Integrated electrochemical biosensor capable of detecting double miRNAs with high sensitivity

By preparing Au/TiO2-FTO electrodes and Y-shaped probes on the electrode surface and combining them with catalytic hairpin amplification reactions, an integrated electrochemical biosensor was constructed, which solved the problems of site uncontrollability and stability in dual-miRNA detection and achieved highly sensitive and accurate breast cancer diagnosis.

CN120651941AActive Publication Date: 2025-09-16WUHAN UNIV OF SCI & TECH

Patent Information

Application Number
CN202510776953.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-11
Publication Date
2025-09-16
Estimated Expiration
2045-06-11

AI Technical Summary

Technical Problem

Existing electrochemical biosensors have problems in dual-target miRNA detection, such as uncontrollable probe modification sites, large fluctuations in detection results, and low accuracy. In addition, the instability of nanomaterial modification affects the sensor signal output.

Method used

Au/TiO2-FTO electrode preparation, Y-shaped capture probe assembly, catalytic hairpin amplification and microdroplet chip electrochemical sensor integration were used. TiO2 nanorod arrays were grown by hydrothermal reaction, Au nanoparticles were reduced by UV, and Y-shaped probes and CHA reaction were combined to achieve highly sensitive detection of dual miRNAs.

Benefits of technology

High reliability, stability and sensitivity of dual miRNA detection were achieved, which improved the accuracy of breast cancer diagnosis and expanded the diagnostic applicability to other miRNA-related diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120651941A_ABST
    Figure CN120651941A_ABST
Patent Text Reader

Abstract

The invention provides an integrated electrochemical biosensor capable of detecting double miRNA with high sensitivity, and the integrated electrochemical biosensor can simultaneously detect double miRNA markers with high sensitivity through self-assembly of a Y-shaped capture probe, preparation of an Au / TiO2-FTO array electrode, catalytic hairpin amplification (CHA) and construction of a micro-droplet chip electrochemical biosensor. The advantages of equalization of double-target miRNA capture probe sites, excellent electrode performance, reliable signal amplification, low sample consumption and the like are integrated, the linear range of miRNA21 and miRNA155 detection is 10 fM to 100 nM, and the detection limits are 5.00 fM and 5.17 fM respectively. By detecting the miRNA21 and miRNA155 double markers, the accuracy of breast cancer diagnosis is up to 98%, and the recognition sequences at the two ends of the Y stent probe are modified, so that the sensor can be used for diagnosing other miRNA marker related diseases. The integrated micro-droplet chip electrochemical biosensor constructed by the invention has a remarkable clinical diagnosis value and a prominent practical application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the fields of materials, biosensors and medical detection, and in particular to an integrated electrochemical biosensor capable of highly sensitively detecting dual miRNAs. Background Art

[0002] MicroRNAs (miRNAs) are a class of endogenous, noncoding, short, single-stranded RNAs consisting of 21-23 nucleotides. They play a crucial role in regulating gene expression and have become important biomarkers for clinical diagnosis, disease treatment, and prognosis assessment. However, their short sequence length, high homology, susceptibility to degradation, low abundance, and complex composition of clinical biospecimens make accurate miRNA detection challenging. Currently, traditional detection methods such as quantitative polymerase chain reaction, Northern blotting, and DNA microarrays offer good reliability for miRNA detection and quantification. However, their high instrumentation, complex procedures, and requirement for specialized personnel limit their application in early disease diagnosis. Fortunately, electrochemical biosensors, with their high sensitivity, low cost, and ease of operation, offer new hope for the convenient and accurate detection of miRNAs in clinical biospecimens.

[0003] Currently, most reported electrochemical biosensors focus on detecting a single target miRNA. Although these sensors exhibit excellent specificity and sensitivity, single-miRNA detection inevitably results in a high number of false positives. Therefore, developing strategies for the simultaneous detection of dual-target miRNAs has become a new research hotspot. Reported detection strategies primarily employ sequential immobilization of different capture probes on an electrode surface, followed by signal amplification using hybridization chain reaction (HCR), catalytic hairpin assembly (CHA), and strand displacement amplification (SDA), to achieve simultaneous detection of dual miRNAs. However, while dual-capture probe modification approaches achieve some degree of simultaneous detection of dual miRNAs, the independent modification of the two capture probes on the electrode surface makes it difficult to control the number of modified probe sites during batch preparation, leading to high variability in detection results and low accuracy. Furthermore, modification of electrodes with high-surface-area and highly conductive nanomaterials (such as graphene, carbon nanotubes, and metal complexes) can significantly improve charge transfer efficiency at the electrode interface and the number of nucleic acid probe binding sites, thereby enhancing sensor signal output performance. However, the modification of nanomaterials on the electrode surface by drop coating not only reduces the stability of the electrode due to operational differences, but also ignores the role of microstructure in sensor signal amplification. Summary of the Invention

