High-efficiency large-scale production method for all-male larimichthys crocea fries

Abstract

The invention provides an efficient large-scale production method for all-male larimichthys crocea fries, and relates to the technical field of aquatic breeding, and the method comprises the following steps: inducing genetic male larimichthys crocea to generate sex reversal through gradient feeding of estradiol feed, and screening to obtain pseudo female larimichthys crocea with genotype XY and gonad histological characteristics conforming to female development. The method comprises the following steps: carrying out reproduction pairing on pseudo female pseudosciaena crocea and normal male pseudosciaena crocea to breed YY super-male parents, and finally, carrying out mating on the super-male parents and female parents to realize large-scale production of all-male pseudosciaena crocea. According to the method, the generation of the pseudo female fish is induced through gradient feeding of low-dose estradiol, so that the survival rate of individuals is improved while the induction success rate is ensured; screening out pseudo female fishes and super male fishes by combining a gender specific molecular marker with a PIT marking technology; the one-step large-scale production of all-male fries is realized through the mixed mating of the super-male fish and the common female fish, and the bred fries have the advantages of fast growth, stable character and the like.

Description

Technical Field

[0001] The invention relates to the technical field of aquatic breeding, and in particular to a high-efficiency large-scale seed production method of all-male large yellow croaker fry. Background Art

[0002] As one of my country's four major marine products, large yellow croaker enjoys the reputation of "national marine fish." Since breakthroughs in seedling and fry breeding technology, its aquaculture production has continued to climb. In 2022, the number of seedlings raised reached 2.58 billion, and the aquaculture output reached 258,000 tons, ranking first among my country's marine aquaculture fish for many consecutive years. Large yellow croaker exhibits significant sexual dimorphism. While females grow faster than males, males achieve a more slender body shape after sexual maturity, better meeting market demand and thus possessing higher economic value.

[0003] Invention Publication No. CN 118985489A discloses a method for large-scale breeding of all-male salmon and trout, which uses exogenous estradiol treatment to reverse the sex of genetically male individuals to physiologically female, thereby obtaining all-male offspring. Studies have shown that estradiol can induce sex reversal in genetically male fish, causing their phenotype to exhibit female characteristics. However, the induction effect is significantly affected by species-specific biological characteristics, and the induction parameters need to be optimized according to the reproductive development patterns of the target fish. In addition, the use of estradiol has dose-dependent side effects: excessively high doses can lead to growth inhibition, decreased survival rate, delayed or even stagnant gonadal development; while excessively low doses may not achieve effective induction. Currently, there are no reports of effective large-scale production of all-male seedlings in research on sex control of large yellow croaker. Summary of the Invention

[0004] In order to solve the technical problem of large-scale production of all-male large yellow croaker seedlings, the present invention provides a high-efficiency large-scale production method for all-male large yellow croaker seedlings. Low-dose estradiol gradient feeding is used to induce pseudo-female fish, ensuring the induction success rate while also improving the individual survival rate; sex-specific molecular markers are combined with PIT marker technology to screen out pseudo-female fish and super-male fish; combined with multiple parent screening and mating of super-male fish with female fish, all-male seedlings are produced in a one-step, large-scale manner. The present invention combines the advantages of sex control, group selection, and molecular breeding. The resulting seedlings grow fast, have stable traits, are easy to operate, and are suitable for large-scale application, with strong market competitiveness.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] A high-efficiency large-scale seed production method for all-male large yellow croaker fry comprises the following steps: (1) Feeding male large yellow croaker with a gradient of estradiol-containing feed to induce sex reversal in male large yellow croaker and identifying and screening pseudo-female large yellow croaker with an XY genotype and female gonadal morphology; (2) Injecting oxytocin into pseudo-female large yellow croaker and normal male fish to induce fertilization and egg laying, and the hatched fry were screened twice, and super male large yellow croaker with genotype YY was identified and screened; (3) Oxytocin is injected into normal female fish and sexually mature super male yellow croaker to induce spawning and fertilization, and the fertilized eggs are collected for hatching and cultivation to obtain large-scale all-male yellow croaker seedlings.

