Application of MTDPS12A gene in regulation and control of myoblast proliferation and / or differentiation
By regulating the expression of the MTDPS12A gene and using siRNA or miRNA to regulate the proliferation and differentiation of myoblasts, the deficiencies in the regulation of skeletal muscle development are resolved, effective regulation of myoblast proliferation and differentiation is achieved, and a new method for skeletal muscle development is provided.
Patent Information
- Application Number
- CN202510835008.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-20
- Publication Date
- 2025-09-19
AI Technical Summary
The existing technology lacks research on the application of the MTDPS12A gene in the regulation of skeletal muscle development and myoblast proliferation and differentiation, resulting in a lack of effective methods for regulating skeletal muscle development.
By regulating the expression of the MTDPS12A gene, siRNA or miRNA is used to inhibit or promote its expression, the proliferation and differentiation of myoblasts are regulated, and corresponding preparations or kits are prepared to achieve the regulation of the MTDPS12A gene.
Effectively regulating the proliferation and differentiation of myoblasts provides a new approach to regulating skeletal muscle development, promoting or inhibiting cell proliferation and differentiation.
Smart Images

Figure CN120661667A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of gene regulation, and in particular to application of the MTDPS12A gene in regulating myoblast proliferation and / or differentiation. Background Art
[0002] Skeletal muscle development is a process of proliferation, differentiation, and fusion of myoblasts. These myoblasts are activated from quiescent myogenic progenitor cells (MuSCs), which possess the capacity for proliferation and differentiation. MuSCs are a specialized stem cell population that maintains a mitotic quiescent state when unactivated. They reside beneath the basal lamina of myofibers and participate in skeletal muscle growth and development, as well as repair and recovery after injury. During myogenesis, quiescent MuSCs are activated into a rapid proliferation phase, inducing the expression of myogenic regulatory factors. These factors increase the expression of genes involved in the myogenic cell cycle during myoblast proliferation, allowing myoblasts to enter the cell cycle and activate cycle-related genes, thereby promoting myoblast proliferation. During this period, cellular metabolic processes are also highly active.
[0003] After proliferation, myoblasts exit the cell cycle and undergo a series of differentiation stages, evolving from myoblasts to myotubes, ultimately forming new muscle fibers. This differentiation process is crucial for the repair of damaged skeletal muscle and its growth and development. Myocyte differentiation is an orderly progression consisting of multiple dynamic phases, each regulated by the expression of specific genes. In a resting state, satellite cells are dormant, their activity marked by the gene PAX7, which is crucial for maintaining satellite cell proliferation and stem cell properties. However, following muscle damage, satellite cells are activated and reenter the cell cycle for the proliferation phase, marked by genes such as MYF5 and PAX7. Late in the proliferation phase, myoblasts exit the cell cycle and begin to develop into myotubes. During this process, the expression of MYF5 and PAX7 gradually decreases, while the levels of myogenin (MYOG) and MRF4 (also known as MYF6) increase. These powerful regulatory factors drive enhanced transcription of myosin genes. Finally, the differentiated myotubes fuse to form multinucleated myotubes or connect closely with injured muscle fibers to repair them. During this process, the expression of Myosin Heavy Chain (MYHC) protein increases significantly, providing the necessary structural and functional support for muscle recovery.
[0004] The MTDPS12A gene is a member of the mitochondrial transporter (SLC25) family, a class of proteins that play a key hub role in the cellular metabolic network. As a member of the family, its core function is to mediate the transport of a variety of metabolic substrates across the mitochondrial membrane, including basic metabolic intermediates produced by the breakdown of fats, carbohydrates, and proteins, as well as important substances such as nucleotides, vitamins, and inorganic ions. These transport steps are key links in maintaining mitochondrial energy metabolism and cellular material balance. By participating in this transmembrane transport mechanism, this gene plays an indispensable physiological role in the central metabolic pathway. MTDPS12A, along with SLC25A5, SLC25A6, and SLC25A31, are all mitochondrial ADP / ATP carriers, responsible for mitochondrial ATP output and providing energy to the cell. Their expression is tissue-specific, highly regulated, and adapted to specific cellular energy needs. They work together to participate in biological processes such as tissue and cell development and proliferation. MTDPS12A is highly expressed in the heart, skeletal muscle, brain, and organs with low mitotic regeneration. The protein encoded by the MTDPS12A gene is called adenine nucleotide translocator 1 (ANT1). It forms a specific channel on the mitochondrial membrane, responsible for regulating the transport of adenine nucleotides within mitochondria, including adenosine diphosphate (ADP) and adenosine triphosphate (ATP). Furthermore, the coding region of the MTDPS12A gene contains several important conserved sequences, such as the acetylcysteine (ACX) motif and the serine / threonine (ST) motif. These conserved sequences play a crucial role in the function of ANT proteins, participating in the regulation of adenine nucleotide transport within mitochondria and cellular energy metabolism.