[0004] To address the shortcomings of existing technologies, the present invention aims to provide an integrated electrochemical biosensor capable of highly sensitive dual-miRNA detection, thus resolving the issues raised in the aforementioned background art. The present invention demonstrates high reliability, stability, and sensitivity in the simultaneous detection of dual-target miRNAs. Furthermore, dual-target miRNA detection demonstrates higher accuracy in breast cancer diagnosis compared to single marker miRNAs. Furthermore, by replacing the Y-shaped probe recognition sequence, the sensor can be extended to diagnose other miRNA-related diseases, highlighting its broad applicability and clinical diagnostic value.

[0005] To achieve the above objectives, the present invention is implemented through the following technical solutions: an integrated electrochemical biosensor for highly sensitive detection of dual miRNAs, comprising Au / TiO2-FTO electrode preparation, Y-shaped capture probe assembly, catalytic hairpin amplification, and microdroplet chip electrochemical sensor integration, and comprising the following steps:

[0006] Step 1: TiO2 nanorod arrays are vertically grown on the FTO surface through a hydrothermal reaction to provide abundant binding sites for probe fixation. Au nanoparticles are then modified on the TiO2 nanorods through UV reduction to reduce the charge transfer impedance at the electrode interface and fix the capture probes.

[0007] Step 2: The three DNA chains Y1, Y2, and Y3 are incubated and assembled to form a Y-shaped capture probe. One end of the probe, which is connected to the thiol group, is fixed to the Au / TiO2-FTO electrode through an Au-S covalent bond, and the other two ends are used for target miRNA detection;

[0008] Step 3: It involves two groups of CHAs, namely miRNA21, H1, H2 and miRNA155, H3, H4. When miRNA21 is present, it triggers the opening of the H1 hairpin. H2 then displaces miRNA21 to form a more stable H1-H2 double strand. miRNA21 enters the next round of CHA cycle. miRNA155 first opens the H3 strand and then forms the H3-H4 double strand.

[0009] Step 4: The Au / TiO2-FTO electrode was used as the microdroplet chip substrate and working electrode. Two layers of PDMS with a thickness of about 0.5 cm were bonded to the Au / TiO2-FTO electrode in sequence, with the reference electrode and the counter electrode placed between the two layers of PDMS. The CHA products triggered by miRNA21 and miRNA155 were added to the detection chamber, and the Y-shaped capture probe was incubated and hybridized with CHA21 and CHA155 for detection.

[0010] Furthermore, the preparation conditions of the TiO2 nanorod array in step 1 are as follows: a mixture of 15 mL of hydrochloric acid, 15 mL of pure water and 0.9 mL of tetrabutyl titanate, reacted at 150°C for 5 h.

[0011] Furthermore, the reaction process of reduction deposition of Au nanoparticles on TiO2 nanorods is as follows: the TiO2-FTO electrode is immersed in tetrachloroauric acid aqueous solution and irradiated with 254 nm ultraviolet light for 5 h.

[0012] Furthermore, in step 2, Y1, Y2, and Y3 were mixed in a ratio of 1:1:1 and incubated at 37°C for 1 h to complete the Y-shaped bracket assembly. The assembled Y-shaped bracket solution was then dropped onto the surface of the Au / TiO2-FTO electrode and incubated at 4°C for 12 h to fix the Y-shaped bracket probe on the Au / TiO2-FTO electrode.

[0013] Furthermore, after the Y-shaped bracket probe was fixed on the Au / TiO2-FTO electrode in step 2, the MCH solution was dropped on the electrode surface and incubated at 25°C for 1 h. Unless specific DNA was adsorbed, the electrode was repeatedly washed three times with 0.01 M PBS buffer to obtain a working electrode.

[0014] Furthermore, in step three, one end of the H2 and H4 DNA chains are connected to methylene blue and ferrocene electrical signal molecules, respectively, for indicating the concentration of the target miRNA.