[0007] Preferably, the gradient feeding starts from the male large yellow croaker at 45 to 52 days of age and is fed for a total of 73 to 80 days.

[0008] More preferably, the gradient feeding method is: when male large yellow croaker is 45-65 days old, feed the compound feed with an estradiol content of 0.7-0.9 mg / kg; when it is 66-80 days old, feed the compound feed with an estradiol content of 0.9-1.1 mg / kg; when it is 81-125 days old, the feeding dose is 1.3-1.7 mg / kg, and after 125 days of age, switch to normal feed feeding.

[0009] More preferably, when the male large yellow croaker fed by the gradient feeding method is 150 days old, the morphological characteristics and oocytes of the normal female ovary can be observed through histological sections.

[0010] Preferably, the identification and screening of the pseudo-female fish or super-male large yellow croaker utilizes PIT live electronic marking technology, injecting a wireless frequency tag into the body of the marked fish to achieve single individual identification; the screening utilizes sex-specific molecular markers to perform PCR amplification and gel electrophoresis analysis on fin ray DNA, combined with gonad tissue sections to observe gonad morphology, and screen pseudo-female fish or super-male large yellow croaker.

[0011] More preferably, the subjects of the PIT live electronic marking are 12-month-old large yellow croaker individuals.

[0012] Preferably, the oxytocin is LHRH-A3, and the injection dose is 1.5-2 μg / kg fish body weight.

[0013] Preferably, in step (2), the ratio of the number of sexually mature pseudo-female fish to normal male fish is 2 to 2.5:1.

[0014] Preferably, the selection and screening operation in step (2) is carried out when the fry are 6 months old and 12 months old, respectively.

[0015] More preferably, the selection criteria for the selection and screening operation in step (2) are greater than average weight, good body color, and no deformity, and the selection rate is 5-15%.

[0016] Compared with the prior art, the present invention has the following beneficial effects: (1) Using low-dose estradiol gradient feeding technology to induce pseudo-female fish, while improving individual survival rate and ensuring normal gonadal development; (2) Based on sex-specific molecular markers and PIT marker technology, pseudo-female and super-male fish can be accurately screened, with a screening accuracy rate of 100%, significantly improving seed production efficiency and reducing labor costs; (3) Through the targeted screening of parental traits and the super-male-female mating strategy, large-scale production of all-male seedlings was achieved in one step, and the growth performance and phenotypic stability of the seedlings were significantly optimized. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is an electrophoresis detection diagram after PCR amplification of pseudo-female fish mothers, normal male fish fathers and offspring using primers designed for sex-specific molecular markers in the present invention.

[0018] Figure 2 Gonadal tissue sections of offspring produced by mating pseudo-female dams with normal sires at 4 months of age.

[0019] The offspring include females (XX), males (XY) and super males (YY). The scale bar in the figure is 20 μm. DETAILED DESCRIPTION

[0020] The present invention will be further described below with reference to the embodiments and accompanying drawings.

[0021] In an embodiment of the present invention, a method for preparing a compound feed containing estradiol is as follows: a predetermined amount of estradiol is weighed and dissolved in 95% ethanol to prepare an estradiol solution with a stock solution concentration of 1 mg / mL, which is then stored in a refrigerator at 4°C protected from light. The stock solution is diluted to an appropriate concentration, the corresponding compound feed is weighed and mixed, and then air-dried at room temperature.