[0005] However, there are no reports on the role of MTDPS12A gene in skeletal muscle development and regulation of myoblast proliferation or differentiation. Summary of the Invention
[0006] The purpose of the present invention is to provide a new use of the MTDPS12A gene, namely, the use of the MTDPS12A gene in regulating myoblast proliferation and / or differentiation, to provide a new method and idea for regulating myoblast proliferation or differentiation and further regulating skeletal muscle development.
[0007] According to a first aspect of the present invention, disclosed is the use of the MTDPS12A gene in regulating myoblast proliferation and / or differentiation.
[0008] According to a second aspect of the present invention, a preparation or kit for regulating the expression of the MTDPS12A gene is disclosed for use in regulating the proliferation and / or differentiation of myoblasts.
[0009] According to a third aspect of the present invention, a method for regulating the expression of the MTDPS12A gene or a kit for use in preparing a product for regulating the proliferation and / or differentiation of myoblasts is disclosed.
[0010] According to a fourth aspect of the present invention, disclosed is the use of an MTDPS12A gene inhibitor in promoting myoblast proliferation.
[0011] According to a fifth aspect of the present invention, disclosed is the use of an MTDPS12A gene inhibitor in the preparation of a product for promoting myoblast proliferation.
[0012] According to a sixth aspect of the present invention, disclosed is the use of an MTDPS12A gene inhibitor in inhibiting myoblast differentiation.
[0013] According to a seventh aspect of the present invention, disclosed is the use of an MTDPS12A gene inhibitor in the preparation of a product for inhibiting myoblast differentiation.
[0014] In certain embodiments, the MTDPS12A gene inhibitor includes siRNA or miRNA that can inhibit its expression.
[0015] In certain embodiments, the siRNA is siRNA-MTDPS12A, and its sequence is shown in SEQ ID No: 2 and SEQ ID No: 3.
[0016] In certain embodiments, the miRNA is miR-98-5p mimics, whose sequences are shown in SEQ ID No: 5 and SEQ ID No: 6.
[0017] According to an eighth aspect of the present invention, disclosed is the use of a preparation for promoting the expression of the MTDPS12A gene in inhibiting the proliferation of myoblasts.
[0018] According to a ninth aspect of the present invention, disclosed is the use of a preparation for promoting the expression of the MTDPS12A gene in the preparation of a product for inhibiting myoblast proliferation.
[0019] According to a tenth aspect of the present invention, disclosed is the use of a preparation for promoting the expression of the MTDPS12A gene in promoting myoblast differentiation.
[0020] According to an eleventh aspect of the present invention, disclosed is the use of a preparation for promoting the expression of the MTDPS12A gene in the preparation of a product for promoting myoblast differentiation.
[0021] In certain embodiments, the agent for promoting MTDPS12A gene expression comprises an overexpression vector or miRNA that can promote MTDPS12A gene expression.
[0022] In certain embodiments, the sequence of the overexpression vector is shown as SEQ ID No: 1.
[0023] In certain embodiments, the miRNA is miR-98-5p inhibitor, the sequence of which is shown in SEQ ID No:7.
[0024] According to the twelfth aspect of the present invention, the use of miR-98-5p in regulating the expression of the MTDPS12A gene is disclosed.
[0025] According to a thirteenth aspect of the present invention, disclosed is the use of miR-98-5p in preparing a product for regulating the expression of the MTDPS12A gene.
[0026] According to a fourteenth aspect of the present invention, disclosed is the use of a preparation for regulating miR-98-5p expression in the preparation of a product for regulating MTDPS12A gene expression.
[0027] According to a fifteenth aspect of the present invention, disclosed is the application of miR-98-5p in regulating myoblast proliferation and / or differentiation, which is achieved by regulating the expression of the MTDPS12A gene.
[0028] According to a sixteenth aspect of the present invention, disclosed is the use of miR-98-5p in preparing a product for regulating myoblast proliferation and / or differentiation, wherein the use is achieved by regulating the expression of the MTDPS12A gene.