[0015] Furthermore, in step 3, the four DNA chains H1, H2, H3, and H4 were first denatured at 95°C for 15 min, and then annealed at -20°C for 5 min to form hairpin structures, and then miRNA21 and miRNA155 were added and incubated at 37°C for 3 h to complete the CHA reaction.

[0016] Furthermore, the detection chamber in step 4 is composed of two layers of PDMS, and a cubic pool with a length of 1 cm, a width of 0.8 cm, and a height of 0.5 cm is made on the PDMS, and the total volume of the detection pool is 0.8 mL.

[0017] Furthermore, in step 4, the cells were incubated at 37° C. for 1 h, and after the Y-shaped capture probes hybridized with CHA21 and CHA155, the cells were washed three times with 0.01 M PBS buffer.

[0018] Furthermore, the DPV test was carried out in a three-electrode system in 0.01 M PBS buffer.

[0019] Beneficial effects of the present invention:

[0020] 1. This integrated electrochemical biosensor for highly sensitive dual-miRNA detection utilizes a Y-shaped capture probe design, ensuring the equality of the dual-target miRNA recognition probe sites. This avoids the increased false-positive events and reduced test accuracy that can occur due to the uncontrolled sites of the two probes being independently modified on the electrode surface.

[0021] 2. The present invention cleverly combines a three-dimensional Au / TiO2-FTO array electrode with a catalytic hairpin amplification reaction, significantly increasing the number of capture probe binding sites and effectively enhancing signal output, reducing the detection limits of miRNA21 and miRNA155 to 5.00 fM and 5.17 fM, respectively.

[0022] 3. The present invention uses an integrated micro-droplet chip electrochemical sensor to effectively solve the problems of low sample volume and large detection interference, achieving the goal of portable, fast and accurate sensor construction. In clinical breast cancer diagnosis, the accuracy rate is as high as 98%. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The preparation process of the three-dimensional Au / TiO2-FTO array electrode and the principle diagram of simultaneous detection of two miRNAs in the present invention;

[0024] Figure 2 This is a scanning electron microscope image of the Au / TiO2-FTO electrode of the present invention;

[0025] Figure 3 The electrochemical impedance spectroscopy (EIS) of the Au / TiO2-FTO electrode of the present invention is shown in FIG.

[0026] Figure 4 (A) Self-assembly of the Y-shaped scaffold; (B) Polyacrylamide gel electrophoresis images of the hybridization of the Y-shaped scaffold with the CHA products triggered by miRNA21 and miRNA155, respectively.

[0027] Figure 5 Cyclic voltammetry curves of the stepwise modification of nucleic acid chains on the Au / TiO2-FTO electrode (a: Au / TiO2-FTO electrode; b: Y-Au / TiO2-FTO electrode; c: CHA21-Y-Au / TiO2-FTO electrode; d: CHA155-Y-Au / TiO2-FTO electrode; e: CHA155-CHA21-Y-Au / TiO2-FTO electrode);

[0028] Figure 6 (A) DPV response curves of miRNA21 and miRNA155 at different concentrations (a → h: 10 fM, 100 fM, 1 pM, 10 pM, 100 pM, 1 nM, 10 nM and 100 nM); (B) linear relationship between DPV current value and the logarithm of target miRNA concentration;

[0029] Figure 7 is the stability diagram of Au / TiO2-FTO electrode;

[0030] Figure 8 This is a diagram of the reproducibility of the integrated micro-droplet chip electrochemical biosensor;

[0031] Figure 9 This is a specific diagram of the integrated microdroplet chip electrochemical biosensor;

[0032] Figure 10 Figure 2 shows the receiver operating curve (ROC) of (A) single miRNA21 or miRNA155 for breast cancer diagnosis; (B) combined miRNA21 and miRNA155 for breast cancer diagnosis. DETAILED DESCRIPTION

[0033] In order to make the technical means, creative features, objectives and effects achieved by the present invention easier to understand, the present invention is further described below in conjunction with specific implementation methods.

[0034] See also Figures 1 to 10 The present invention provides the following technical solution: an integrated electrochemical biosensor capable of highly sensitive detection of dual miRNAs. This example designs and assembles a Y-shaped probe with dual recognition domains, prepares an array electrode structure of gold nanoparticle-modified TiO2 nanorods (Au / TiO2-FTO), and integrates these to construct a portable, highly precise micro-droplet chip electrochemical biosensor. Furthermore, given that both miRNA21 and miRNA155 are highly expressed in breast cancer patients and are closely associated with breast cancer development, they can serve as biomarkers for early diagnosis of breast cancer.

