Preparation method and application of Asian cotton root tip paraffin section

Abstract

The invention discloses a preparation method and application of an Asian cotton root tip paraffin section. The preparation method comprises the following steps: S21, culturing an experimental material; s22, taking and fixing experimental materials; s23, dehydrating the experimental material; s24, transparency of the experimental material; s25, carrying out wax dipping on the experimental material; s26, embedding the experimental material; s27, performing wax repairing on the experimental material; s28, preparing hybridized slices of experimental materials; the prepared section can be used for carrying out positioning research on the Asian cotton root tip gene by adopting an RNA in-situ hybridization method, the method has very high sensitivity and specificity, and the obtained hybridization section result can be stored for a long time.

Description

[0001] This application is a divisional application of the patent application with the application date of July 29, 2022, application number 202210911280.6, and invention name “A RNA in situ hybridization method for gene localization research in Asian cotton root tips”. Technical Field

[0002] The invention relates to the fields of plant molecular biology technology and plant microscopy technology, and in particular to an RNA in situ hybridization method for studying the location of genes in root tips of Asian cotton. Background Art

[0003] Cotton is an important cash crop. Cotton fiber is an important raw material for the textile industry and the main raw material for people's clothing and daily textiles. Since the Industrial Revolution in the 18th century, the invention of the flying shuttle, spinning machine, loom and cotton gin has promoted the development of the cotton textile industry and cotton production, making cotton increasingly important. Over the past century, cotton fiber has always accounted for a large proportion of the total consumption of textile raw materials. G. arboreum Native to Asia, first cultivated and spread by Asians, Asian cotton is also known as native cotton, purple cotton, or small cotton. Due to its long history of introduction and widespread cultivation, Asian cotton has produced numerous superior varieties and variants, forming the renowned Chinese cotton strain. Therefore, Asian cotton has played a crucial role in the development and improvement of cotton fiber.

[0004] With the continuous advancement of genomic research, a large number of studies focusing on quantitative gene expression analysis have emerged in plant biology. Microarrays and next-generation sequencing methods are being used to study developmental, physiological, and stress-responsive processes, dissect epigenetic and small RNA pathways, and construct large-scale gene regulatory networks (Rensink and Buel 2005; Li et al. 2010; Lister and O'Malley 2008). While these technologies facilitate the simultaneous analysis of large gene sets, they typically provide only very limited spatiotemporal resolution of gene expression changes. This limitation can be overcome by combining some analytical methods with laser microdissection or fluorescence-activated cell sorting (FACS) (Brady and Orlando 2007; Brooks and Strable 2009; Galbraith and Birnbaum 2006; Ohtsu and Smith 2007). However, to fully understand the biological role of a gene, understanding its spatiotemporal expression pattern at cellular resolution is essential. Detailed analysis of gene expression patterns is particularly crucial when studying developmental processes or the effects of environmental stimuli and mutations. For example, in different developmental parts of the root, key genes that affect root growth, and the differential expression of different parts of the root tip in response to abiotic stress. Therefore, studying the spatiotemporal expression pattern of genes plays an important role in gene localization, functional research, and the screening of key genes.

[0005] RNA in situ hybridization technology can detect target mRNAs in cells by hybridizing with labeled antisense RNA probes obtained by in vitro transcription of the gene of interest. With the application of single-cell transcriptome sequencing technology in plants, RNA in situ hybridization technology is further needed to locate marker genes in different parts of different plants. At present, the RNA in situ hybridization technology system is relatively mature in plants mainly including Arabidopsis thaliana, rice, corn, poplar and peanut. However, the current RNA in situ hybridization method does not yet have a complete system to be applied to cotton, especially to the positioning of specific genes in the root tip of Asian cotton. Therefore, the present invention is of great significance to the application of single-cell transcriptome sequencing technology in cotton root tip and the positioning research of specific marker genes. Summary of the Invention

[0006] The present invention aims to provide an RNA in situ hybridization method for studying gene localization in the root apex of Asian cotton. This method is used to study the expression of target genes during the development of the lateral root apex of Asian cotton. Combined with single-cell transcriptome sequencing, specific marker genes in different parts of the root apex are screened, facilitating the application of single-cell transcriptome sequencing technology in the cotton root apex and the localization of specific marker genes.

[0007] In order to achieve the above objectives, the main technical solutions adopted by the present invention include: An RNA in situ hybridization method for studying gene localization in root tips of Asian cotton comprises the following steps: S1. Preparation of a sense probe and an antisense probe containing a target gene sequence as shown in SEQ ID NO. 1; S2. Preparation of experimental samples: paraffin sections of cotton root tips were prepared; S3. Prehybridization: After dewaxing, rehydration with graded alcohol, HCl treatment, Proteinase K digestion, RNA re-fixation, acetylation, and dehydration, the sections were placed on a staining rack and sealed and stored at 4°C. S4, hybridization incubation treatment: The hybridized section sample obtained in step S3 is first hybridized and incubated with the sense probe and antisense probe obtained in step S1 in a 50°C incubator in the dark, and then hybridized and incubated for a second time at room temperature; S5, post-hybridization treatment: the sample obtained in step S4 is treated with TBS-BSA and Buffer 3 in sequence, and then treated with NBT / BCIP color development solution; S6. Microscopic examination: Rinse the parafilm off the colored slices with distilled water, then air dry them in a fume hood. After the slices are dry, place them under a microscope for observation and photography. S7. Post-reaction processing and storage: For slice samples where hybridization signals are observed, terminate the reaction with distilled water, treat with gradient ethanol and gradient xylene, and then blow dry in a fume hood. Add 80μL neutral gum (neutral resin: xylene volume ratio is 1:1) to each slide for sealing, and dry at 37℃. The experimental results can be preserved for a long time.

[0008] In the RNA in situ hybridization method described above, preferably, in step S1, a target gene having a sequence as shown in SEQ ID NO. 1 is first obtained by PCR amplification, the target gene is transcribed and connected to a T7 promoter to obtain a sense probe, and the target gene is transcribed and connected to an SP6 promoter to obtain an antisense probe.