[0029] Beneficial effects of the present invention:
[0030] Through research, the present invention has discovered a new regulatory gene, MTDPS12A, that can influence skeletal muscle development, particularly regulating myoblast proliferation and differentiation. By regulating the expression of the MTDPS12A gene, myoblast proliferation and differentiation can be efficiently regulated. Therefore, applying the MTDPS12A gene to regulate myoblast proliferation and / or differentiation can further regulate skeletal muscle development, providing new ideas and methods for regulating skeletal muscle development. BRIEF DESCRIPTION OF THE DRAWINGS
[0031] Figure 1 This is the comparison result of the CDS region between mouse MTDPS12A and pig MTDPS12A genes;
[0032] Figure 2 The results of the interference of MTDPS12A gene on the proliferation of C2C12 myoblasts were as follows: Figure 2 a is the result of qPCR detection of the expression of proliferation marker genes in C2C12 cells after transfection of siRNA. Figure 2b is the cell activity results of CCK8 detection at 12h, 24h, 36h and 48h, Figure 2 c is the result of EDU experiment to detect the changes in cell proliferation ability after interference with MTDPS12A gene, siRNA-NC is the nonsense NC fragment control group, siRNA-MTDPS12A is the MTDPS12A gene interference fragment treatment group, scale bar is 100 μm, ns indicates P>0.05, * indicates P<0.05, ** indicates P<0.01, *** indicates P<0.001;
[0033] Figure 3 The results show the effect of overexpression of MTDPS12A on the proliferation of C2C12 cells: Figure 3 a is the result of qPCR detection of the expression of proliferation marker genes in C2C12 cells after transfection of overexpression vectors. Figure 3 b is the cell activity results of CCK8 detection at 12h, 24h and 48h, Figure 3 c is the result of EDU experiment to detect the changes in cell proliferation ability after overexpression of MTDPS12A gene, pcDNA3.1 is the blank vector control group, pcDNA3.1-MTDPS12A is the MTDPS12A gene overexpression vector treatment group, scale bar is 100 μm, ns indicates P>0.05, * indicates P<0.05, ** indicates P<0.01, *** indicates P<0.001;
[0034] Figure 4 Results of the effect of overexpression of MTDPS12A on myogenic differentiation marker protein CDK6: Figure 4 a is the detection band of CDK6 protein after overexpression of MTDPS12A by WB. Figure 4 b shows the relative expression results after statistical analysis of the grayscale values of WB bands quantified using ImageJ software. pcDNA3.1 is the blank vector control group, and pcDNA3.1-MTDPS12A is the MTDPS12A gene overexpression vector treatment group. * indicates P < 0.05.
[0035] Figure 5 Results of interfering with MTDPS12A gene to inhibit the differentiation of C2C12 cells: Figure 5 a is the result of qPCR detection of the expression of differentiation marker genes MYHC, MYOD and MYOG after interfering with MTDPS12A. Figure 5 b is the immunofluorescence detection of MYHC myotubes after interfering with MTDPS12A. Figure 5c is the result of Western blot detection of the expression levels of MYHC and MYOG proteins after interference with MTDPS12A. siRNA-NC is the nonsense NC fragment control group, and siRNA-MTDPS12A is the MTDPS12A gene interference fragment treatment group. The scale bar is 100 μm. ns indicates P>0.05, * indicates P<0.05, and ** indicates P<0.01.
[0036] Figure 6 Overexpression of MTDPS12A gene promoted the differentiation of C2C12 cells. Figure 6 a is the result of qPCR detection of the expression of differentiation marker genes MYHC, MYOD and MYOG after overexpression of MTDPS12A. Figure 6 b is the immunofluorescence detection of MYHC myotubes after overexpression of MTDPS12A. Figure 6 c is the expression level of MYHC and MYOG proteins detected by Western blot after overexpression of MTDPS12A. pcDNA3.1 is the blank vector control group, and pcDNA3.1-MTDPS12A is the MTDPS12A gene overexpression vector treatment group. The scale bar is 100 μm. ns indicates P>0.05, * indicates P<0.05, and ** indicates P<0.01.