[0022] Example 1

[0023] This embodiment provides a method for large-scale seed production of highly efficient all-male large yellow croaker fry, comprising the following steps: (1) Feeding male large yellow croaker with a gradient of estradiol-containing feed to induce sex reversal in male large yellow croaker and identifying and screening pseudo-female large yellow croaker with an XY genotype and female gonadal morphology; (2) Injecting oxytocin into pseudo-female large yellow croaker and normal male fish to induce fertilization and egg laying, and the hatched fry were screened twice, and super male large yellow croaker with genotype YY was identified and screened; (3) Oxytocin is injected into normal female fish and sexually mature super male yellow croaker to induce spawning and fertilization, and the fertilized eggs are collected for hatching and cultivation to obtain large-scale all-male yellow croaker seedlings.

[0024] In some preferred embodiments, the gradient feeding begins when male large yellow croaker are 45 to 52 days old and is fed for a total of 73 to 80 days. This has the technical effect of initiating induction during the critical window of gonadal differentiation in large yellow croaker, ensuring maximum sex reversal efficiency while avoiding growth inhibition caused by premature feeding or delayed gonadal development caused by late feeding.

[0025] In some more preferred implementation cases, the gradient feeding method is: when male large yellow croaker is 45-65 days old, it is fed with a compound feed with an estradiol content of 0.7-0.9 mg / kg; when it is 66-80 days old, it is fed with a compound feed with an estradiol content of 0.9-1.1 mg / kg; when it is 81-125 days old, the feeding dose is 1.3-1.7 mg / kg, and after 125 days of age, it is switched to normal feed feeding. Its technical effect is that by establishing a time-series progressive enhancement pattern of estradiol, the dynamic adaptation of the physiological metabolism and gonad development of large yellow croaker is achieved. Feeding low doses of estradiol in the early stage reduces the metabolic burden of large yellow croaker, gradually increasing the feeding dose in the middle stage to enhance gonad feminization, and high doses of estradiol in the late stage ensure that sex reversal is completed, ensuring the survival rate of pseudo-female fish while ensuring that the gonads of pseudo-female fish are fully developed and have normal spawning function.

[0026] In some more preferred embodiments, when male large yellow croaker fed by the gradient feeding method is 150 days old, the morphological characteristics and oocytes of normal female ovaries can be observed through histological sections.

[0027] In some preferred implementations, the identification and screening of pseudo-female or super-male large yellow croaker utilizes PIT live electronic tagging technology, which injects radio frequency tags into the tagged fish to identify individual individuals. The screening process utilizes sex-specific molecular markers to amplify fin ray DNA through PCR and gel electrophoresis analysis, combined with gonadal tissue sections to observe gonadal morphology, to screen for pseudo-female or super-male large yellow croaker. This technical advantage lies in the combination of molecular markers and morphology, achieving dual verification of genotype and phenotype, ensuring 100% screening accuracy and avoiding breeding bias caused by false screening. Furthermore, live tagging technology supports tracking of individuals throughout their lifecycle, providing a data foundation for large-scale seed production.

[0028] In some preferred implementations, the PIT live electronic tagging is performed on 12-month-old large yellow croaker. The technical benefit lies in tagging at sexual maturity, which not only reduces the stress-induced damage of tagging juvenile fish but also accurately correlates gonadal development with individual identity information, enhancing the biological significance of the tagging data.

[0029] In some preferred embodiments, the oxytocin is LHRH-A3, and the injection dose is 1.5-2 μg / kg fish body weight. This dosage range effectively stimulates synchronized ovulation and spermatogenesis in broodstock, improving fertilized egg quality and hatchability while avoiding metabolic burden or gonadal overmaturity caused by hormone overdose.

[0030] In some preferred implementation cases, the ratio of sexually mature pseudo-female fish to normal male fish in step (2) is 2 to 2.5:1. The technical effect is that by optimizing the sex ratio and balancing the ratio of sperm to eggs, the fertilization efficiency is significantly improved and the waste of resources caused by sperm competition is reduced.

[0031] In some preferred implementation cases, the selection and screening operation in step (2) is performed when the fry are 6 months old and 12 months old, respectively. The technical effect is that the staged screening can dynamically evaluate the growth performance and stress resistance of the fry, eliminate developmentally delayed individuals at an early stage, and lock in high-quality parent candidates at a later stage, thereby improving the consistency of the population.