[0009] In the RNA in situ hybridization method described above, preferably, the preparation of the experimental sample in step S2 specifically includes the following steps: S21. Cultivation of experimental materials: Using tissue culture method, select Asian cotton seeds with full grains and place them in MS medium for growth; S22. Collection and Fixation of Experimental Materials: 5-day-old, uniformly growing lateral root tips of Asian cotton were selected. 1-2 cm long root tip segments were taken on ice as experimental samples and placed in pre-chilled fixative. Vacuum treatment was performed to allow the fixative to quickly penetrate the interior of the experimental sample. S23. Dehydration of experimental materials: Dehydrate the experimental samples in 50% ethanol three times, each time for 30 minutes; 70% ethanol, overnight; 85% ethanol, time for 1 hour; 95% ethanol, time overnight; and anhydrous ethanol twice, each time for 1 hour. The entire process was carried out in a 4°C refrigerator. Ethanol was diluted with DEPC water. S24. Transparent treatment of experimental materials: Perform the treatment at room temperature by sequentially passing the experimental samples through solutions with ethanol:xylene volume ratios of 3:1, 1:1, 1:3, 0:1, and 0:1 for 1 hour each. S25. Wax dipping of experimental materials: Place the experimental sample in 50 mL of xylene and 1 / 4 volume of wax chips, and place in a 42°C oven overnight. Continue to add wax chips to the xylene solution until the xylene solution is gradually saturated. This process continues for 2-3 days. Transfer the experimental samples into dissolved pure liquid paraffin and immerse them in wax in a 60°C oven. Replace the wax with fresh liquid paraffin every night for three consecutive days to ensure that the paraffin fills the interior of the plant samples. S26. Embedding of experimental materials: Pour dissolved pure liquid paraffin into a preheated embedding mold, take out the experimental sample, place it in the embedding mold and position it according to the sectioning requirements. After the paraffin surface solidifies, quickly put it into cold water to allow the paraffin to solidify quickly; S27. Wax trimming of experimental materials: Remove the wax block from the embedding mold and trim the wax block sample into a horizontal or vertical section according to the needs of paraffin sectioning. The section of the microtome blade should be rectangular, otherwise it will be difficult to cut into wax strips; S28. Preparation of hybridization sections of experimental materials: Cut the wax block into wax strips with a thickness of 6-10 μm, add DEPC water on an RNase-free slide, use a blade to divide the wax strip into small pieces, spread them flat on the slide, and let the wax strip float on the DEPC water. Place the slide on a 37°C slide dryer for no more than 5 minutes to prevent RNA degradation. After the wax strip is flattened, absorb the excess water, and finally place the slide in a section box and store it at 4°C for later use.

[0010] In the RNA in situ hybridization method described above, preferably, the formula of the MS medium is MURASHIGE&SKOOG 4.33 g / L, glucose 15 g / L, and Phytagel 2.6 g / L, the pH of the medium is 6.1-6.2, and the culture conditions are a constant temperature of 28° C., 16 h light / 8 h dark; The fixative is 50% FAA, including: 50 mL of anhydrous ethanol, 10 mL of 37% formaldehyde solution, 5 mL of glacial acetic acid, and 35 mL of DEPC water; the vacuum pressure range is 0.04-0.06 MPa until all the sample materials sink into the fixative.

[0011] In the RNA in situ hybridization method described above, preferably, in step S3, the prehybridization process is as follows: the slice sample on the slide is sequentially subjected to 100% xylene for 10 min; 100% xylene for 10 min; 75% xylene + 25% ethanol for 2 min; 25% xylene + 75% ethanol for 2 min; 100% ethanol for 2 min; 95% ethanol for 2 min; 80% ethanol for 2 min; 60% ethanol for 2 min; 30% ethanol for 2 min; DEPC water (fresh) for 2 min; 0.25M HCl for 20 min; DEPC water for 5 min; 2×SSC for 20 min; DEPC water for 5 min; Proteinase K (fresh) solution, 37°C for 30 min; 1×PBS for 2 min; 0.2% Glycine (fresh) for 2 min; 1×PBS for 2 min; 1×PBS for 2 min; 4% formaldehyde for 10 min; 1×PBS for 5 min; 1×PBS for 5 min; acetylation reagent (fresh) for 5 min; 1×PBS 5min; 1×PBS 5min; store at 4℃ for later use. The pre-hybridization process is complete.

[0012] The 0.25M HCl solution is prepared from DEPC water, mainly composed of 68.491 mL of DEPC water and 1.509 mL of concentrated hydrochloric acid; The 2×SSC is prepared from 20×SSC (3M NaCl, 0.3M trisodium citrate, DEPC water, pH 7.0, autoclaved) and DEPC water. The working solution concentration after dilution is 2×SSC. The Proteinase K (fresh) solution: 7 mL 1 M Tris (pH 8.0) + 7 mL 0.5 M EDTA (pH 8.0) + 56 mL DEPC water + 20 μL Proteinase K Stock, prepared for immediate use; 1×PBS: 1×PBS was obtained by diluting 10×PBS (1.3M NaCl, 70mM Na2HPO4, 30mM NaH2PO4, pH 7.4) with DEPC water, and sterilized by autoclave after DEPC treatment; 0.2% glycine: 7 mL 10×PBS + 63 mL DEPC water + 0.12 g glycine, prepared and used immediately; The 4% formaldehyde solution was prepared by mixing 7.56 mL of 37% formaldehyde and 7 mL of 10× PBS, and then adding DEPC water to make the volume up to 70 mL.

[0013] The acetylation reagent was prepared by adding 670 µL triethanolamine, 200 µL HCl, and 125 µL acetic anhydride to 50 mL DEPC water and was used immediately.

[0014] In the RNA in situ hybridization method described above, preferably, in the above step S4, the first hybridization incubation process is as follows: First, air-dry the hybridized sections obtained in step S3 until the sections are pure white. Dilute the sense and antisense probes by diluting 1 µg (per hybridized section) of each probe to 40 µL (per hybridized section) with 50% formamide, mix well, denature at 80°C for 2 minutes, immediately cool on ice for 2-3 minutes, and centrifuge. Then add 80µL of Hyb Solution to each hybridized section, mix well with a pipette tip with the tip cut off, draw 120µL of the above probe hybridization solution (the amount for each hybridized section) and slowly drip it onto the slide containing the hybridized section, and slowly cover it with a parafilm of the same size; place the slide in a humidified chamber and hybridize overnight in a 50℃ oven in the dark.

[0015] The probe hybridization solution for each hybridization section is as follows: 1µg sense probe or antisense probe (1µg / (sense probe concentration / antisense probe concentration)), 50% formamide (40µL - 1µg sense probe or antisense probe concentration), 80µL Hyb Solution, prepared with DEPC water; The Hyb Solution was prepared with DEPC water, 5 mL of deionized formamide, 2 mL of 50% dextran sulfate, 1 mL of 10× blocking reagent, 0.6 mL of 5 M NaCl, 100 µL of 1 M Tris (pH 7.5), 20 µL of 0.5 M EDTA (pH 8.0), 150 µL of 10 mg / mL tRNA, and 1.13 mL of DEPC water. It was stored at -20°C until use. 5M NaCl: 29.22 g NaCl was dissolved in 80 mL ultrapure water, the volume was adjusted to 100 mL, and the solution was sterilized by autoclave after DEPC treatment. 1M Tris (pH 7.5): Dissolve 12.11 g of Tris in 80 mL of DEPC water, add 6.5 mL of concentrated hydrochloric acid, dilute to 100 mL, and adjust the pH to 7.5; The 10× blocking reagent: 5 g of blocking reagent (Roche) was dissolved in 50 mL of Maleic buffer (heated in a 65°C water bath), sterilized by high pressure after DEPC treatment, and stored at 4°C (opaque) until used; The Maleic buffer: 1.161 g DL-maleic acid and 0.8766 g NaCl were dissolved in 80 mL of water, solid NaOH was added to adjust the pH to about 5.0, and then 1 M NaOH was slowly added to adjust the pH to about 7.5 and then the volume was fixed to 100 mL.