[0037] Figure 7 The results of miR-98-5p targeting and regulating the MTDPS12A gene are shown in the figure: Figure 7 a is the binding site between miR-98-5p and the 3'UTR of the MTDPS12A gene obtained by analyzing the TargetScan online prediction website. Figure 7 b is the sequence comparison analysis of miR-98-5p in various species; Figure 7 c is the wild type and mutant fluorescent vector sequence pair designed based on the binding site of miR-98-5p and the 3'UTR of the MTDPS12A gene. WT-MTDPS12A-3'UTR is the wild type fluorescent vector sequence pair, and MUT-MTDPS12A-3'UTR is the mutant fluorescent vector sequence pair. Figure 7 d shows the detection results of C2C12 cells after wild-type and mutant fluorescent reporter vectors were co-transfected with miR-98-5pmimics, ns indicates P>0.05, * indicates P<0.05, *** indicates P<0.001;
[0038] Figure 8 The results of miR-98-5p on C2C12 cell differentiation are shown in Figure 2. Figure 8 a is the comparison of MTDPS12A gene expression in C2C12 cells after transfection of miR-98-5p mimics and miR-NC. Figure 8 b is the comparison of MTDPS12A gene expression in C2C12 cells after transfection of miR-98-5p inhibitor and miR-NC. Figure 8 c is the comparison result of C2C12 cells co-transfected with miR-98-5p mimics, pcDNA3.1-MTDPS12A overexpression vector and control group, miR-mimics indicates transfection with miR-98-5p mimics, miR-inhibitor indicates transfection with miR-98-5p inhibitor, miR-NC indicates nonsense control group, * indicates P < 0.05;
[0039] Figure 9 The result diagram shows that miR-98-5p positively regulates C2C12 cell proliferation: Figure 9 a is the result of CCK8 detection of cell activity after overexpression of miR-98-5p, Figure 9 b is the result of CCK8 detection of cell activity after inhibition of miR-98-5p, Figure 9 c is the result of EDU detection of the effect of overexpression of miR-98-5p on myoblast proliferation. Figure 9 d shows the effect of EDU detection on myoblast proliferation after inhibition of miR-98-5p. miRNA-mimics indicates transfection of miR-98-5p mimics, miRNA-inhibitor indicates transfection of miR-98-5p inhibitor, and miRNA-NC indicates nonsense control group. Scale bar is 100 μm. * indicates P < 0.05, and ** indicates P < 0.01.
[0040] Figure 10 The results of miR-98-5p negatively regulating C2C12 cell differentiation are shown in Figure 1. Figure 10 a is the result of immunofluorescence detection of the number of MYHC myotubes after overexpression of miR-98-5p. Figure 10 b is the result of immunofluorescence detection of the number of MYHC myotubes after inhibition of miR-98-5p. Figure 10 c is the result of qPCR detection of MYHC mRNA expression after overexpression of miR-98-5p, Figure 10 d shows the results of qPCR detection of MYHC mRNA expression after inhibition of miR-98-5p. miRNA-mimics indicates transfection of miR-98-5p mimics, miRNA-inhibitor indicates transfection of miR-98-5p inhibitor, and miRNA-NC indicates nonsense control group. Scale bar is 100 μm. * indicates P < 0.05, and ** indicates P < 0.01. DETAILED DESCRIPTION
[0041] The invention will be further described in detail below with reference to the accompanying drawings.
[0042] By performing RNA-seq sequencing on the longissimus dorsi muscle at three key time points of pig skeletal muscle development, 33 days, 65 days, and 90 days, GSEA analysis showed that the ATP metabolism pathway changed significantly during muscle development, and MTDPS12A was the gene with the highest expression change in this pathway. It is speculated that the MTDPS12A gene may be involved in the regulation of skeletal muscle growth and development.
[0043] Example 1 Construction of pcDNA3.1-MTDPS12A expression vector.
[0044] 1.1MTDPS12A gene sequence alignment.
[0045] The CDS region sequences of the pig (XM_003133345.4) and mouse (NM_007450.5) MTDPS12A genes were downloaded from the NCBI database and then compared using the BLAST tool in the database. The results showed that the homology between the two genes was as high as 99%, the deviation was close to 0, and the confidence level was high ( Figure 1 ). Therefore, the function of the porcine MTDPS12A gene can be verified in mouse myoblasts C2C12.
[0046] 1.2 Cloning of the MTDPS12A gene.
[0047] The porcine MTDPS12A gene sequence (XM_003133345.4) was downloaded from the NCBI database, and primers in the CDS region were designed and synthesized. The CDS sequence of the MTDPS12A gene was amplified by PCR technology. The amplified products were detected by agarose gel electrophoresis and sequencing. The correctly sequenced amplified sequences were used for subsequent vector construction.
[0048] 1.3 Construction of pcDNA3.1-MTDPS12A overexpression vector.
[0049] The primers used for amplification in the previous step were added with restriction site sequences, and the CDS fragment of the MTDPS12A gene was amplified again. The resulting product was digested, ligated, and transformed. The picked monoclonal colonies were expanded and then subjected to bacterial liquid PCR. The results showed that MTDPS12A in these monoclonal bacteria was successfully connected to the pcDNA3.1 vector. The constructed expression vector was recorded as pcDNA3.1-MTDPS12A overexpression vector, and its successful construction was verified by sequencing. The successfully constructed pcDNA3.1-MTDPS12A overexpression vector plasmid was used for subsequent research. The sequence of the pcDNA3.1-MTDPS12A overexpression vector is shown in SEQ ID No: 1.
