicus

[0044]

[0045] 3. Fluorescent Dye-LMTIA Experiment

[0046] 3.1 Reaction system of fluorescent dye method

[0047] The reaction system of the fluorescent dye method is shown in Table 2.

[0048] Table 2 Reaction system of fluorescent dye method

[0049]

[0050] 3.2 Primer screening experiment for fluorescent dye-LMTIA

[0051] The assay was performed using the Gentier 96E fully automated PCR analysis system developed by Xi'an Tianlong Technology Co., Ltd., and the assay parameters were set. Ophiopogon japonicus DNA was used as a positive control, and DEPC water was used as a negative control. Two replicates were run, and the temperature gradient was set at 52°C, 54°C, 56°C, and 58°C, with a 1.5-minute interval. Fluorescence signal data was collected 40 times. At the end of the experiment, the amplification curves were systematically analyzed to identify the optimal primers for Ophiopogon japonicus detection.

[0052] The results of primer screening for fluorescent dye-LMTIA: The amplification curve of primer screening for Ophiopogon japonicus is as follows: Figure 1 、 Figure 2 、 Figure 3 As shown in the figure, a comparison revealed that all three primer sets were capable of amplification. The first set of Ophiopogon primers (MaiDF12, MaiDB13, MaiD-LF) and the third set (MaiD-F3, MaiDB13, MaiD-LF) achieved similar amplification efficiencies and signals, but the first set exhibited better reproducibility than the third. While the second set of Ophiopogon primers (MaiDF12, MaiD-B2, MaiD-LF) exhibited good overall reproducibility, both the amplification efficiency and signal were weaker than the first and third sets. In summary, the first set of Ophiopogon primers achieved the best amplification results, followed by the third set, and the second set achieved the worst.

[0053] 4Proofman-LMTIA Experiment

[0054] 4.1 Proofman-LMTIA reaction system

[0055] The reaction system of Ophiopogon japonicus Proofman-LMTIA is shown in Table 3.

[0056] Table 3 Reaction system of Ophiopogon japonicus Proofman-LMTIA

[0057]

[0058] 4.2 Temperature Optimization Experiment of Proofman-LMTIA

[0059] The assay was performed using the Gentier 96E fully automated PCR analysis system developed by Xi'an Tianlong Technology Co., Ltd., and the assay parameters were set. Ophiopogon japonicus DNA was used as a positive control, and DEPC water was used as a negative control. Two replicates were run at a temperature gradient of 59°C, 61°C, 63°C, and 65°C. Fluorescence signal data was collected 40 times at 30-second intervals. The optimal temperature among these four temperatures was determined based on the amplification curve. This optimal temperature was then optimized using Ophiopogon japonicus DNA as a positive control and DEPC water as a negative control. Three replicates were run at 60°C, 61°C, and 62°C. Fluorescence signal data was collected 40 times at 30-second intervals. Finally, at the end of the experiment, the amplification curves were systematically analyzed to determine the optimal temperature for the Ophiopogon japonicus reaction system.

[0060] Proofman-LMTIA temperature optimization experiment results: The temperature amplification curve of Ophiopogon japonicus primers (MaiDF12, MaiDB13, MaiD-LF, MaiD-Pr) is shown in the figure below: Figure 4 、 Figure 5 As shown in the figure, a comparison revealed that when amplified at 59°C, 61°C, 63°C, and 65°C, Ophiopogon japonicus DNA, used as a positive control, exhibited amplification at all four temperatures, while DEPC water, used as a negative control, exhibited no amplification. Furthermore, at 59°C, the amplification efficiency, signal, and reproducibility of Ophiopogon japonicus primers were the lowest. At 63°C, the amplification efficiency and signal of Ophiopogon japonicus primers were stronger than at 59°C, but the reproducibility was also poor. At 61°C and 65°C, the amplification efficiency and reproducibility of Ophiopogon japonicus primers were superior to the other two temperatures, but the signal was stronger at 61°C. Therefore, the order of amplification effect from strong to weak was: 61°C > 65°C > 63°C > 59°C. When amplified at 60°C, 61°C, and 62°C, Ophiopogon japonicus DNA, used as a positive control, exhibited amplification at all three temperatures, while DEPC water, used as a negative control, exhibited no amplification. Furthermore, at 62°C, the amplification efficiency and signal of the Ophiopogon japonicus primers were lower than those at the other two temperatures, and reproducibility was poor. While the signals of the Ophiopogon japonicus primers were similar at 60°C and 61°C, the amplification efficiency and reproducibility at 61°C were both better than those at 60°C. Therefore, the order of amplification effect from strong to weak is: 61°C > 60°C > 62°C. In summary, the optimal temperature for the Ophiopogon japonicus primers is 61°C.