[0016] In the RNA in situ hybridization method described above, preferably, in the above step S4, after the first hybridization incubation treatment, the sample is processed as follows before the second hybridization incubation antibody is used to incubate the slice sample: After the first hybridization incubation, the hybridized sections were placed in 0.2×SSC solution preheated at 50°C to rinse off the parafilm membrane, and then treated with 0.2×SSC solution at 50°C for 1 hour; 0.2×SSC solution at 50°C for 1 hour; NTE solution at 37°C for 5 minutes; NTE solution at 37°C for 5 minutes; NTE + RNase solution at 37°C for 30 minutes; NTE solution at 37°C for 5 minutes; NTE solution at 37°C for 5 minutes; 0.2×SSC solution at 50°C for 1 hour; 1×TBS solution for 5 minutes; blocking solution for 45 minutes; and TBST-BSA solution for 45 minutes. The NTE: 14.61 g NaCl, 1 mL 0.5 M EDTA (pH 8.0), and 5 mL 1 M Tris (pH 8.0) were dissolved in 400 mL sterile water, mixed, and then made up to 500 mL with sterile water and sterilized by autoclaving; NTE + RNase: add 35uL RNase A solution to 70mL NTE; The RNase A solution has a concentration of 10 mg / mL and is stored at -20°C for future use. The 1×TBS solution is prepared by diluting 10×TBS (1M Tris pH 7.5, 1.5M NaCl, autoclaved) with sterile water to obtain the final working solution 1×TBS. The blocking solution was prepared by adding 5 mL of 10× blocking solution and 5 mL of 10× TBS, followed by 40 mL of sterile water.

[0017] In the RNA in situ hybridization method described above, preferably, in the above step S4, the second hybridization incubation process is as follows: diluting the antibody solution DIG-AP with a TBST-BSA solution at a ratio of TBST-BSA:DIG-AP=2000:1; adding the diluent (120 μL / slide) to a glass slide, covering it with a parafilm of the same size, and placing it in a humidified chamber at room temperature in the dark for 2 h.

[0018] In the RNA in situ hybridization method described above, preferably, in step S5, the post-hybridization treatment process is: At room temperature, the parafilm membrane was rinsed with TBST-BSA solution; the slides were treated with TBST-BSA solution for 15 min; the slides were treated with TBST-BSA solution for 15 min; the slides were treated with Buffer 3 solution for 5 min; the slides were treated with Buffer 3 solution for 5 min. Finally, 120 μL / slide of NBT / BCIP color development solution was added to each slide in a dark environment for color development, and the slides were covered with a parafilm membrane of the same size and placed in a humidified chamber for color development at room temperature in the dark. The Buffer 3 solution is prepared with sterile water and contains: 50 mL 1M Tris (pH 9.5), 10 mL 5M NaCl, 25 mL 1M MgCl2, and then refilled with sterile water to 500 mL. The solution is then sterilized by high pressure. After standing for a period of time, a flocculent precipitate will form in the Buffer 3 solution. The solution can be used after being shaken until the precipitate disappears. The NBT / BCIP color development solution: Each slide contains: 2.5 μL NTB / BCIP stock solution and 125 μL Buffer 3.

[0019] In the RNA in situ hybridization method described above, preferably, in step S7, the processing and storage process after the reaction is terminated is: At room temperature, for the slice samples where hybridization signals were observed, they were sequentially treated with sterile distilled water for 2 minutes; sterile distilled water for 2 minutes; 30% ethanol for 2 minutes; 60% ethanol for 2 minutes; 80% ethanol for 2 minutes; 95% ethanol for 2 minutes; 100% ethanol for 2 minutes; 25% xylene + 75% ethanol for 2 minutes; 75% xylene + 25% ethanol for 2 minutes; 100% xylene for 5 minutes; 100% xylene for 5 minutes; then 80 μL of neutral gum (the volume ratio of neutral resin: xylene is 1:1) was added to each slide for sealing and dried at 37°C. The experimental results can be preserved for a long time.

[0020] The beneficial effects of the present invention are: This invention provides an RNA in situ hybridization method for gene localization in the root tip of Asian cotton. It can be used to localize specific cotton genes, converting invisible signals into visible colors. Furthermore, this method easily overcomes the difficulties in identifying marker genes in currently popular single-cell transcriptome sequencing technologies. It also boasts high sensitivity and specificity, and the hybridization sections obtained can be preserved for long periods of time.

[0021] The present invention provides an RNA in situ hybridization method for studying the location of genes in the root tip of Asian cotton, which has been successfully applied to the in situ hybridization experiment of cotton root tips for the first time. The present invention places the cotton root tip in a filter for fixation, dehydration, transparency and wax soaking, thereby avoiding damage to the tissue during the movement of the root tip, thereby preparing a structurally complete paraffin section of the cotton root tip. The existing paraffin section technology is still unable to prepare such a structurally complete paraffin section from the tender cotton root tip tissue. In addition, cotton is a polysaccharide and polyphenol plant. Compared with the existing technology, the present invention effectively avoids the influence of polysaccharides and polyphenols on the in situ hybridization of cotton root tips, and the hybridization background is relatively clear, which is of great significance for the determination of tissue site marker genes in the single-cell transcriptome sequencing of cotton root tips. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 These are the Asian cotton seedlings and the ball filter used in the embodiments of the present invention.

[0023] Figure 2 This is a section diagram in the embodiment of the paraffin section preparation method of the present invention.

[0024] Figure 3 This is a vector map in the examples of the present invention.

[0025] Figure 4 This is an electrophoresis diagram of the gene cloning process in an embodiment of the present invention.

[0026] Figure 5 This is an electrophoresis diagram of colony PCR in the gene cloning process in an embodiment of the present invention.

[0027] Figure 6 This is a sequence alignment diagram of the sequencing results in the examples of the present invention.

[0028] Figure 7 This is the electrophoresis diagram of the plasmid extracted from a single colony that was correctly sequenced in the example of the present invention.

[0029] Figure 8 This is the electrophoresis diagram of the synthetic probe in the embodiment of the present invention.

[0030] Figure 9 This is a schematic diagram of the in situ hybridization results with a T7 sense probe in an embodiment of the present invention.

[0031] Figure 10 Schematic diagram of the in situ hybridization results with the SP6 antisense probe in an embodiment of the present invention.

[0032] Figure 11 This is a slice diagram obtained by the paraffin slice preparation method in the comparative example of the present invention. DETAILED DESCRIPTION

[0033] The present invention uses the single-cell transcriptome sequencing data of the lateral root tip of Asian cotton to analyze and obtain specific marker genes for the root cap tissue part GaCYP88D6 , further amplify the specific fragment of the gene through primers, and then use RNA in situ hybridization technology, according to the principle of complementary pairing of nucleic acid bases, hybridize the labeled single-stranded antisense RNA synthesized in vitro with the target RNA in the tissue or cell, locate the antisense RNA probe to the expression area of ​​the gene to be tested, and through the alkaline phosphatase (AP) combined with the DIG label on the probe and the colorless substrate added to AP later, the located expression area is converted into a colored precipitation deposition area (blue-purple), which is finally conducive to the paraffin section and RNA in situ hybridization technology to locate the gene GaCYP88D6 The location of the marker genes screened by single-cell transcriptome sequencing was further demonstrated by locating them in the root cap tissue of the root tip of the Asian cotton lateral root.