[0050] Example 2 Inhibition (interference) of the effect of MTDPS12A gene on the proliferation of C2C12 myoblasts.
[0051] In order to explore the effect of inhibiting (interfering) the MTDPS12A gene on the proliferation of C2C12 cells, the MTDPS12A gene interference fragment siRNA-MTDPS12A was designed and synthesized. The sequences are shown in SEQ ID No: 2 and SEQ ID No: 3, as shown in Table 1:
[0052] Table 1 Interference fragment sequences
[0053]
[0054] siRNA-MTDPS12A and nonsense control siRNA-NC (any siRNA not associated with the mouse and pig genomes) were transfected into mouse C2C12 cells. 24 hours after transfection, RNA was extracted and qPCR was performed. The results were as follows: Figure 2 As shown in the results, the results showed that after transfection of siRNA-MTDPS12A, the expression level of MTDPS12A gene in C2C12 cells was extremely significantly decreased (P<0.01), while the expression levels of proliferation marker genes CDK12, CDK6, and Ki67 were extremely significantly increased (P<0.01) ( Figure 2 a); EDU staining and CCK8 proliferation assay were used to detect the effect of MTDPS12A gene interference on C2C12 cells. The CCK8 assay was tested at 12h, 24h, 36h, and 48h. The results showed that MTDPS12A gene interference could significantly promote the proliferation of C2C12 cells (P<0.05) ( Figure 2 b); EDU staining experiments showed that the interference of MTDPS12A gene could significantly increase the percentage of C2C12 EDU-positive cells (P<0.05) ( Figure 2 c), further demonstrating that interfering with MTDPS12A gene expression can promote the proliferation of C2C12 myoblasts.
[0055] The above experimental results all indicate that interfering with MTDPS12A gene expression can promote the proliferation of C2C12 myoblasts.
[0056] Example 3 Effect of overexpression of the MTDPS12A gene on the proliferation of C2C12 myoblasts.
[0057] The pcDNA3.1-MTDPS12A overexpression vector was transfected into C2C12 myoblasts. RNA and protein were extracted 24 h after transfection and tested. The results were as follows: Figure 3As shown: qPCR experiments showed that after transfection of pcDNA3.1-MTDPS12A overexpression vector, the expression of MTDPS12A gene was significantly increased (P<0.05), while the expression of proliferation-related marker genes CDK6, CDK12, and PCNA was significantly decreased (P<0.05) ( Figure 3 a); pcDNA3.1-MTDPS12A overexpression vector was transfected into C2C12 cells, and CCK8 proliferation assay was performed at 12h, 24h, and 48h. The results showed that overexpression of MTDPS12A gene could inhibit the proliferation of C2C12 myoblasts, especially at 24h and 48h, which was extremely significant (P<0.01) ( Figure 3 b); EDU experiments were performed to detect the effect of overexpression of MTDPS12A gene on the proliferation of C2C12 cells. The results showed that overexpression of MTDPS12A gene significantly inhibited the percentage of EDU-positive cells (P<0.01) ( Figure 3 c) Overexpression of the MTDPS12A gene inhibits the proliferation of C2C12 myoblasts. The above results indicate that overexpression of the MTDPS12A gene can inhibit the proliferation of C2C12 myoblasts.
[0058] Western blot experiments were performed, and the results were as follows Figure 4 As shown in: The results showed that the protein expression of proliferation marker gene CDK6 was significantly reduced after MTDPS12A gene overexpression (P<0.05) ( Figure 4 ab).
[0059] The above experimental results show that overexpression of MTDPS12A gene can inhibit the proliferation of C2C12 myoblasts.
[0060] Example 4 Effect of interfering with the MTDPS12A gene on the differentiation of C2C12 myoblasts.
[0061] Verify whether the MTDPS12A gene has an effect on the differentiation of C2C12 myoblasts: First, the MTDPS12A gene interference fragment siRNA-MTDPS12A (sequence as shown in Table 1) and the control nonsense NC fragment siRNA-NC were transfected into C2C12 myoblasts respectively. After 6 hours of transfection, the culture medium was replaced with fresh 2% HS. After 5 days of differentiation treatment, RNA and protein were extracted and tested. The results are shown in Figure 2. Figure 5 As shown in: The results showed that the expression levels of differentiation marker genes detected by qPCR were significantly decreased in the siRNA-MTDPS12A treatment group compared with the siRNA-NC group (P<0.05) ( Figure 5a); Immunofluorescence staining results showed that interference with the MTDPS12A gene significantly reduced the proportion of MYHC myotubes (P<0.05) ( Figure 5 b); Western blot experiments showed that the protein expression of differentiation marker genes MYOD and MYHC was significantly decreased by interfering with the MTDPS12A gene (P<0.05) ( Figure 5 c).