[0035] The specific steps are as follows:

[0036] Step 1: Preparation of Au nanoparticle-modified TiO2 nanorod array electrode: TiO2 nanorod array is in situ grown on the FTO surface through hydrothermal reaction, and then Au nanoparticles are modified on the TiO2 nanorods through electrodeposition to construct a high-performance three-dimensional Au / TiO2-FTO array electrode.

[0037] Step 2: Y-shaped probe scaffold assembly, through the self-assembly of three DNA nucleic acid chains Y1, Y2 and Y3 to form a Y-shaped scaffold capture probe.

[0038] Step 3: Capture probe fixation: drop the Y-shaped capture probe on the surface of the Au / TiO2-FTO electrode for incubation and fixation.

[0039] Step 4: Block the electrode to block the nonspecific adsorption sites and obtain a working electrode.

[0040] Step 5: Catalyze the hairpin assembly amplification reaction. MiRNA21 and miRNA155 trigger two sets of catalytic hairpin amplification reactions to achieve signal amplification.

[0041] Step 6: Construction of an integrated electrochemical biosensor, using a three-dimensional Au / TiO2-FTO array electrode as the substrate, with two layers of PDMS placed on it in sequence, with the reference electrode and the counter electrode placed in the middle of the two layers of PDMS, and a detection pool of 1 cm in length × 0.8 cm in width × 1 cm in height was set up.

[0042] The preparation process for the three-dimensional Au / TiO2-FTO array electrode in step 1 above involves: First, ultrasonically clean the FTO by soaking it in ultrapure water, then ethanol, and finally ultrapure water for 3 minutes. Then, the FTO sheet, tilted 45° downward with the conductive side facing downward, was placed in a 50 mL polytetrafluoroethylene-lined container. 30 mL of the mixed reaction solution was added and the reaction was heated at 150°C for 5 hours to in situ grow the TiO2 nanorod array on the FTO surface. Finally, the sheet was irradiated under UV light for 5 hours to coat the TiO2 nanorods with Au nanoparticles.

[0043] The reaction solution for preparing TiO2 nanorod arrays in step 1 above is 15 mL ultrapure water + 15 mL concentrated hydrochloric acid + 0.9 mL tetrabutyl titanate, and the reaction solution for UV reduction of Au nanoparticles is 15 mL ultrapure water + 20 μL (2.5 mM) tetrachloroauric acid.

[0044] During the assembly of the Y-shaped probe scaffold in step 2 above, the sequences of Y1, Y2, and Y3 are shown in Table 1, wherein the concentrations are all 2 μmol / L, the incubation temperature is 37° C., and the incubation time is 60 min.

[0045] During the Y-shaped probe fixation process in step three, one end of the Y3 DNA nucleic acid chain is modified with a thiol group, so that the Y-shaped probe is connected to the surface of the Au nanoparticles through an Au-S covalent bond.

[0046] During the electrode blocking process in step 4 above, nonspecific adsorption sites are blocked by MCH, and the electrode is rinsed with PBS buffer to obtain a working electrode. The PBS solution consists of 0.01 M NaH2PO4, 0.01 M Na2HPO4, 0.01 M MgCl2, and 0.01 M KCl.

[0047] During the catalytic hairpin assembly amplification reaction in step 5 above, H1, H2, H3, and H4 (base sequences shown in Table 1) were denatured at 95°C for 15 minutes and annealed at -20°C for 5 minutes to form the hairpin structure. The concentrations of H1, H2, H3, and H4 were all 2 μmol / L. The resulting hairpin probes, H1, H2, H3, and H4, were then mixed in a 1:1:1:1 ratio and incubated at 37°C for 3 hours. MiRNA21 and miRNA155 were then added to trigger the two catalytic hairpin reactions, yielding CHA21 and CHA155 products.

[0048] Table 1 DNA probe sequences

[0049] name Base sequence (5' → 3') Y1 GAATGCCGCTTACAGTACGCCTAGGTTACTCTACACAT Y2 TCCGACTAAGCCAGTAAGCGGCATTCATCACATCTCTA Y3 ACCTAGGCGTACTTGGCTTAGTCGGAGGGAAGGAGAGC-SH H1 TCAACATCAGTCTGATAAGCTACCATGTGTAGATAGCTTATCAGACTGATCCAAGTCAGACCAC H2 TAAGCTATCTACACATGGTAGCTTATCAGACTGATCCATGTGTAGAGTA-Mb H3 CCCCTATCACGATTAGCATTAACCTAGAGATGTTTAATGCTAATCGTGATCCATAACTGTCCTG H4 GCATTAAACATCTCTAGGTTAATGCTAATCGTGATCCTAGAGATGTGAT-Fc

[0050] During the construction of the integrated electrochemical biosensor described above, the Au / TiO2-FTO substrate served as both the substrate and the working electrode for the microdroplet chip sensor. The reference electrode and counter electrode were Ag / AgCl and platinum wire, respectively. The dimensions of the single-layer PDMS cubic cell were 1 cm long, 0.8 cm wide, and 0.5 cm high.