[0061] Example 2 Sensitivity Experiment of Proofman-LMTIA

[0062] The assay was performed using the Gentier 96E fully automated PCR analysis system developed by Xi'an Tianlong Technology Co., Ltd., and the detection parameters were set. A gradient dilution of Ophiopogon japonicus DNA (1 ng / μL to 100 fg / μL, five concentration steps) was used as a positive control, and DEPC water was used as a negative control. Three replicates were set up, the temperature was set at 61°C, and fluorescence signal data was collected 40 times at 30-second intervals. At the end of the experiment, the amplification curves were systematically analyzed to determine the sensitivity of the Ophiopogon japonicus primers.

[0063] Proofman-LMTIA sensitivity test results: The sensitivity amplification curve of Ophiopogon japonicus primers (MaiDF12, MaiDB13, MaiD-LF, MaiD-Pr) is shown in the figure below: Figure 6 As shown in the figure, a comparison reveals that Ophiopogon japonicus DNA, used as a positive control, exhibits amplification at all three concentrations: 1 ng / μL, 100 pg / μL, and 10 pg / μL. However, no amplification was observed in the negative control, DEPC water, or at concentrations of 1 pg / μL, 100 fg / μL, and 10 fg / μL. Furthermore, at 1 ng / μL, the Ophiopogon japonicus primers exhibited the best amplification efficiency and reproducibility. At 100 pg / μL, the Ophiopogon japonicus primers exhibited the second-best amplification efficiency and reproducibility, second only to 1 ng / μL. At 10 pg / μL, the Ophiopogon japonicus primers exhibited the worst amplification efficiency and reproducibility, but the signals at 1 ng / μL, 100 pg / μL, and 10 pg / μL were similar. Therefore, the order of amplification effect from strongest to weakest is: 1 ng / μL > 100 pg / μL > 10 pg / μL. Therefore, the lowest sensitivity of Proofman-LMTIA in detecting Ophiopogon japonicus is 10 pg / μL.

[0064] Example 3 Specificity Experiment of Proofman-LMTIA

[0065] The assay was performed using the Gentier 96E fully automated PCR analysis system, developed by Xi'an Tianlong Technology Co., Ltd., and the detection parameters were set. Ophiopogon japonicus DNA served as a positive control, and DEPC water served as a negative control. Samples included Herba Lysimachiae, Hedyotis diffusae, Angelica sinensis, Angelica dahurica, Pinellia ternata, Anemarrhena asphodeloides, Herba Lysimachiae, Ophiopogon japonicus, and Radix Ophiopogonis japonicus. Two replicates were set up, and the temperature was set at 61°C. Fluorescence signal data was collected 40 times at 30-second intervals, representing a 20-minute isothermal amplification. At the end of the experiment, the amplification curves were systematically analyzed to confirm the specificity of the Ophiopogon japonicus primers.