[0062] The above results indicate that interference (inhibition) of MTDPS12A gene expression can inhibit the differentiation of C2C12 myoblasts.
[0063] Example 5 Effect of overexpression of the MTDPS12A gene on the differentiation of C2C12 myoblasts.
[0064] Verify the effect of overexpression of MTDPS12A gene on C2C12 cell differentiation: C2C12 cells were transfected with pcDNA3.1-MTDPS12A overexpression vector and pcDNA3.1 empty expression vector. After 6 hours of transfection, differentiation treatment was performed. After 5 days of differentiation, RNA and protein were extracted and tested. The results are as follows Figure 6 As shown in: The results showed that qPCR results showed that the expression levels of differentiation marker genes MYOD, MYOG and MYHC in the pcDNA3.1-MTDPS12A overexpression vector group were significantly increased compared with the pcDNA3.1 empty expression vector group (P<0.05) ( Figure 6 a); Immunofluorescence assay results showed that overexpression of the MTDPS12A gene could significantly increase the number of MYHC myotubes (P<0.01) ( Figure 6 b); Western blot experiments showed that the protein expression levels of differentiation marker genes MYOD and MYHC in the pcDNA3.1-MTDPS12A overexpression vector group were significantly increased (P<0.05) ( Figure 6 c).
[0065] The above results all indicate that overexpression of MTDPS12A gene can promote the differentiation of C2C12 myoblasts.
[0066] Example 6: miR-98-5p targeted regulation of the MTDPS12A gene.
[0067] 6.1 Predict miRNAs that target and regulate MTDPS12A.
[0068] Since Examples 1-5 have shown that the MTDPS12A gene can regulate the proliferation and differentiation of C2C12 myoblasts, in order to further understand its mechanism, online prediction websites such as TargetScan and miRDB were used to predict miRNAs that may target and regulate the MTDPS12A gene. Several miRNAs that may target MTDPS12A were obtained. After analyzing the possible miRNAs, miR-98-5p was selected as the upstream regulatory factor of the MTDPS12A gene for further research. TargetScan analysis showed that the "seed" sequence of mmu-miR-98-5p can bind to the 3'UTR of MTDPS12A at positions 110–116 ( Figure 7 a); Bioinformatics results show that its seed sequence is highly conserved among species ( Figure 7 b). The sequence of miR-98-5p is shown in SEQ ID No: 4: UGAGGUAGUAAGUUGUAUUGUU (5'-3').
[0069] Based on the miR-98-5p sequence, miR-98-5p mimics that can promote its overexpression were designed and synthesized. The sequence is as follows:
[0070] sense(5'-3')UGAGGUAGUAAGUUGUAUUGUU(SEQ ID No:5);
[0071] antisense(5'-3')CAAUACAACUUACUACCUCAUU (SEQ ID No: 6).
[0072] At the same time, a miR-98-5p inhibitor was designed and synthesized to inhibit (interfere with) the expression of miR-98-5p, and its sequence is: AACAAUACAACUUACUACCUCA (SEQ ID No: 7).
[0073] 6.2 Dual-luciferase reporter assay.
[0074] The MTDPS12A 3'UTR sequence containing the miR-98-5p binding site was connected to the Pmir-GLO vector (Promega) to construct a wild-type fluorescent reporter plasmid (WT-Pmir-GLO-MTDPS12A). The binding site was modified using the same method to construct a mutant fluorescent reporter plasmid (MUT-Pmir-GLO-MTDPS12A). The results are shown in Figure 2. Figure 7As shown in c, WT-MTDPS12A-3'UTR is the wild-type fluorescent vector sequence pair, and MUT-MTDPS12A-3'UTR is the mutant fluorescent vector sequence pair. Wild-type and mutant fluorescent reporter vectors were co-transfected with miR-98-5p mimics into C2C12 cells, and luciferase activity was detected 24 hours later. The fluorescence activity of the mutant group did not change after co-transfection with miR-98-5p mimics, while the fluorescence activity of the wild-type group decreased after co-transfection ( Figure 7 d), indicating that miR-98-5p mimics can inhibit the expression of the MTDPS12A gene. The results show that miR-98-5p can specifically target and regulate the MTDPS12A gene.