[0051] This embodiment further provides a detailed description of the technical solution based on the above steps, as follows:

[0052] All chemical reagents used in this example were purchased from Sinopharm Group, and the target miRNA and probe DNA sequences involved were purchased from Shanghai Shenggong Biotechnology Co., Ltd. Ultrapure water was obtained from the Jinlan Water Purification System (Sichuan Jinlan Technology Co., Ltd.). All electrochemical tests in this invention were performed using a three-electrode system, with data collected using a CHI760E electrochemical workstation (Shanghai Chenhua Instrument Co., Ltd., Shanghai, China). The constructed Au / TiO2-FTO electrode served as the working electrode, the Ag / AgCl electrode served as the reference electrode, and the platinum wire served as the counter electrode.

[0053] Example 1 Preparation of Au / TiO2-FTO Electrode and Principle of Simultaneous Highly Sensitive Detection of Dual miRNAs

[0054] like Figure 1 The preparation process of the Au / TiO2-FTO electrode shown in the figure is to grow a TiO2 nanorod array on the conductive side of the FTO glass through a hydrothermal reaction, and then deposit Au nanoparticles on the TiO2 nanorods through UV reduction to prepare a three-dimensional Au / TiO2-FTO array electrode. It can be clearly observed under a scanning electron microscope ( Figure 2 ), TiO2 nanorods are vertically arranged on the FTO surface, and Au nanoparticles are evenly attached to the TiO2 nanorods, which provides abundant attachment sites for the Y-shaped probe and enables the Y-shaped probe to be firmly fixed to the electrode surface through Au-S covalent bonds. The interfacial charge transfer ability of the Au / TiO2-FTO electrode can be characterized by EIS measurement. EIS is tested in 10 mM and 0.1 M KCl aqueous solutions. The semicircle diameter of the obtained curve represents the interfacial charge transfer impedance (R ct ), the smaller the semicircle diameter is, the stronger the charge transfer capability is. Figure 3 As shown, the FTO bare electrode has the largest semicircle diameter, indicating that its R ctThe largest, followed by TiO2-FTO and Au / TiO2-FTO electrodes, indicates that the modification of TiO2 nanorods and Au nanoparticles can significantly improve the charge transfer capacity of the electrode interface. The signal amplification principle of this sensor is based on two sets of catalytic hairpin assembly amplification reactions to achieve high-sensitivity detection of miRNA21 and miRNA155. Figure 1 As shown, when the target miRNA21 is present, the H1 hairpin is opened, and H2 then competes to remove miRNA21 from H1, causing miRNA21 to enter the next CHA21 cycle. The H1-H2 duplex is captured by the Y-shaped probe, where the methylene blue (Mb) attached to one end of H2 serves as an electrical signal indicator reflecting the concentration of miRNA21. Similarly, when miRNA155 is present, it triggers the process of CHA155, and the electrical signal from ferrocene (Fc) attached to one end of H4 reflects the concentration of miRNA155. The significant difference in the redox potentials of Mb and Fc prevents the detection of miRNA21 and miRNA155 from interfering with each other. In summary, the integrated electrochemical biosensor constructed in this invention, by combining the abundant probe binding sites of the Au / TiO2-FTO array electrode with the excellent interfacial charge transfer capability and CHA signal amplification, shows outstanding application prospects and clinical application value in breast cancer diagnosis.