[0034] In order to better explain the present invention, so as to facilitate understanding, the following Figure 1-11 The present invention will be described in detail through specific embodiments, but the embodiments of the present invention are not limited thereto. Wherein, X% ethanol refers to an aqueous solution with an ethanol volume content of X%.

[0035] In the following examples, the corresponding genes are described as follows: SEQUENCE A: This is an embodiment of the present invention GaCYP88D6 The CDS region sequence of the gene is as follows: SEQUENCE A (SEQ ID NO.1): AGAACCCCGGATTGAAAGGAAAGAATTTCATTCCCTTTGGAGGAGGAAGTAGAATCTGCCCTGGATCTGACCTAGGCAAACTTGAGGTCTCCATTTTCCTGCACCATTTTCTCTCAATTATAAGCTTGAAGAGCTGAATCCAAAGGCTCCAACCATTACCTTACCTTTGACACGCCCAGCAGACAACT SEQUENCE B: is the forward primer sequence for the amplified fragment of the embodiment of the present invention; SEQUENCE C: is the reverse primer sequence of the amplified fragment of the embodiment of the present invention; The primer sequences are as follows: SEQUENCE B (SEQ ID NO.2): AGAACCCCGGATTGAAAGGAAAGA; SEQUENCE C (SEQ ID NO. 3): AGTTGTCTGCTGGGCGTGT.

[0036] Example 1 An RNA in situ hybridization method suitable for studying gene localization in root tips of Asian cotton comprises the following steps: Step 1: Preparation of probes for target genes; 1. Preparation and linearization of probe template In the early stage of this invention, candidate target genes of the root tip and root cap tissue of Asian cotton were screened by single-cell transcriptome sequencing and UMAP dimensionality reduction cluster analysis, and specific regions of the target genes were selected, such as sequences with high specificity in the CDS region of the gene, or the 5' or 3' UTR region. SnapGene 4.1.9 software was used to design GaCYP88D6 The specific sequence and amplification primers for the transcription template are selected and the selected highly specific sequence is aligned with the reference genome sequence of the species. The sequence should be consistent with the target gene and have low similarity with other gene sequences. Probes should have good specificity and should not match other genes for more than 50 bp. Hybridization probes should be 150-200 bp in length; probes longer than this should be hydrolyzed. The transcription template should not exceed 1.5 kilobases. The GC content of the probe should ideally be 40-60%, with no consecutive repeated bases.

[0037] Root tip tissue from Asian cotton was ground with liquid nitrogen, and RNA was extracted using a plant RNA extraction kit (Tiangen). RNA was then reverse-transcribed into cDNA using a reverse transcription kit (Quanshijin). Specific sequences were amplified using a PCR amplifier, using the Asian cotton cDNA as a template.

[0038] The enzymes used in the cloning reaction were TransTaq DNA Polymerase High Fidelity (HiFi) (Full Gold), cloning reaction system: PCR amplification system: 2 μL template (i.e., liquid nitrogen ground Asian cotton root tip tissue, extracted RNA, and reverse transcribed cDNA as template), 1 μL upstream primer (SEQUENCE B), 1 μL downstream primer (SEQUENCE C), 5 μL 10× TransTaq DNA HiFi Buffer I, 4μL 2.5mM dNTPs, 1μL TransTaq HiFi DNA Polymerase, 36μL Nuclease-free water.

[0039] Cloning PCR amplification conditions: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s (35 cycles); extension at 72°C for 5 min; and storage at 4°C.

[0040] The PCR products obtained from the above PCR amplification were examined by electrophoresis on a 1% agarose gel. The specific target fragment was rapidly excised under UV light in the dark and recovered using an agarose gel recovery kit (Tiangen). The recovered product was ligated into the p-GEM-T Easy (TaKaRa) vector using the following system: 1 μL of the specific target fragment's gel-recovered product, 1 μL of the p-GEM-T Easy vector, 0.5 μL of T4 DNA Ligase, and 2.5 μL of 2× Rapid Ligation Buffer. The entire reaction system was incubated overnight at 4°C. The ligation product was then heat-shocked by adding it to 50 μL of Top10 competent cells, incubated on ice for 25 minutes, then heat-shocked at 42°C for 90 seconds, and then incubated on ice for 2 minutes. The cells were then transferred to a 2 mL sterile centrifuge tube and incubated with 300 μL of SOC liquid medium. The cells were incubated at 37°C in a shaker at 200 rpm for 1.5 hours. Finally, 200 μL of the bacterial culture was spread evenly on an LB plate containing 50 mg / L ampicillin, allowed to dry, and then incubated inverted in a 37°C incubator for 12-18 hours. Individual colonies were streaked onto the plates and allowed to grow. Positive clones were initially screened by colony-based PCR amplification. Eight to ten colonies were selected and sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing using the T7 primer (TAATACGACTATAGG). The sequencing results were compared with the specific target sequence (SEQUENCE A) using DNAMAN software. Single colonies with correct alignment were selected for inoculation, shaken, and cultured overnight at 37°C (180-200 rpm). Plasmid DNA was extracted using a plasmid extraction kit (Tiangen), and the probe template containing the target gene was linearized.

[0041] The p-GEM-T Easy vector map is as follows Figure 3 As shown. Figure 4 The cDNA of root tip tissue of Asian cotton was used as template to clone GaCYP88D6 The CDS region of the gene is specific. Lane 1 (from left to right) is the DL2000 Plus DNA Marker; Lanes 2-4 (from left to right) are the electrophoresis results of cloning using Asian cotton cDNA as a template. The size of the band in the electrophoresis is about 200bp, which is consistent with the cloned GaCYP88D6 The CDS region of the gene is of the same size as the specific gene and can be used for subsequent transformation of Top10 competent cells.

[0042] like Figure 5 As shown, the cloned specific fragment was connected to the p-GEM-T Easy vector and identified by colony PCR. Lane 1 (from left to right) is the DL2000 Plus DNA Marker; lanes 2-12 (from left to right) are the electrophoresis results of colony PCR of the cloned fragment using Asiatic cotton DNA as a template and connected to the p-GEM-T Easy vector. The band size in the electrophoresis pattern is about 200bp and can be used for sequencing.

[0043] like Figure 6 As shown, the Asian cotton cDNA was used as a template for cloning and the sequence was sequenced using T7 primers. GaCYP88D6 Sequencing alignment results diagram showing correct sequencing results.

[0044] like Figure 7 As shown, GaCYP88D6 Plasmids were extracted from single colonies with correct sequencing results, and the obtained plasmid electrophoresis results are shown in the figure; among them, lane 1 (from left to right) is DL2000 Plus DNA Marker; lanes 2-7 (from left to right) are plasmids from single colonies with correct sequencing results (including GaCYP88D6 Electrophoresis of plasmid containing specific fragments.