[0032] In some more preferred implementation cases, the selection criteria for the selection and screening operation in step (2) are greater than average weight, good body color, and no deformities, with a selection rate of 5-15%. The technical effect is that through phenotypic directed selection, superior individuals with fast growth and strong disease resistance are selected, maintaining the genetic diversity of the population, while controlling the selection rate to avoid inbreeding depression and ensure the robustness of the seedling population.

[0033] Example 2

[0034] This embodiment provides a high-efficiency large-scale seed production method for all-male large yellow croaker fry, comprising the following steps: 1. Induction and cultivation of pseudo-female fish.

[0035] Starting from May 2021, about 150,000 common large yellow croaker seedlings with strong vitality and voracious feeding were selected and placed in a 10-ton cement pool. They were fed with compound feed containing estradiol from 45 days after hatching to induce sex reversal in genetically male large yellow croaker. The estradiol feeding period was 80 days.

[0036] Estradiol was fed in a gradient-increasing manner: 0.8 mg / kg from 45 to 65 days of age; 1 mg / kg from 66 to 80 days of age; and 1.5 mg / kg from 81 to 125 days of age. Fish were then switched to a normal diet after 125 days of age. Water was changed at least 100% daily, and the fish were fed 4-5 times. Mortality was monitored daily and recorded.

[0037] Subsequently, at 150 days of age and 12 months of age, the gonads of the large yellow croaker were taken to prepare histological sections to observe the gonadal development, and the corresponding fin rays were taken to extract DNA to identify the genetic genotype. Individuals with a male genotype (XY) identified by DNA, if their histological sections were observed to be female, were identified as pseudo-females. The gonads of pseudo-females showed the morphological characteristics of normal female ovaries, and oocytes could be observed at 150 days of age. Figure 2 During the estradiol treatment period, the survival rate of large yellow croaker was 95%, and the success rate of pseudo-female induction was 100%.

[0038] 2. Molecular identification and screening of pseudo-female fish.

[0039] Large yellow croaker fry induced with estradiol were reared and selected twice, at 6 and 12 months of age. The selection criteria were above average weight, good coloration, and the absence of deformities, with a retention rate of 10%. At 6 months of age, approximately 10,000 large yellow croaker fry were selected based on the selection criteria. At 12 months of age, another 1,000 fry were selected based on the selection criteria.

[0040] The selected large yellow croakers were treated with PIT live electronic tagging technology, and radio frequency tags were injected into the bodies of the tagged fish to achieve single individual identification. At the same time, the fin rays of each fish were preserved in anhydrous ethanol and stored at -20°C, and matched one by one with the serial numbers of the radio frequency tags. The genomic DNA in the fin rays was then extracted using the phenol-chloroform extraction method. Existing large yellow croaker sex-specific primers were used for PCR amplification and gel electrophoresis, and the sex of the males and females was identified by the difference in the amplified DNA bands. The fin ray DNA amplification of the genetically female (XX) large yellow croaker showed only one band at 200bp, while the fin ray DNA amplification of the genetically male (XY) large yellow croaker showed two bands at 250bp and 200bp. Based on this, pseudo-female large yellow croakers were screened out. The amplification electrophoresis detection diagram is shown in the figure below. Figure 1 shown.

[0041] The primer information of DNA specific molecular marker is as follows: LYC-XF:TCCCTGGTTAACTCTGATGTCCACG, LYC-XR:AGTGCCCTCTGGACAGAAACA, LYC-YF:ACTGTTTCAGAAAGTAACCGCAG, LYC-YR:CTGGGTGGCCTCACACTCAGTGTT.

[0042] The PCR reaction system was as follows: 10 μL of 2× PCR Taq mix, 0.5 μL each of F and R primers, 1 μL of 50 ng / μL DNA, and 8 μL of double-distilled water. The amplification program was as follows: pre-denaturation at 94°C for 5 minutes; 35 cycles of denaturation at 94°C for 30 seconds, annealing at 61°C for 30 seconds, and extension at 72°C for 30 seconds; and extension at 72°C for 10 minutes.