[0055] Example 2 Feasibility analysis of simultaneous detection of dual miRNAs using Au / TiO2-FTO array electrodes combined with Y-shaped bracket probes

[0056] The Y-shaped scaffold capture probe assembly is the key to ensure the simultaneous detection of dual miRNAs in the present invention, such as Figure 4 As shown in (A), channels 4, 5, and 6 are the electrophoretic bands of Y1+Y2, Y2+Y3, and Y1+Y3 assembled in pairs, respectively. Channel 7 is the electrophoretic band of the assembly of three DNA chains Y1+Y2+Y3. It can be seen that the positions of the bands in channels 4, 5, and 6 are similar, while the electrophoretic band in channel 7 moves the slowest, indicating that Y1+Y2+Y3 can self-assemble to form a Y-shaped scaffold probe. When the Y-shaped probe is incubated with the CHA products triggered by miRNA21 and miRNA155, respectively, as shown in Figure 4 As shown in (B), the electrophoretic bands in channels 4 and 5 showed similar positions, while when the Y-shaped probe was incubated with CHA21 and CHA155 simultaneously, a slower moving band appeared in channel 6, indicating that the Y-shaped probe can independently or simultaneously recognize cross-linked CHA21 and CHA155. Then, cyclic voltammetry was used to characterize the modification of the Y-shaped probe on the Au / TiO2-FTO electrode surface and the recognition and hybridization process of the Y-shaped probe with CHA21 and CHA155. Figure 5As shown, the bare Au / TiO2-FTO electrode has the highest redox peak current. When the Y-shaped probe is covalently fixed to the electrode surface via an Au-S bond, the peak current decreases. CHA21 and CHA155, when dropped onto the electrode surface and incubated separately, show similar current decreases, with the largest decrease in peak current occurring when both CHA21 and CHA155 are simultaneously bound to the Y-shaped probe. This is because the negative charge on the surface of the nucleic acid chain inhibits electron transfer at the electrode interface. This also demonstrates that simultaneous detection of dual miRNAs using the Au / TiO2-FTO array electrode and the Y-shaped scaffold probe is feasible.

[0057] Example 3 Standard Curve Drawing

[0058] The steps for drawing the standard curve are as follows:

[0059] (1) First, Y1, Y2, and Y3 were mixed in a 1:1:1 ratio and incubated at 37°C for 1 h to complete the Y-shaped scaffold assembly. Then, 20 μL of the assembled Y-shaped scaffold solution was dropped on the surface of the Au / TiO2-FTO electrode and incubated in Tris-HCl buffer at 4°C for 12 h to fix the Y-shaped scaffold probe on the electrode through the Au-S covalent bond. Then, 20 μL of MCH solution was dropped on the electrode surface and incubated at 25°C for 1 h to remove non-specific DNA adsorption. Finally, the electrode was repeatedly washed three times with 0.01 M PBS buffer to obtain a working electrode.

[0060] (2) The target miRNA triggers the catalytic hairpin amplification reaction. First, the H1, H2, H3, and H4 DNA chains are kept at 95°C for 15 minutes and then annealed at -20°C for 5 minutes to form hairpin structures. Then, the formed H1, H2, H3, and H4 hairpin probes are mixed in a 1:1:1:1 ratio and incubated at 37°C for 3 hours. MiRNA21 and miRNA155 are added to trigger two sets of catalytic hairpin reactions to obtain CHA21 and CHA155 products. Finally, the obtained CHA21 and CHA155 products are dropped onto the working electrode described in step (1) and incubated at 37°C for 1 hour to allow the Y-shaped capture probe to recognize and hybridize with CHA21 and CHA155. The mixture is then washed repeatedly with 0.01 M PBS buffer three times to collect DPV electrical signals.

[0061] (3) According to the different DPV current responses of target miRNA at different concentrations, a standard curve is drawn with the logarithm of the concentration as the horizontal axis and the DPV current value as the vertical axis. Figure 6As shown in the data, the DPV peak current intensity increases with the increase of the target miRNA concentration (a→ h: 10 fM, 100 fM, 1 pM, 10 pM, 100 pM, 1 nM, 10 nM and 100 nM), and the peak current intensity has a good linear relationship with the logarithm of the target miRNA concentration. The detection limits for miRNA21 and miRNA155 are as low as 5.00 fM and 5.17 fM, respectively.

[0062] Example 4 Evaluation of reliability and specificity of integrated electrochemical sensors

[0063] (1) Stability test

[0064] The Au / TiO2-FTO working electrode was prepared according to Example 1 and Example 3, and the prepared Au / TiO2-FTO working electrode was stored at 4°C, and 1 nM miRNA21 and miRNA155 were detected every 4 h. Figure 7 As shown in the figure, during the 40-h test, the DPV current response values ​​of miRNA21 and miRNA155 did not fluctuate significantly, and the standard deviations (RSDs) of miRNA21 and miRNA155 were 2.8% and 3.4%, respectively, indicating that the sensor has good stability.