[0075] The sequence of the wild-type fluorescent reporter plasmid (WT-Pmir-GLO-MTDPS12A) is shown in SEQ ID No: 8:
[0076] TACCCAAGCTCACAAGTTCACAGATCCATTGTGGTGGTTTAACAGACTATTCTTGAG
[0077] GAAATAAAACAAAAAAAAGAGACAGATCTTGGATAAAACCAGACCGTAAGGAAT
[0078] ACCTCAGAAAAAAATGCTTCATTGAGTATTCATTAAACCACAGAAGTATTTTGTATT
[0079] TATTTTACATTTAGATTCCCACAGAAAACAGGCTAGCTTATCATACTTGTTCACCTG
[0080] ATTAACTGAAGAACTGATGCTGAAAAGTAACTCAGTGTGACTCATTAATAAAGACT
[0081] ACTCAATACACTTTATCTCC
[0082] The sequence of the mutant fluorescent reporter plasmid (MUT-Pmir-GLO-MTDPS12A) is shown in SEQ ID No: 9:
[0083] TACCCAAGCTCACAAGTTCACAGATCCATTGTGGTGGTTTAACAGACTATTCTTGAG
[0084] GAAATAAAACAAAAAAAAGAGACAGATCTTGGATAAAACCAGACCGTAAGGAAA
[0085] TGGAGTGAAAAAAATGCTTCATTGAGTATTCATTAAACCACAGAAGTATTTTGTATT
[0086] TATTTTACATTTAGATTCCCACAGAAAACAGGCTAGCTTATCATACTTGTTCACCTG
[0087] ATTAACTGAAGAACTGATGCTGAAAAGTAACTCAGTGTGACTCATTAATAAAGACT
[0088] ACTCAATACACTTTATCTCC
[0089] Example 7 miR-98-5p targets MTDPS12A to inhibit the differentiation of C2C12 myoblasts.
[0090] Transfection of miR-98-5p mimics ( Figure 8 miR-mimics) and miR-98-5p inhibitor ( Figure 8 The expression of MTDPS12A gene was detected after the miR-inhibitor was added to C2C12 cells. Figure 8 As shown in: After transfection with miR-98-5p mimics, the expression of MTDPS12A gene in the miR-98-5p mimics group was significantly downregulated compared with the miR-NC control group (P<0.05) ( Figure 8 a), indicating that miR-98-5p mimics can inhibit the expression of MTDPS12A gene; after transfection with miR-98-5p inhibitor, the expression of MTDPS12A gene in the miR-98-5p inhibitor transfection group was significantly upregulated compared with the miR-NC control group (P<0.05) ( Figure 8 b), indicating that miR-98-5p inhibitor can promote MTDPS12A gene expression.
[0091] Further rescue experiments were conducted, with the cells divided into pc3.1-MTDPS12A+mimics group: co-transfected pcDNA3.1-MTDPS12A overexpression vector and miR-98-5p mimics into C2C12 cells; pc3.1+mimics group: co-transfected pcDNA3.1 empty expression vector and miR-98-5p mimics into C2C12 cells; and pc3.1+miR-NC group: co-transfected pcDNA3.1 empty expression vector and miR-NC (miRNA meaningless control) into C2C12 cells. Figure 8 As shown in Figure c, compared with the pc3.1+mimics group and the pc3.1+miR-NC group, the expression of the differentiation marker gene MYHC was significantly increased in the pc3.1-MTDPS12A+mimics group (P<0.05). Compared with the pc3.1+miR-NC group, the expression of the differentiation marker gene MYHC was significantly decreased in the pc3.1+mimics group. These results indicate that overexpression of MTDPS12A can rescue the inhibitory effect of miR-98-5p on myoblast differentiation, further demonstrating that miR-98-5p targets MTDPS12A to inhibit myoblast differentiation.
[0092] Example 8: miR-98-5p positively regulates and promotes the proliferation of C2C12 cells.
[0093] To study the effect of miR-98-5p on C2C12 cell proliferation: miR-98-5p mimics ( Figure 9 miRNA-mimics) and mimics NC (nonsense control group, Figure 9 miRNA-NC), and miR-98-5 inhibitor ( Figure 9 miRNA-inhibitor) and inhibitorNC (nonsense control group, Figure 9 The results showed that compared with mimics NC, the cell activity of the miR-98-5p mimics group was significantly increased (P<0.01) ( Figure 9 a). Compared with inhibitor NC, the cell activity of the miR-98-5p inhibitor transfected group was significantly decreased (P<0.01) ( Figure 9 b). EDU assay showed that overexpression of miR-98-5p significantly increased the percentage of EDU-positive cells in the miR-98-5p mimics transfection group (P<0.05) ( Figure 9c), indicating that overexpression of miR-98-5p can promote the proliferation of myoblasts C2C12. In the miR-98-5 inhibitor group, inhibition of miR-98-5p significantly reduced the percentage of EDU-positive cells (P<0.05) ( Figure 9 d), indicating that inhibition of miR-98-5p can inhibit the proliferation of C2C12 myoblasts. The above results indicate that miR-98-5p can positively regulate the proliferation of C2C12 myoblasts.