[0043] 3. Spawning and hatching of pseudo-female large yellow croaker and cultivation of super-male fry.

[0044] A total of 485 pseudo-female large yellow croaker were screened out through sex molecular markers, from which 45 sexually mature two-year-old pseudo-female fish were selected, and 20 normal male fish were also selected. They were placed together in a cement pool, and nutritional regulation, light and temperature regulation, etc. were performed on the pseudo-female fish and normal female fish.

[0045] Nutritional regulation refers to using fresh ice-cold green fish and sandworms as bait, adding 3-5% of vitamin C and 1-2% of vitamin E to the bait weight, and feeding twice a day; light and temperature regulation uses a 65W incandescent lamp to control the surface light of the brooding pond, the light intensity is 60-650lux, the lighting time is transitioned from 12 hours to 16 hours of long light, and the water temperature is 18-22℃.

[0046] Both male and female broodstock were injected with the oxytocin hormone LHRH-A3 to induce spawning and fertilization. A total of 1,150 mL of fertilized eggs were collected and cultured, resulting in approximately 320,000 fry and 120,000 juveniles measuring 5 cm in length. The water temperature for fry, juveniles, and juveniles was 23-26°C, with a salinity of 28-32‰ and a pH of 8.0-8.2. Water changes and aeration levels were gradually increased as the fry grew. The fry were fed a diet consisting of rotifers, freshly chilled copepods, Artemia nauplii, and formulated feed.

[0047] 4. Molecular identification and screening of super male yellow croaker.

[0048] At 6 and 12 months of age, the offspring of pseudo-female large yellow croaker were screened twice. Selection criteria included being above average weight, good coloration, and free of deformities, with a retention rate of 10% each time. After these two selections, approximately 1,000 individuals were retained for breeding. At 15 months of age, each individual was individually marked with PIT electronic markers, and fin rays were clipped for DNA sexing. Genetically female (XX) large yellow croaker showed only a single band at 200 bp, while genetically male (XY) large yellow croaker showed two bands at 250 bp and 200 bp, and super male (YY) large yellow croaker showed a single band at 250 bp. Super male large yellow croaker was identified based on this molecular marker screening. A total of 220 super male large yellow croaker were identified.

[0049] 5. Large-scale breeding of all-male yellow croaker.

[0050] The super male fish screened and identified were cultivated, and 20 sexually mature female fish over 2 years old and 20 super male fish were selected and placed in a cement pool. Nutritional regulation, light and temperature regulation, etc. were carried out on the super male fish and ordinary female fish.

[0051] Broodstock were injected with the oxytocin hormone LHRH-A3 to induce spawning and fertilization, and the fertilized eggs were collected for culture. The water temperature for larvae, juveniles, and young fish was 23-25°C, with a salinity of 28-32‰ and a pH of 8.0-8.2. Water changes and aeration levels were gradually increased as the fry grew. Rotifers, Artemia nauplii, and compound feed were used for fry culture. A total of 150,000 all-male large yellow croaker (Pseudosciaena crocea) with a total length of 5 cm were cultured. When the fry reached four months of age, 30 samples were collected and dissected for gonadal removal. Tissue sections confirmed that all the fish were male, confirming that the fry were all-male.

[0052] Comparative Example 1

[0053] The difference between this comparative example and Example 2 is that the feeding duration of this comparative example is 60 days.

[0054] About 200 common large yellow croaker seedlings with strong vitality and voracious feeding were selected and fed with compound feed containing estradiol from 45 days after hatching to induce sex reversal in genetically male large yellow croakers. The estradiol feeding period was 60 days.