[0066] The specific amplification curves of Ophiopogon japonicus primers (MaiDF12, MaiDB13, MaiD-LF, MaiD-Pr) are shown in Figure 2. Figure 7As shown in the figure, a comparison revealed that in an experiment using Ophiopogon japonicus as a positive control and DEPC water as a negative control, with Ophiopogon japonicus, Radix Ophiopogonis, Herba Hedyotis diffusae, Radix Angelicae Sinensis, Radix Angelicae Dahuricae, Radix Pinelliae, Rhizoma Anemarrhenae, and Herba Lysimachiae as the test samples, only the Ophiopogon japonicus DNA, which served as the positive control, was amplified, while the test samples, including Ophiopogon japonicus, Radix Ophiopogonis, Herba Hedyotis diffusae, Radix Angelicae Sinensis, Radix Angelicae Dahuricae, Radix Pinelliae, Rhizoma Anemarrhenae, and Herba Lysimachiae, as well as the negative control, DEPC water, showed no amplification. Furthermore, the Ophiopogon japonicus primers demonstrated good amplification efficiency, signal, and reproducibility, indicating that the Proofman-LMTIA system has good specificity for detecting Ophiopogon japonicus.

[0067] Example 4 Detection limit experiment of Proofman-LMTIA

[0068] The assay was performed using the Gentier 96E fully automated PCR analysis system developed by Xi'an Tianlong Technology Co., Ltd., and the assay parameters were set. Ophiopogon japonicus served as a positive control, and DEPC water as a negative control. Ophiopogon japonicus DNA was mixed with Hubei Ophiopogon japonicus DNA at ratios of 20%, 10%, 5%, 1%, 0.1%, and 0.01%. Three replicates were set up, the temperature was set at 61°C, and fluorescence signal data was collected 40 times at 30-second intervals. At the end of the experiment, the amplification curves were systematically analyzed to determine the detection limit of the Ophiopogon japonicus primers.

[0069] Proofman-LMTIA detection limit experiment results: The detection limit amplification curve of Ophiopogon japonicus primers (MaiDF12, MaiDB13, MaiD-LF, MaiD-Pr) is shown in the figure below: Figure 8 As shown in the figure, a comparison revealed that in the simulated adulteration experiment with Ophiopogon japonicus and Hubei Ophiopogon japonicus, both the positive control Ophiopogon japonicus DNA and the test sample mixed with Hubei Ophiopogon japonicus DNA at ratios of 20%, 10%, 5%, 1%, and 0.1% amplified the molecule, while the test sample mixed with Hubei Ophiopogon japonicus DNA at a ratio of 0.01% and the negative control DEPC water showed no amplification. Furthermore, the positive control Ophiopogon japonicus primers exhibited the best amplification efficiency, signal, and reproducibility. The test sample mixed with Hubei Ophiopogon japonicus DNA at ratios of 20%, 10%, and 5% showed similar signal and reproducibility, but the order of amplification efficiency from strongest to weakest was: 20% > 10% > 5%. The test sample mixed with Hubei Ophiopogon japonicus DNA at ratios of 1% and 0.1% showed similar amplification efficiency and signal, but the former showed better reproducibility. Therefore, the minimum detection limit for the Ophiopogon japonicus primers is 0.1%.

[0070] Example 5 Actual sample detection experiment of Proofman-LMTIA

[0071] Six commercially available Chinese patent medicines containing Radix Ophiopogonis were randomly selected from the Xuchang Central Branch of Henan Zhang Zhongjing Pharmacy Co., Ltd. and tested using the Proofman-LMTIA method developed in this paper. This method uses the Gentier 96E fully automated PCR analysis system developed by Xi'an Tianlong Technology Co., Ltd., and sets the test parameters. Radix Ophiopogonis served as a positive control, and DEPC water served as a negative control. Quanlu Pills, Compound Green Olive Throat Lozenges, Jinming Tablets, Jianmin Throat Tablets, Compound Pien Tze Huang Lozenges, and Juhong Pills were tested. Three replicates were set, the temperature was set at 61°C, and fluorescence signal data was collected 99 times at 30-second intervals. Finally, at the end of the experiment, the market test results were analyzed using amplification curves.