[0094] Example 9 miR-98-5p negatively regulates the differentiation of myoblasts C2C12.
[0095] In order to study the effect of miR-98-5p on C2C12 cell differentiation, miR-98-5p inhibitor ( Figure 10 miRNA-inhibitor) and inhibitor NC (nonsense control group, Figure 10 miRNA-NC) and miR-98-5p mimics ( Figure 10 miRNA-mimics) and mimics NC (nonsense control group, Figure 10 The cells were transfected with miRNA-NC and the differentiation medium was replaced after 6 hours. The cells were differentiated for 5 days. The effect of miR-98-5p on the differentiation of C2C12 myoblasts was detected by MYHC myotube immunofluorescence. Figure 10 As shown in the results: The results showed that overexpression of miR-98-5p in the miR-98-5pmics transfection group could reduce the proportion of MYHC myotubes ( Figure 10 a), indicating that overexpression of miR-98-5p inhibits the differentiation of C2C12 myoblasts; inhibition of miR-98-5p in the miR-98-5p inhibitor transfection group can increase the proportion of MYHC myotubes ( Figure 10 b), indicating that inhibition of miR-98-5p can promote the differentiation of myoblasts C2C12. qPCR experiments were performed to detect the expression of the differentiation marker gene MYHC. The results showed that overexpression of miR-98-5p in the transfected miR-98-5p mimics group inhibited the expression of MYHC ( Figure 10 c), indicating that overexpression of miR-98-5p inhibits the differentiation of myoblasts C2C12; inhibition of miR-98-5p in the miR-98-5p inhibitor transfection group can promote the expression of MYHC ( Figure 10
Claims
1. Application of the MTDPS12A gene in regulating myoblast proliferation and / or differentiation.
2. Use of a preparation or kit for regulating MTDPS12A gene expression in regulating myoblast proliferation and / or differentiation, or use of a preparation or kit for regulating MTDPS12A gene expression in preparing a product for regulating myoblast proliferation and / or differentiation.
3. Use of an MTDPS12A gene inhibitor in promoting myoblast proliferation or use of an MTDPS12A gene inhibitor in preparing a product that promotes myoblast proliferation.
4. Use of an MTDPS12A gene inhibitor in inhibiting myoblast differentiation or use of an MTDPS12A gene inhibitor in preparing a product for inhibiting myoblast differentiation.
5. The use according to claim 3 or 4, wherein The MTDPS12A gene inhibitor includes siRNA or miRNA that can inhibit its expression; Preferably, the siRNA is siRNA-MTDPS12A, the sequences of which are shown in SEQ ID No: 2 and SEQ ID No: 3; Preferably, the miRNA is miR-98-5p mimics, and its sequence is shown in SEQ ID No: 5 and SEQ ID No:
6.
6. Use of a preparation that promotes MTDPS12A gene expression in inhibiting myoblast proliferation or use of a preparation that promotes MTDPS12A gene expression in preparing a product that inhibits myoblast proliferation.
7. Use of a preparation that promotes MTDPS12A gene expression in promoting myoblast differentiation or use of a preparation that promotes MTDPS12A gene expression in preparing a product that promotes myoblast differentiation.
8. The use according to claim 6 or 7, wherein The preparation for promoting MTDPS12A gene expression includes an overexpression vector or miRNA that can promote MTDPS12A gene expression; Preferably, the sequence of the overexpression vector is shown as SEQ ID No:
1. Preferably, the miRNA is miR-98-5p inhibitor, and its sequence is shown in SEQ ID No:
7.
9. Application of miR-98-5p in regulating MTDPS12A gene expression; application of miR-98-5p in preparing products that regulate MTDPS12A gene expression; application of preparations that regulate miR-98-5p expression in preparing products that regulate MTDPS12A gene expression.
10. Use of miR-98-5p in regulating myoblast proliferation and / or differentiation or in preparing a product for regulating myoblast proliferation and / or differentiation, wherein: The application is achieved by regulating the expression of the MTDPS12A gene.