[0055] Estradiol was fed in a gradient-increasing manner: 0.8 mg / kg at 45-55 days of age; 1 mg / kg at 56-65 days of age; and 1.5 mg / kg at 66-105 days of age. Fish were then switched to normal feed after 105 days of age. Water was changed at least 100% daily, and the fish were fed 4-5 times. Mortality was monitored daily and recorded.

[0056] Subsequently, the gonads of the large yellow croaker were taken at 150 days and 12 months of age to prepare histological sections to observe the gonad development, and the corresponding fin rays were taken to extract DNA to identify the genetic genotype.

[0057] During the estradiol treatment period, the survival rate of large yellow croaker was 90%, and the success rate of inducing pseudo-female fish was 90%. Histological sections revealed that some large yellow croaker exhibited facultative gonadalism.

[0058] Comparative Example 2

[0059] The difference between this comparative example and Example 2 is that the feeding duration of this comparative example is 105 days.

[0060] About 200 common large yellow croaker seedlings with strong vitality and voracious feeding were selected and fed with compound feed containing estradiol from 45 days after hatching to induce sex reversal in genetically male large yellow croakers. The estradiol feeding period was 105 days.

[0061] Estradiol was fed in a gradient-increasing manner: 0.8 mg / kg from 45 to 65 days of age; 1 mg / kg from 66 to 80 days of age; and 1.5 mg / kg from 81 to 150 days of age. Fish were then switched to normal feed after 150 days of age. Water was changed at least 100% daily, and the fish were fed 4-5 times. Mortality was monitored daily and recorded.

[0062] Gonads were then removed from the large yellow croaker at 150 days and 12 months of age for histological sections to observe gonadal development. Fin rays were also collected for DNA extraction to identify genotypes. During the estradiol treatment period, the survival rate of large yellow croaker was 85%, and the success rate of pseudo-female induction was 90%. Histological sections revealed abnormalities in egg nucleus development in some large yellow croaker individuals.

[0063] Comparative Example 3

[0064] The difference between this comparative example and Example 2 is that the estradiol dosage fed in this comparative example is lower than the protection scope of the present invention.

[0065] About 200 common large yellow croaker seedlings with strong vitality and voracious feeding were selected and fed with compound feed containing estradiol from 45 days after hatching to induce sex reversal in genetically male large yellow croakers. The estradiol feeding period was 80 days.

[0066] Estradiol was fed in a gradient-increasing manner: 0.5 mg / kg from 45 to 65 days of age; 0.7 mg / kg from 66 to 80 days of age; and 1 mg / kg from 81 to 125 days of age. Fish were then switched to a normal diet after 125 days of age. Water was changed at least 100% daily, and the fish were fed 4-5 times. Mortality was monitored daily and recorded.

[0067] Gonads were then removed from the large yellow croaker at 150 days and 12 months of age for histological sections to observe gonadal development. Fin rays were also collected for DNA extraction to identify genotypes. During the estradiol treatment period, the survival rate of large yellow croaker was 95%, and the success rate of pseudo-female induction was 100%. Histological sections revealed that oocyte developmental arrest was common in large yellow croaker.

[0068] Comparative Example 4

[0069] The difference between this comparative example and Example 2 is that the estradiol dosage fed in this comparative example is higher than the protection scope of the present invention.

[0070] About 200 common large yellow croaker seedlings with strong vitality and voracious feeding were selected and fed with compound feed containing estradiol from 45 days after hatching to induce sex reversal in genetically male large yellow croakers. The estradiol feeding period was 80 days.

[0071] Estradiol was fed in a gradient-increasing manner: 1.2 mg / kg from 45 to 65 days of age; 1.5 mg / kg from 66 to 80 days of age; and 2.0 mg / kg from 81 to 125 days of age. Fish were then switched to a normal diet after 125 days of age. Water was changed at least 100% daily, and the fish were fed 4-5 times. Mortality was monitored daily and recorded.