[0045] 2. Probe Transcription and Collection Probe transcription was performed using the Roche DIG RNA Labeling Kit (SP6 / T7). The sense probe consisted of SEQUENCE A linked to T7 RNA Polymerase (Roche), and the antisense probe consisted of SEQUENCE A linked to SP6 RNA Polymerase (Roche). All reagents used for transcription were prepared with DEPC water. The transcription system and method are as follows: The transcription system consisted of 1 μg of linearized template, 2 μL of 10× Transcription Buffer, 2 μL of 10× NTP Labeling Mixture, 1 μL of RNase Inhibitor, and 2 μL of T7 or SP6 RNA Polymerase. Add DEPC water to a total volume of 20 μL and transcribe at 37°C for 2.5 hours. Then, add 2.5 μL of DNase I and treat at 37°C for 15 minutes to remove the DNA template. The reaction was terminated by adding 1 μL of 0.5 M EDTA (pH 8.0). Then, add 2.5 μL of 4M LiCl and 75 μL of anhydrous ethanol to the product and freeze it at -20°C overnight. The next day, centrifuge the product at 0°C for 20 minutes at 12,000 rpm. Remove the supernatant, rinse with 150 μL of 80% ethanol, centrifuge at 0°C for 20 minutes at 12,000 rpm. Aspirate the supernatant, dry the pellet in the enzyme-free centrifuge tube on a clean bench, dissolve it in 20-40 μL of DEPC-free water, measure the concentration, and aspirate 1-2 μL of the pellet for electrophoresis on a 1% agarose gel. Store the remaining probe product at -80°C. Note: Before electrophoresis, treat the electrophoresis tank, comb, bottom plate, and conical flask used for gel preparation with enzyme-free treatment. Ensure maximum sterility and enzyme-free operation throughout the entire process.

[0046] The results are as follows Figure 8 The following is an electrophoresis diagram of the synthetic probe template; among them, lane 1 (from left to right) is the DL2000Plus DNA Marker; lane 2 (from left to right) is the electrophoresis diagram of the synthetic sense probe (connected to the T7 promoter); lane 3 (from left to right) is the electrophoresis diagram of the synthetic antisense probe (connected to the SP6 promoter). The electrophoresis diagram shows that the size of lanes 2 and 3 is about 200bp, which is consistent with the GaCYP88D6 The CDS region sequences (SEQUENCE A) are of the same size and can be used for subsequent hybridization experiments.

[0047] Step 2: Preparation of experimental samples; (1) Cultivation of experimental materials: The experimental materials were Asian cotton seedlings. Using tissue culture, Asian cotton seeds of uniform size and full grains were selected. The seeds were first delinted and dehulled with concentrated sulfuric acid. The seeds were sterilized in a clean bench with 0.1% HgCl for 15 minutes, then washed three times with sterile water for 5 minutes each time. The seeds were then placed in MS culture medium and propped up the next day. The growth conditions for the tissue culture method used were a constant temperature of 28°C and a 16-hour light / 8-hour dark period. Samples were taken approximately 5 days after growth, when the lateral roots grew to 2-3 cm.

[0048] The formula of the above-mentioned MS culture medium is MURASHIGE&SKOOG 4.33 g / L, glucose 15 g / L, and Phytagel 2.6 g / L. The pH of the culture medium is 6.1-6.2, and it is sterilized by high pressure.

[0049] (2) Collection and fixation of experimental materials: Select the root tips of the lateral roots of Asian cotton that have grown for 5 days and have the same growth (such as Figure 1 As shown in the left figure, take samples on ice and cut 1-2 cm long root tip fragments of Asian cotton seedlings with a sharp double-sided blade as experimental samples. Figure 1 As shown in the figure on the right), place the spherical filter into the pre-cooled fixative solution; vacuum treatment is to allow the fixative solution to quickly enter the sample, and keep it in the fixative solution in a 4°C refrigerator overnight for fixation.

[0050] The fixative is 50% FAA (formalin-acetic acid-ethanol), which includes 50 ml of anhydrous ethanol, 10 ml of 37% formaldehyde solution, 5 ml of glacial acetic acid, and 35 ml of DEPC water. The vacuum pressure range is 0.04-0.06 MPa, and the sample material is removed after all the sample material sinks into the fixative.

[0051] (3) Dehydration of experimental materials: The fixed samples were dehydrated in 50% ethanol three times for 30 minutes each; 70% ethanol overnight; 85% ethanol for 1 hour; 95% ethanol overnight; and anhydrous ethanol twice for 1 hour each. The entire process was carried out in a refrigerator at 4°C, and the ethanol was diluted with DEPC water.

[0052] (4) Transparency of experimental materials: The samples were processed at room temperature by sequentially passing through solutions with ethanol:xylene volume ratios of 3:1, 1:1, 1:3, 0:1, and 0:1, with each ratio of solution being treated for 1 hour for transparency.

[0053] (5) Wax immersion of experimental materials: Place the spherical filter containing the sample in 50 ml of xylene and 1 / 4 of the volume of wax chips, and then place it in a 42°C oven for overnight treatment. Continue to add wax chips to the xylene until the xylene solution is gradually saturated (i.e., the wax chips are no longer soluble in the xylene). This process takes 2-3 days. At the same time, dissolve solid pure paraffin in a 60°C oven in advance. Transfer the spherical filter containing the sample to the dissolved pure liquid paraffin and immerse it in wax in a 60°C oven. Replace the liquid paraffin with fresh liquid paraffin for 3 consecutive nights to ensure that the paraffin fills the interior of the plant sample.

[0054] (6) Embedding of experimental materials: Preheat the toothless tweezers and embedding mold in a 60°C oven. Select a suitable embedding mold according to the sample size. Pour the dissolved pure liquid paraffin into the preheated embedding mold. Take out the sample and place it in the embedding mold and position it according to the sectioning requirements. After the surface of the paraffin solidifies, quickly place it in cold water to allow the paraffin to solidify quickly. After it is completely solidified, store it in a 4°C refrigerator.

[0055] (7) Wax trimming of experimental materials: Take the wax block out of the embedding mold and trim the sample into a cross-section according to the needs of paraffin sectioning. The cutting surface of the slicer blade should be rectangular, otherwise it will be difficult to cut into wax strips.

[0056] (8) Preparation of hybridization sections of experimental materials: Glue the trimmed wax block to a rectangular base and fix it on a microtome. Place the wax block parallel to the blade of the microtome and adjust the slice thickness to 6-10 μm. When slicing, use a brush to pick up the wax strips and lay the cut wax strips flat on a clean paper. Add DEPC water to an RNase-free slide and use a blade to cut the wax strips into small pieces. Lay the small pieces flat on the slide so that the wax strips float on the DEPC water. Place the slide in a 37°C dryer for no more than 5 minutes to prevent RNA degradation. After the wax strips are flattened, absorb the excess water and finally place the slide in a section box at 4°C for storage.

[0057] Step 3, pre-hybridization: Observe and select structurally intact hybrid sections of Asian cotton root tips and crowns under a microscope, and perform dewaxing, gradient alcohol rehydration, HCl treatment, Proteinase K digestion, RNA re-fixation, acetylation, and dehydration. Place the sections on a staining rack and seal them at 4°C for storage or use in in situ hybridization experiments.