[0065] (2) Repeatability experiment

[0066] According to Example 1 and Example 3, the Au / TiO2-FTO working electrode was prepared and stored at 4°C. The electrodes were divided into 6 batches, with 3 parallel samples in each batch, to detect 1 nM miRNA21 and miRNA155. Figure 8 As shown in the data, in the six batches of detection, the DPV current response values ​​of miRNA21 and miRNA155 did not fluctuate significantly, and the standard deviations (RSDs) of miRNA21 and miRNA155 were 3.9% and 2.6%, respectively, indicating that the sensor has good repeatability.

[0067] (3) Specificity experiments

[0068] Since actual biological samples often contain multiple miRNAs and miRNAs are highly homologous, specific detection is one of the key performances of biosensors. The present invention detects target miRNA21 and miRNA155, and other 5 different oligonucleotides (miRNA sequences are shown in Table 2) according to Example 3. Figure 9As shown, the DPV current response is significant when the target miRNA is present, while the DPV electrical signals of other oligonucleotides are almost consistent with the blank group, indicating that the electrochemical sensor constructed by the present invention has good specificity for the target miRNA.

[0069] Table 2 miRNA base sequences

[0070] name Base sequence (5' → 3') miRNA-21 TAGCTTATCAGACTGATGTTGA miRNA-155 TTAATGCTAATCGTGATAGGGGT miRNA-122 TGGAGTGTGACAATGGTGTTTG miRNA-141 TAACACTGTCTGGTAAAGATGG miRNA-214 ACAGCAGGCGCAGACAGGCAGT miRNA-let7a TGAGGTAGTAGGTTGTATAGTT miRNA-210 CTGTGCGTGTGACAGCGGCTGA

[0071] Example 5: Verification of the accuracy of the integrated electrochemical biosensor for clinical breast cancer diagnosis

[0072] In this example, a total of 40 clinical blood samples were collected, including 30 breast cancer patients and 10 healthy individuals. 2 mL of venous blood was collected from each sample and centrifuged at 3000 rpm for 15 min. 20 μL of the upper serum was taken and added to the CHA reaction system for signal amplification. Then, 20 μl of CHA product was aspirated and incubated with the Y-branch probe in the detection pool to collect DPV signals. By comparing with the results of nuclear magnetic resonance and tissue sections, the accuracy of miRNA21 or miRNA155 in breast cancer diagnosis was 96% and 93%, respectively. When the two target miRNAs were used for breast cancer diagnosis at the same time, the accuracy could be as high as 98%, indicating that the integrated micro-droplet chip electrochemical sensor constructed by the present invention has good clinical application prospects.

[0073] The basic principles, main features and advantages of the present invention are shown and described above. For those skilled in the art, it is obvious that the present invention is not limited to the details of the above exemplary embodiments, and the present invention can be implemented in other specific forms without departing from the spirit or basic features of the present invention.

[0074] In addition, it should be understood that although this specification is described in terms of implementation methods, not every implementation method contains only one independent technical solution. This narrative method of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment can also be appropriately combined to form other implementation methods that can be understood by those skilled in the art.

Claims

1. An integrated electrochemical biosensor capable of highly sensitive detection of dual miRNAs, characterized in that: The Au / TiO2-FTO electrode preparation, Y-shaped capture probe assembly, catalytic hairpin amplification, and microdroplet chip electrochemical sensor integration include the following steps: Step 1: TiO2 nanorod arrays are vertically grown on the FTO surface through a hydrothermal reaction to provide abundant binding sites for probe fixation. Au nanoparticles are then modified on the TiO2 nanorods through UV reduction to reduce the charge transfer impedance at the electrode interface and fix the capture probes. Step 2: The three DNA chains Y1, Y2, and Y3 are incubated and assembled to form a Y-shaped capture probe. One end of the probe, which is connected to the thiol group, is fixed to the Au / TiO2-FTO electrode through an Au-S covalent bond, and the other two ends are used for target miRNA detection; Step 3: It involves two groups of CHAs, namely miRNA21, H1, H2 and miRNA155, H3, H4. When miRNA21 is present, it triggers the opening of the H1 hairpin. H2 then displaces miRNA21 to form a more stable H1-H2 double strand. miRNA21 enters the next round of CHA cycle. miRNA155 first opens the H3 strand and then forms the H3-H4 double strand. Step 4: The Au / TiO2-FTO electrode was used as the microdroplet chip substrate and working electrode. Two layers of PDMS with a thickness of about 0.5 cm were bonded to the Au / TiO2-FTO electrode in sequence, with the reference electrode and the counter electrode placed between the two layers of PDMS. The CHA products triggered by miRNA21 and miRNA155 were added to the detection chamber, and the Y-shaped capture probe was incubated and hybridized with CHA21 and CHA155 for detection.