[0072] Gonads were then removed from the large yellow croaker at 150 days and 12 months of age for histological sections to observe gonadal development. Fin rays were also collected for DNA extraction to identify genotypes. During the estradiol treatment period, the survival rate of the large yellow croaker was 68%, and the success rate of pseudo-female induction was 81%. Histological sections revealed that high doses of estradiol caused ovarian fibrosis in the large yellow croaker.

[0073] Comparative Example 5

[0074] The difference between this comparative example and Example 2 is that the feeding period of this comparative example starts from the age of 30 days of large yellow croaker.

[0075] About 200 common large yellow croaker seedlings with strong vitality and voracious feeding were selected and fed with compound feed containing estradiol from 30 days after hatching to induce sex reversal in genetically male large yellow croakers. The estradiol feeding period was 80 days.

[0076] Estradiol was fed in a gradient-increasing manner: 0.8 mg / kg from 30 to 50 days of age; 1 mg / kg from 51 to 65 days of age; and 1.5 mg / kg from 66 to 110 days of age. Fish were then switched to a normal diet after 110 days of age. Water was changed at least 100% daily, and the fish were fed 4-5 times. Mortality was monitored daily and recorded.

[0077] Gonads were then removed at 150 days and 12 months of age for histological sections to observe gonadal development, and corresponding fin rays were taken for DNA extraction to identify genetic genotypes. During the estradiol treatment period, the survival rate of large yellow croaker was 78%, and the success rate of pseudo-female induction was 63%.

[0078] Comparative Example 6

[0079] The difference between this comparative example and Example 2 is that the feeding period of this comparative example starts from the age of 60 days of large yellow croaker.

[0080] About 200 common large yellow croaker seedlings with strong vitality and voracious feeding were selected and fed with compound feed containing estradiol from 60 days after hatching to induce sex reversal in genetically male large yellow croakers. The estradiol feeding period was 80 days.

[0081] Estradiol was fed in a gradient-increasing manner: 1.2 mg / kg at 60-80 days of age; 1.5 mg / kg at 81-95 days of age; and 2.0 mg / kg at 96-140 days of age. Fish were then switched to a normal diet after 125 days of age. Water was changed at least 100% daily, and the fish were fed 4-5 times. Mortality was monitored daily and recorded.

[0082] Gonads were then removed at 150 days and 12 months of age for histological sections to observe gonadal development, and corresponding fin rays were taken for DNA extraction to identify genetic genotypes. During the estradiol treatment period, the survival rate of large yellow croaker was 90%, and the success rate of pseudo-female induction was 58%.

[0083] The induction success rates and survival rates of Example 2 and Comparative Examples 1-6 are summarized and the results are shown in Table 1.

[0084] Table 1 Group Induction success rate (%) Survival rate (%) Gonadal development Example 2 100 95 No abnormalities Comparative Example 1 90 90 Facultative gonads appear Comparative Example 2 90 85 Abnormal egg nuclear development Comparative Example 3 100 95 Oocyte developmental arrest Comparative Example 4 81 68 Ovarian fibrosis Comparative Example 5 63 78 - Comparative Example 6 58 90 -

[0085] As shown in Table 1, the feeding method provided by the technical solution of the present invention can effectively induce sex reversal in male fish, while ensuring the individual survival rate and making the induction success rate reach 100%.

[0086] The results of Comparative Examples 1-2 show that adjusting the feeding duration of estradiol significantly affects the induction success rate and survival rate of pseudo-female fish. Although shortening the feeding cycle can maintain a high survival rate, it will lead to incomplete sex reversal and the occurrence of facultative gonadal phenomenon; while extending the feeding time will cause abnormal oocyte nuclear development due to the cumulative effect of hormones, resulting in reduced individual survival rate; the results of Comparative Examples 3-4 show that the induction effect of estrogen shows a typical threshold effect, with gonadal development blockage in the low-dose group; and the high-dose group causes ovarian tissue fibrosis due to the metabolic toxicity of excessive estrogen. Comparative Examples 5-6 show the effect of estrogen feeding period on male fish induction. Feeding estradiol too early or too late will affect the induction success rate and survival rate of large yellow croaker individuals.