[0058] The prehybridization process is as follows: the slides were dewaxed in 100% xylene for 10 min; 100% xylene for 10 min; 75% xylene + 25% ethanol for 2 min; 25% xylene + 75% ethanol for 2 min; 100% ethanol for 2 min; 95% ethanol for 2 min; 80% ethanol for 2 min; 60% ethanol for 2 min; 30% ethanol for 2 min; DEPC water (fresh) for 2 min, then rehydrated with gradient alcohols; 0.25 M HCl for 20 min; DEPC water for 5 min; 2× SSC for 20 min; DEPC water for 5 min; Proteinase K (fresh) solution at 37°C for 30 min; 1× PBS for 2 min; 0.2% Glycine (fresh) for 2 min; 1× PBS for 2 min; 1× PBS for 2 min; 4% formaldehyde for 10 min; 1× PBS for 5 min; 1× PBS for 5 min; acetylation reagent (fresh) for 5 min; 1× PBS 5 min; 1× PBS 5 min; store at 4°C until use; the pre-hybridization process is complete.

[0059] 0.25M HCl solution: prepared from DEPC water, mainly composed of 68.491mL DEPC water and 1.509mL concentrated hydrochloric acid; 2×SSC: Prepared from 20×SSC (3 M NaCl, 0.3 M trisodium citrate, DEPC water, pH 7.0, autoclaved) and DEPC water. The working solution concentration after dilution is 2×SSC. Proteinase K (fresh) solution: 7 mL 1 M Tris (pH 8.0) + 7 mL 0.5 M EDTA (pH 8.0) + 56 mL DEPC water + 20 μL Proteinase K Stock (10 mg / mL Proteinase K), prepared and used immediately; 1× PBS: 1× PBS was obtained by diluting 10× PBS (1.3 M NaCl, 70 mM Na2HPO4, 30 mM NaH2PO4, pH 7.4) with DEPC water, and then sterilized by autoclave after DEPC treatment; 0.2% glycine: 7 mL 10×PBS + 63 mL DEPC water + 0.12 g glycine, prepared and used immediately; 4% formaldehyde: 7.56 mL of 37% formaldehyde and 7 mL of 10× PBS, then add DEPC water to the final volume of 70 mL. Acetylation reagent: Prepare 670 µL triethanolamine, 200 µL HCl, and 125 µL acetic anhydride in 50 mL DEPC water.

[0060] Step 4: Hybridization and incubation treatment: 1. First hybridization incubation treatment First, dry the hybridized sections obtained by pre-hybridization until the section color is pure white; Dilute the sense probe (SEQUENCE A linked to the T7 promoter) and antisense probe (SEQUENCE A linked to the SP6 promoter). Dilute 10 µg (for 10 hybridized sections) of each probe to 400 µL (for 10 hybridized sections) with 50% formamide, mix well, denature at 80°C for 2 minutes, immediately cool on ice for 2-3 minutes, remove from the tube, and centrifuge immediately. Then, add 800 µL of Hyb Solution and mix well using a pipette tip with the tip cut off to obtain the probe hybridization solution. Pipette 120 µL of the above probe hybridization solution (for each hybridized section) and slowly add it dropwise to the slide containing the hybridized section. Slowly cover with parafilm the same size as the slide. Place the slide in a humidified chamber and hybridize overnight in a 50°C oven in the dark.

[0061] The probe hybridization solution for each hybridization section is as follows: 1µg sense probe or antisense probe (1µg / (sense probe concentration / antisense probe concentration)), 50% formamide (40µL - 1µg sense probe or antisense probe concentration), and 80µL Hyb Solution, prepared with DEPC water. 50% formamide: refers to an aqueous solution with a volume content of 50% formamide; Hyb Solution: Prepared with DEPC water, 5 mL deionized formamide, 2 mL 50% dextran sulfate aqueous solution, 1 mL 10× blocking reagent, 0.6 mL 5 M NaCl, 100 µL 1 M Tris (pH 7.5), 20 µL 0.5 M EDTA (pH 8.0), 150 µL 10 mg / mL tRNA, and 1.13 mL DEPC water. Store at -20°C until used. 5M NaCl: Dissolve 29.22 g NaCl in 80 mL ultrapure water, dilute to 100 mL, treat with DEPC water, and autoclave for later use. 1M Tris (pH 7.5): Dissolve 12.11 g of Tris in 80 mL of DEPC water, add 6.5 mL of concentrated hydrochloric acid, make up to 100 mL, and adjust the pH to 7.5. 10× blocking reagent: 5 g of blocking reagent (Roche) was dissolved in 50 mL of Maleic buffer (heated in a 65°C water bath), treated with DEPC, and sterilized by autoclave. It was then stored at 4°C (opaque) until used. Maleic buffer: Dissolve 1.161 g DL-maleic acid and 0.8766 g NaCl in 80 mL of water. Add solid NaOH to adjust the pH to approximately 5.0. Slowly add 1 M NaOH to adjust the pH to approximately 7.5 and bring the volume to 100 mL.

[0062] 2. Sample treatment between the first hybridization incubation and the second hybridization incubation After the first hybridization incubation, the hybridized sections were placed in a 0.2×SSC solution preheated at 50°C to rinse off the parafilm membrane, and then placed in a 0.2×SSC solution at 50°C for 1 hour; a 0.2×SSC solution at 50°C for 1 hour; a NTE solution at 37°C for 5 minutes; a NTE solution at 37°C for 5 minutes; a NTE + RNase solution at 37°C for 30 minutes; a NTE solution at 37°C for 5 minutes; a NTE solution at 37°C for 5 minutes; a 0.2×SSC solution at 50°C for 1 hour; a 1×TBS solution at room temperature for 5 minutes; a fresh blocking solution at room temperature for 45 minutes; and a TBST-BSA solution at room temperature for 45 minutes.

[0063] NTE: Dissolve 14.61 g NaCl, 1 mL 0.5 M EDTA (pH 8.0), and 5 mL 1 M Tris (pH 8.0) in 400 mL sterile water. Mix thoroughly, dilute to 500 mL with sterile water, and sterilize by autoclaving.

[0064] NTE + RNase: Add 35uL RNase A solution to 70mL NTE.

[0065] RNase A solution: Concentration: 10 mg / mL, store at -20°C until use.

[0066] 1X TBS solution: Dilute 10X TBS (1M Tris pH 7.5, 1.5M NaCl, autoclaved) with sterile water to obtain the final working solution.

[0067] Blocking solution: 5 mL 10× blocking solution, 5 mL 10× TBS, then add 40 mL sterile water and prepare immediately.

[0068] The TBST-BSA solution (500 mL) is shown in Table 1.

[0069]

[0070] 3. Second hybridization incubation treatment Dilute the DIG-AP antibody solution with TBST-BSA solution at a ratio of TBST-BSA:DIG-AP = 2000:1. Add 120 μL of the dilution solution to each slide and cover with parafilm of equal size. Place in a humidified chamber at room temperature in the dark for 2 h.

[0071] Step 5: Post-hybridization processing At room temperature, use TBST-BSA solution to rinse off the parafilm membrane on the hybridization sample obtained after the second hybridization incubation treatment; treat with TBST-BSA solution for 15 minutes; treat with TBST-BSA solution for 15 minutes; treat with TBST-BSA solution for 15 minutes; treat with Buffer 3 solution for 5 minutes; treat with Buffer 3 solution for 5 minutes. Finally, in a light-proof environment, 120 μL / slice of NBT / BCIP color development solution is added to each slide for color development, covered with a parafilm membrane of equal size, and placed in a humidified box for color development at room temperature in the dark.