[0072] Proofman-LMTIA actual sample test results: The Proofman-LMTIA test results of the actual samples of 6 ingredients labeled with Ophiopogon japonicus are as follows Figure 9 As shown. By comparison, it can be found that in the experiment with Ophiopogon japonicus as the positive control and DEPC water as the negative control, and Quanlu Pills, Compound Green Olive Throat Relief Lozenges, Jinming Tablets, Jianmin Throat Tablets, Compound Pien Tze Huang Lozenges, and Juhong Pills as the test samples, the Ophiopogon japonicus DNA as the positive control group and the six test samples were amplified, while only the DEPC water as the negative control was not amplified. Therefore, it can be seen that the Proofman-LMTIA detection method established by the present invention was used to detect the Ophiopogon japonicus components in the six selected Chinese patent medicines, and the detection rate of the Ophiopogon japonicus Proofman-LMTIA system for the Chinese patent medicines labeled with Ophiopogon japonicus was 100%.

[0073] A highly specific fragment of the Ophiopogon japonicus gene was selected as the target sequence, and LMTIA primers were designed for the target sequence. Then, combined with the Proofman probe, the key parameters of the reaction system were optimized, and the Proofman-LMTIA detection system for Ophiopogon japonicus was successfully established and applied to the detection of Ophiopogon japonicus components in traditional Chinese medicines. After optimization, the optimal reaction temperature of the established Proofman-LMTIA method was 61°C; the method had strong specificity and no cross-reaction with genomic DNA of Ophiopogon japonicus, Ophiopogon japonicus, etc.; and the sensitivity could reach 10pg / μL. This method was used for actual sample testing, and the detection rate of Ophiopogon japonicus components in six traditional Chinese medicines with Ophiopogon japonicus listed in the ingredient list was 100%. These data show that this method is simple to operate, highly sensitive, highly specific, and has a short reaction time. It has great development potential, can meet the current demand for rapid detection of Ophiopogon japonicus, and provide certain protection for the consumer rights of the general public.

[0074] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A primer set for identifying components of Ophiopogon japonicus using LMTIA technology, characterized in that: The following primers and probes are included: MaiDF12: 5'-CGCGCCAAGACCTTTTGCGCCAAGGAACAATGCTTT-3'; MaiDB13: 5'-GTCTTGGCGCGTTTTACGTATGGAAGGATCACGCTG-3'; MaiD-LF: 5'-GGCACGCGACGCTCTC-3'; MaiD-Pr: 5'-BHQ2-GGCACGCGACGCC-6-FAM-3'.

2. A kit for identifying components of Radix Ophiopogonis using LMTIA technology, characterized in that: Comprising the primer set according to claim 1.

3. Use of the primer set according to claim 1 or the kit according to claim 2 in identifying Radix Ophiopogonis components in traditional Chinese medicine or health products.

4. A detection method for identifying components of Ophiopogon japonicus based on LMTIA technology, characterized in that: The following steps are involved: Obtain genomic DNA of the sample to be tested, use the genomic DNA as a template, and perform an LMTIA reaction using the primer set according to claim 1, and determine whether the sample to be tested contains Ophiopogon japonicus components based on the presence or absence of an amplification curve.

5. The detection method according to claim 4, wherein The LMTIA reaction system includes: 10 μM primers MaiDF12, MaiDB13, MaiD-LF 0.36 μL in total, 10 μM probe MaiD-Pr 0.1 μL, 5×mix premix 2 μL, 10 U / μL Bst polymerase 0.4 μL, DNA template 2 μL, and ddH2O added to 10 μL.

6. The detection method according to claim 5, wherein In the LMTIA reaction system, the molar ratio of MaiDF12, MaiDB13, MaiD-LF and probe MaiD-Pr is 8:8:2:

5.

7. The detection method according to claim 4, wherein The procedure of the LMTIA reaction is: isothermal amplification at 61° C. for 20 min.

8. The detection method according to claim 4, wherein The judgment method is: if an amplification curve appears in the amplification result, the sample to be tested contains the Ophiopogon japonicus component; if no amplification curve appears in the amplification result, the sample to be tested does not contain the Ophiopogon japonicus component.

Images