[0087] Unless otherwise specified, the raw materials and equipment used in the present invention are commonly used in the art; the methods used in the present invention are conventional methods in the art unless otherwise specified.

[0088] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent transformation made to the above embodiment based on the technical essence of the present invention still fall within the scope of protection of the technical solution of the present invention.

Claims

1. A high-efficiency large-scale seed production method for all-male large yellow croaker fry, characterized in that: The steps include: (1) Feeding male large yellow croaker with a gradient of estradiol-containing feed to induce sex reversal in male large yellow croaker and identifying and screening pseudo-female large yellow croaker with an XY genotype and female gonadal morphology; (2) Injecting oxytocin into pseudo-female large yellow croaker and normal male fish to induce fertilization and egg laying, and the hatched fry were screened twice, and super male large yellow croaker with genotype YY was identified and screened; (3) Oxytocin is injected into normal female fish and sexually mature super male yellow croaker to induce spawning and fertilization, and the fertilized eggs are collected for hatching and cultivation to obtain large-scale all-male yellow croaker seedlings.

2. A high-efficiency large yellow croaker all-male seed large-scale seed production method according to claim 1, characterized in that, The gradient feeding starts from the age of the male large yellow croaker being 45 to 52 days and is fed for a total of 73 to 80 days.

3. A high-efficiency large-scale seed production method for all-male large yellow croaker seedlings according to claim 1 or 2, characterized in that, The gradient feeding method is as follows: when male large yellow croaker is 45-65 days old, a compound feed with an estradiol content of 0.7-0.9 mg / kg is fed; when male large yellow croaker is 66-80 days old, a compound feed with an estradiol content of 0.9-1.1 mg / kg is fed; when male large yellow croaker is 81-125 days old, a feeding dose of 1.3-1.7 mg / kg is fed, and after 125 days of age, the feeding dose is switched to normal feed.

4. A high-efficiency large yellow croaker all-male seed large-scale seed production method according to claim 3, characterized in that, When the male large yellow croaker fed by the gradient feeding method is 150 days old, the morphological characteristics and oocytes of the normal female ovary can be observed through histological sections.

5. A high-efficiency large yellow croaker all-male seed large-scale seed production method according to claim 1, characterized in that, The identification and screening of pseudo-female fish or super-male large yellow croaker utilizes PIT live electronic marking technology, injecting a wireless frequency tag into the body of the marked fish to achieve single individual identification; the screening utilizes sex-specific molecular markers to perform PCR amplification and gel electrophoresis analysis on fin ray DNA, combined with gonad tissue sections to observe gonad morphology, and screen pseudo-female fish or super-male large yellow croaker.

6. A high-efficiency large-scale seed production method for all-male large yellow croaker seedlings according to claim 5, characterized in that, The objects of implementation of the PIT live electronic marking are 12-month-old large yellow croaker individuals.

7. A high-efficiency large-scale seed production method for all-male large yellow croaker seedlings according to claim 1, characterized in that, The oxytocin is LHRH-A3, and the injection dose is 1.5-2 μg / kg fish body weight.

8. A high-efficiency large-scale seed production method for all-male large yellow croaker seedlings according to claim 1, characterized in that, In the step (2), the ratio of the number of sexually mature pseudo-female fish to normal male fish is 2 to 2.5:

1.

9. A high-efficiency large yellow croaker all-male seedling large-scale seed production method according to claim 1, characterized in that, The selection and screening operation in step (2) is performed when the fry are 6 months old and 12 months old, respectively.

10. A high-efficiency large-scale seed production method for all-male large yellow croaker seedlings according to claim 1 or 9, characterized in that: The selection criteria for the selection and screening operation in step (2) are that the weight is greater than the average, the body color is good, and there is no deformity, and the selection rate is 5-15%.

Images