[0072] The root tips of Asian cotton lateral roots are rich in polysaccharides and polyphenols, which can easily affect in situ hybridization results. Therefore, to maximize the specificity of the target gene, the hybridization signal should be stopped immediately, observed, and photographed once the signal is generated and the color reaction begins. Therefore, for in situ hybridization of Asian cotton genes, the slides should be observed for color development starting 24 hours later, with observations every three hours, generally taking 24-48 hours for optimal color development.

[0073] Buffer 3 solution: Prepared with sterile water, it contains: 50 mL 1M Tris (pH 9.5), 10 mL 5M NaCl, 25 mL 1M MgCl2. Add sterile water to 500 mL and sterilize by autoclaving. Buffer 3 solution will produce flocculent precipitation after standing for a period of time. Shake well and use it after the precipitation disappears. NBT / BCIP colorimetric solution: Each slide contains: 2.5μL NBT / BCIP stock solution and 125μL Buffer 3.

[0074] Step 6: Microscopic examination: Rinse the colored slice sample with distilled water to remove the parafilm membrane, then blow dry in a fume hood. After the slice is blown dry, place it under a microscope for examination, observation and photography.

[0075] Step 7. Post-reaction processing and storage At room temperature, for the slice samples where hybridization signals were observed, they were sequentially treated with sterile distilled water for 2 minutes; sterile distilled water for 2 minutes; 30% ethanol for 2 minutes; 60% ethanol for 2 minutes; 80% ethanol for 2 minutes; 95% ethanol for 2 minutes; 100% ethanol for 2 minutes; 25% xylene + 75% ethanol for 2 minutes; 75% xylene + 25% ethanol for 2 minutes; 100% xylene for 5 minutes; 100% xylene for 5 minutes; then blow-dried in a fume hood, add 80 μL neutral gum (neutral resin: xylene volume ratio is 1:1) to each slide for sealing, and dry at 37°C. The experimental results can be preserved for a long time.

[0076] Microscopic examination results showed GaCYP88D6 The results of positioning the lateral root tips of Asian cotton are as follows Figure 9-10 As shown; Figure 9 for GaCYP88D6 Figure 1 shows the hybridization results of RNA in the root cap tissue of Asian cotton lateral roots and the sense probe (connected to a T7 promoter); Figure 10 for GaCYP88D6 Comparison chart of hybridization results between RNA and antisense probe (linked to SP6 promoter) in root cap tissue of lateral roots of Asian cotton. GaCYP88D6 It is located in the root cap tissue in the root tip of the Asian cotton lateral root, providing an important basis for the positioning of root tip marker genes in the cotton root tip single-cell transcriptome sequencing analysis results, and laying the foundation for the drawing of the cotton root tip single-cell transcriptome map and the single-cell transcriptome map of various tissue parts of cotton.

[0077] Comparative Example Since the root tips of 5-day-old Asian cotton are relatively tender, it is very difficult to prepare paraffin sections. In the early stage of the present invention, a large number of experiments were conducted to improve the paraffin section process. The comparative example is the initial stage of the experiment. The root tips of Asian cotton were collected, fixed, dehydrated, transparent, waxed, embedded and trimmed with wax using forceps. No ball filter was used. The paraffin sections obtained are as follows: Figure 11 shown.

[0078] The results showed that the use of forceps to move the root apical material would cause a lot of damage to the structural integrity of the tissue, and the paraffin sections obtained by the method used in the present invention (such as Figure 2 The structure is intact and can be used for in situ hybridization experiments on immature materials.

[0079] This invention describes an RNA in situ hybridization method for gene localization in the root apex of Asian cotton. It can be used to localize marker genes in specific tissues of the cotton root apex (such as the root cap, epidermis, stele, and endodermis), converting invisible signals into visible colors. Furthermore, this method easily overcomes the difficulties in identifying marker genes using currently popular single-cell transcriptome sequencing techniques. It also boasts high sensitivity and specificity, and the hybridization sections obtained can be preserved for extended periods, allowing for direct microscopic observation upon subsequent observation.

[0080] The above embodiments are merely preferred embodiments of the present invention and are not intended to limit the present invention in any other manner. Any person skilled in the art may utilize the above disclosed technical content to modify or modify the above embodiments into equivalent embodiments with equivalent variations. However, any simple modifications, equivalent variations, and modifications to the above embodiments that do not depart from the technical content of the present invention and are based on the technical essence of the present invention remain within the scope of protection of the present invention.

Claims

1. A method for preparing paraffin sections of cotton root tips, characterized in that: The steps include: S21. Cultivation of experimental materials: Using tissue culture method, select Asian cotton seeds with full grains and place them in MS medium for growth; S22. Collection and Fixation of Experimental Materials: 5-day-old, uniformly growing lateral root tips of Asian cotton were selected. 1-2 cm long root tip segments were taken on ice as experimental samples. The samples were placed in a spherical filter and then in pre-chilled fixative. Vacuum treatment was performed to allow the fixative to quickly enter the sample. S23. Dehydration of experimental materials: Dehydrate the experimental samples in 50% ethanol three times, each time for 30 minutes; 70% ethanol, overnight; 85% ethanol, time for 1 hour; 95% ethanol, time overnight; and anhydrous ethanol twice, each time for 1 hour. The entire process was carried out in a 4°C refrigerator, and the ethanol was diluted with DEPC water. S24. Transparent treatment of experimental materials: Perform the treatment at room temperature by sequentially passing the experimental samples through solutions with ethanol:xylene volume ratios of 3:1, 1:1, 1:3, 0:1, and 0:1 for 1 hour each. S25. Wax impregnation of experimental materials: Place the spherical filter containing the experimental sample in 50 mL of xylene and 1 / 4 volume of wax chips, and place in a 42°C oven overnight. Continue to add wax chips to the xylene solution until the xylene solution is gradually saturated. This process should be repeated for 2-3 days. Transfer the spherical filter containing the sample to dissolved pure liquid paraffin and immerse it in wax in a 60°C oven. Replace the liquid paraffin with fresh liquid paraffin every night for 3 consecutive days until the interior of the plant sample is completely filled with paraffin. S26. Embedding of experimental materials: Pour dissolved pure liquid paraffin into a preheated embedding mold, take out the experimental sample, place it in the embedding mold and position it according to the sectioning requirements. After the paraffin surface solidifies, quickly put it into cold water to allow the paraffin to solidify quickly; S27. Wax trimming of experimental materials: Remove the wax block from the embedding mold and trim the wax block sample into a horizontal or vertical section according to the needs of paraffin sectioning. The section of the microtome blade should be rectangular, otherwise it will be difficult to cut into wax strips; S28. Preparation of hybridization sections of experimental materials: Cut the wax block into wax strips with a thickness of 6-10 μm, add DEPC water on an RNase-free slide, use a blade to divide the wax strip into small pieces, spread them flat on the slide, and let the wax strip float on the DEPC water. Place the slide on a 37°C slide dryer for no more than 5 minutes to prevent RNA degradation. After the wax strip is flattened, absorb the excess water, and finally place the slide in a section box and store it at 4°C for later use.