2. The integrated electrochemical biosensor capable of highly sensitive detection of dual miRNAs according to claim 1, characterized in that: The preparation conditions of the TiO2 nanorod array in step 1 are as follows: a mixture of 15 mL of hydrochloric acid, 15 mL of pure water, and 0.9 mL of tetrabutyl titanate, reacted at 150°C for 5 h.

3. The integrated electrochemical biosensor capable of highly sensitive dual-miRNA detection according to claim 1, characterized in that: The reaction process of Au nanoparticles reduction deposition on TiO2 nanorods is as follows: the TiO2-FTO electrode is immersed in tetrachloroauric acid aqueous solution and irradiated with 254 nm ultraviolet light for 5 h.

4. The integrated electrochemical biosensor capable of highly sensitive dual-miRNA detection according to claim 1, characterized in that: In step 2, Y1, Y2, and Y3 were mixed in a ratio of 1:1:1 and incubated at 37°C for 1 h to complete the Y-shaped bracket assembly. The assembled Y-shaped bracket solution was then dropped onto the surface of the Au / TiO2-FTO electrode and incubated at 4°C for 12 h to fix the Y-shaped bracket probe on the Au / TiO2-FTO electrode.

5. The integrated electrochemical biosensor capable of highly sensitive detection of dual miRNAs according to claim 4, characterized in that: After the Y-shaped bracket probe was fixed on the Au / TiO2-FTO electrode in step 2, the MCH solution was dropped on the electrode surface and incubated at 25°C for 1 h. Unless specific DNA was adsorbed, the electrode was repeatedly washed three times with 0.01 M PBS buffer to obtain a working electrode.

6. The integrated electrochemical biosensor capable of highly sensitive dual-miRNA detection according to claim 1, characterized in that: In step 3, one end of the H2 and H4 DNA chains are connected to methylene blue and ferrocene electrical signal molecules, respectively, to indicate the concentration of the target miRNA.

7. The integrated electrochemical biosensor capable of highly sensitive detection of dual miRNAs according to claim 6, characterized in that: In step 3, the four DNA chains H1, H2, H3, and H4 were first denatured at 95°C for 15 min, and then annealed at -20°C for 5 min to form hairpin structures, and then miRNA21 and miRNA155 were added and incubated at 37°C for 3 h to complete the CHA reaction.

8. The integrated electrochemical biosensor capable of highly sensitive dual-miRNA detection according to claim 1, characterized in that: In step 4, the detection chamber is composed of two layers of PDMS, and a cubic pool with a length of 1 cm, a width of 0.8 cm, and a height of 0.5 cm is made on the PDMS. The total volume of the detection pool is 0.8 mL.

9. The integrated electrochemical biosensor capable of highly sensitive detection of dual miRNAs according to claim 1, characterized in that: In step 4, the cells were incubated at 37° C. for 1 h, and after the Y-shaped capture probes hybridized with CHA21 and CHA155, the cells were washed three times with 0.01 M PBS buffer.

10. The integrated electrochemical biosensor capable of highly sensitive detection of dual miRNAs according to claim 9, characterized in that: The DPV test was carried out in a three-electrode system in 0.01 M PBS buffer.

Citation Information

Patent Citations

  • Super-sensitive electrochemical biosensor and preparation method and application thereof

    CN110823979A

  • Low-voltage driven ratio type bipolar electrode electrochemical luminescence biosensor and application thereof

    CN116794129A

  • Method for detecting tumor marker miRNA155 by adsorbing polyA-ssDNA through gold nanoparticles

    CN117517425A

  • Method of electrically detecting a biological analyte molecule

    US20100194409A1

Cited By

  • Biosensor for detecting serum miRNA-21 of cervical cancer patient

    CN121830839A

  • A biosensor for detecting serum miRNA-21 of cervical cancer patient

    CN121830839B

  • Isothermal amplification method and kit for detecting EGFR-L858R and EGFR-T790M point mutation

    CN121874349A

  • Breast cancer metastasis dual recognition biosensor and construction method and application thereof

    CN122382203A