2. Use of the paraffin sections of cotton root tips prepared by the preparation method according to claim 1 in research on gene localization in cotton root tips, wherein the sequence of the cotton root tip gene is shown in SEQ ID No.

1.

3. The use according to claim 2, characterized in that The RNA in situ hybridization method includes the following steps: S1. Preparation of target gene probes: Preparation of sense probes and antisense probes containing the target gene sequence as shown in SEQ ID No. 1; S2. Preparation of experimental samples: paraffin sections of cotton root tips were prepared; S3. Prehybridization: After dewaxing, rehydration with graded alcohol, HCl treatment, Proteinase K digestion, RNA re-fixation, acetylation, and dehydration, the sections were placed on a staining rack and sealed and stored at 4°C. S4, hybridization incubation treatment: The hybridized section sample obtained in step S3 is first hybridized and incubated with the sense probe and antisense probe obtained in step S1 in a 50°C incubator in the dark, and then hybridized and incubated for a second time at room temperature; S5, post-hybridization treatment: the sample obtained in step S4 is treated with TBS-BSA and Buffer 3 in sequence, and then treated with NBT / BCIP color development solution; S6. Microscopic examination: Rinse the parafilm off the colored slices with distilled water, then air dry them in a fume hood. After the slices are dry, place them under a microscope for observation and photography. S7. Post-reaction processing and storage: For slice samples where hybridization signals are observed, terminate the reaction with distilled water, treat with gradient ethanol and gradient xylene, and then blow dry in a fume hood. Add 80 μL of neutral gum with a volume ratio of 1:1 between neutral resin and xylene to each slide for sealing, and dry at 37°C. The experimental results can be preserved for a long time.

4. The use according to claim 3, characterized in that The prehybridization process in step S3 is as follows: the slice sample on the slide is sequentially subjected to 100% xylene for 10 minutes; 100% xylene for 10 minutes for dewaxing; 75% xylene + 25% ethanol for 2 minutes; 25% xylene + 75% ethanol for 2 minutes; 100% ethanol for 2 minutes; 95% ethanol for 2 minutes; 80% ethanol for 2 minutes; 60% ethanol for 2 minutes; 30% ethanol for 2 minutes; fresh DEPC water for dewaxing and gradient alcohol rehydration; 0.25M HCl for 20 minutes; DEPC water for 5 minutes; 2×SSC for 20 minutes; DEPC water for 5 minutes; fresh Proteinase K solution, 37°C, 30 minutes; 1×PBS for 2 minutes; fresh 0.2% Glycine for 2 minutes; 1×PBS for 2 minutes; 1×PBS for 2 minutes; 4% formaldehyde for 10 minutes; 1×PBS for 5 minutes; 1×PBS for 5 minutes; fresh acetylation reagent for 5 minutes; 1×PBS for 5 minutes; 1×PBS 5min; store at 4℃ for future use; the pre-hybridization process is complete.

5. The use according to claim 3, characterized in that In step S4, the first hybridization incubation process is as follows: First, air-dry the hybridization sections obtained in step 3 until the sections are pure white. Dilute the sense probe and antisense probe by diluting 1 μg of each to 40 μL with 50% formamide, mix well, denature at 80°C for 2 minutes, immediately cool on ice for 2-3 minutes, and centrifuge immediately. Then, add 80 μL of Hyb Solution to each hybridized section, mix thoroughly with a pipette tip, and slowly add 120 μL of the probe hybridization solution dropwise onto the glass slide containing the hybridized section. Slowly cover with a parafilm film of the same size. Place the glass slide in a humidified chamber and hybridize overnight in a 50°C oven in the dark. The probe hybridization solution for each hybridization section is as follows: 1 μg of sense probe or antisense probe, 40 μL of 50% formamide, and 80 μL of Hyb Solution, prepared with DEPC water.

6. The use according to claim 3, characterized in that In step S4, after the first hybridization incubation treatment, the sample is processed as follows before the second hybridization incubation treatment is performed on the slice sample: After the first hybridization incubation, the hybridized sections were placed in 0.2×SSC solution preheated at 50°C to rinse off the parafilm membrane, and then treated with 0.2×SSC solution at 50°C for 1 hour; Treat with 0.2×SSC solution at 50℃ for 1 hour; treat with NTE solution at 37℃ for 5 minutes; treat with NTE solution at 37℃ for 5 minutes; treat with NTE+RNase solution at 37℃ for 30 minutes; treat with NTE solution at 37℃ for 5 minutes; treat with NTE solution at 37℃ for 5 minutes; treat with 0.2×SSC solution at 50℃ for 1 hour; treat with 1×TBS solution for 5 minutes; Treat with fresh Blocking Solution for 45 minutes; Treat with TBST-BSA solution for 45 min.

7. The use according to claim 3, characterized in that In step S4, the second hybridization incubation process is as follows: dilute the second hybridization incubation antibody DIG-AP with TBST-BSA solution at TBST-BSA:DIG-AP=2000:1; add 120 μL / slide of the dilution solution to the slide and cover it with a parafilm film the same size as the slide; place it in a humidified box at room temperature in the dark for 2 hours.

8. The use according to claim 3, characterized in that In step S5, the post-hybridization treatment process is as follows: At room temperature, the parafilm membrane was rinsed with TBST-BSA solution and treated with TBST-BSA solution for 15 min; TBST-BSA solution treatment for 15 min; Buffer 3 solution treatment for 5 min; Treat with Buffer 3 solution for 5 minutes. Finally, add 120 μL / slide of NBT / BCIP color development solution to each slide in a dark environment for color development. Cover with a parafilm of the same size and place in a humidified box for color development at room temperature in the dark.

9. The use according to claim 3, characterized in that In step S7, the process of processing and storing after the reaction is terminated is as follows: At room temperature, for the slice samples where hybridization signals were observed, they were sequentially treated with sterile distilled water for 2 minutes; sterile distilled water for 2 minutes; 30% ethanol for 2 minutes; 60% ethanol for 2 minutes; 80% ethanol for 2 minutes; 95% ethanol for 2 minutes; 100% ethanol for 2 minutes; 25% xylene + 75% ethanol for 2 minutes; 75% xylene + 25% ethanol for 2 minutes; 100% xylene for 5 minutes; 100% xylene for 5 minutes; then 80 μL of neutral gum was added to each slide for sealing, and the slides were dried at 37°C. The experimental results can be preserved for a long time.

10. The preparation method according to claim 1, characterized in that The formula of the MS medium is MURASHIGE&SKOOG 4.33 g / L, glucose 15 g / L, and Phytagel 2.6 g / L. The pH of the medium is 6.1-6.

2. The culture conditions are a constant temperature of 28° C. and 16 h light / 8 h dark. The fixative is 50% FAA, including: 50 mL of anhydrous ethanol, 10 mL of 37% formaldehyde solution, 5 mL of glacial acetic acid, and 35 mL of DEPC water; the vacuum pressure range is 0.04-0.06 MPa, until all the sample materials sink into the fixative.

Images