Saline-alkali soil soybean high-efficiency nitrogen-fixing fast-growing rhizobium sp. SAS17 and application thereof

Abstract

The invention discloses a high-efficiency nitrogen-fixing fast-growing rhizobium sp. SAS17 for soybeans in saline-alkali soil and application thereof, and relates to the technical field of soybean planting, the key point of the technical scheme is that the soybean fast-growing rhizobium sp. SAS17 is extracted from soybean root nodules planted in the saline-alkali soil, and compared with other soybean fast-growing rhizobium sp. The rhizobium can form effective symbiotic nitrogen fixation with different soybean varieties under saline-alkali treatment, the saline-alkali tolerance of soybeans is improved, and the rhizobium has the potential application value of improving the soybean yield.

Description

Technical Field

[0001] The present invention relates to the technical field of soybean planting, and more particularly to a saline-alkali soil soybean high-efficiency nitrogen-fixing and fast-growing rhizobium bacterium SAS17 and an application thereof. Background Art

[0002] As one of the most important food crops in the legume family, soybeans rely on their symbiotic nitrogen-fixing ability with rhizobia to determine their timely nitrogen supply, thus impacting soybean yield. Soybean nodulation and nitrogen fixation with rhizobia can reduce nitrogen fertilizer usage. Soybean varieties have specific recognition for different rhizobia, resulting in varying nodulation efficiencies when inoculated with different rhizobia. Furthermore, the indigenous rhizobia found in the soils of my country's major soybean-producing regions vary.

[0003] In order to improve the salt-alkali tolerance of soybean plants in saline-alkali land, identifying the rhizobia in saline-alkali land and exploring the saline-alkali rhizobia that can efficiently fix nitrogen with different soybean varieties will help enhance the salt-alkali tolerance of soybeans, increase the planting area of ​​soybeans in saline-alkali land and increase soybean yields. Summary of the Invention

[0004] The present invention aims to provide a high-efficiency, fast-growing rhizobium bacterium SAS17 for soybean nitrogen fixation in saline-alkali soil and its application. The rhizobium can form effective symbiotic nitrogen fixation with different soybean varieties under saline-alkali treatment, thereby improving the salt-alkali tolerance of soybeans and having potential application value in increasing soybean yield.

[0005] The above technical objectives of the present invention are achieved through the following technical solutions: a fast-growing rhizobium SAS17 for efficient nitrogen fixation of soybeans in saline-alkali land, wherein the fast-growing rhizobium SAS17 is isolated from soybean nodules grown in saline-alkali land in Arong Banner, Inner Mongolia. The fast-growing rhizobium SAS17 has a preservation number of CGMCC No. 34035 and is deposited in the General Microbiology Center of the China Culture Collection of Microorganisms. The depository address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences. The preservation date is March 31, 2025, and the classification name is Sinorhizobium fredii.

[0006] The present invention also provides a bacterial agent containing the saline-alkali soil soybean high-efficiency nitrogen-fixing and fast-growing rhizobium SAS17, wherein the fast-growing rhizobium SAS17 is used as an active ingredient in the bacterial agent.

[0007] The present invention also provides a biological fertilizer containing the saline-alkali soil soybean high-efficiency nitrogen-fixing and fast-growing rhizobium SAS17. The biological fertilizer comprises the fast-growing rhizobium SAS17 and a fertilizer carrier.

[0008] The present invention also provides a bacterial solution of a fast-growing rhizobium SAS17 with high-efficiency nitrogen fixation in saline-alkali soil soybeans. The fast-growing rhizobium SAS17 bacterial solution is prepared by adding the fast-growing rhizobium SAS17 into a plant nutrient solution and mixing the mixture until the bacterial solution concentration OD600 is 0.1.

[0009] Furthermore, the plant nutrient solution is a nitrogen-free nutrient solution.

[0010] The present invention also provides an application of the saline-alkali soil soybean efficient nitrogen-fixing and fast-growing rhizobium SAS17. The fast-growing rhizobium SAS17 is inoculated into the soybean roots or the soybean rhizosphere soil to improve the soybean stress tolerance, promote soybean nodulation and nitrogen fixation, promote the growth and development of soybean plants, and increase soybean yield.

[0011] In summary, the present invention has the following beneficial effects: the present invention extracts a fast-growing soybean rhizobium from soybean nodules grown in saline-alkali land. Compared with other fast-growing soybean rhizobia, the rhizobium can form effective symbiotic nitrogen fixation with different soybean varieties under saline-alkali treatment, thereby improving the salt-alkali tolerance of soybeans and having potential application value in increasing soybean yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 It is the composition of saline-alkali soil rhizobium in the embodiment of the present invention;

[0013] Figure 2 is the 16SrDNA phylogenetic tree of the SAS17 strain in the embodiment of the present invention;

[0014] Figure 3 This is the colony morphology of the SAS17 strain on YMB medium in the embodiment of the present invention;

[0015] Figure 4 This is the phenotype of plants inoculated with the USDA110 strain and the SAS17 strain in the embodiment of the present invention and treated with salt in Wm82 soybeans;

[0016] Figure 5 The present invention relates to the identification of phenotypic traits of soybean plants after saline-alkali treatment, without inoculation, inoculation with USDA110, and inoculation with SAS17. DETAILED DESCRIPTION

[0017] The following is combined with Figure 1-5 The present invention is described in further detail.

[0018] Example: To improve the salt-alkali tolerance of soybean plants in saline-alkali soil, we identified the rhizobia species in saline-alkali soil and found that Sinorhizobium had the highest abundance in saline-alkali soil ( Figure 1 ), we speculate that Sinorhizobium may play an important role in saline-alkali land.

[0019] The fast-growing rhizobium bacteria of the present invention are isolated from soybean nodules grown in saline-alkali land in Arong Banner, Inner Mongolia. The separation and purification method is as follows:

[0020] Nodule collection and cleaning: Fresh nodules were obtained from the soybean root system and rinsed repeatedly with sterile water for 5 times to remove surface soil impurities.

[0021] Surface disinfection: Immerse the nodules in 70% ethanol solution (v / v) and let it stand for 1 minute; transfer them to 4% sodium hypochlorite solution (v / v) and soak for 3 minutes to completely inactivate surface microorganisms.

[0022] Final cleaning: Rinse again with sterile water 5 times to remove residual disinfectant.

[0023] Nodule crushing and bacterial isolation: Under sterile conditions, use blunt-tipped forceps to gently crush the nodules until they are broken. Use an inoculating loop to collect the sap from the nodules and streak the solution evenly onto Yeast-Mannitol Medium (YMB).

[0024] Culture and Observation: Place the inoculated plate in a 28°C incubator and observe every 24 hours. Once a single, transparent colony appears on the surface of the culture medium, select the colony for purification and subsequent identification.

[0025] Identification of Rhizobium genus, identified by 16sRDNA_F / R:

[0026] F: 5'--3': AGAGTTTGATCCTGGCTCAG;

[0027] R: 5'--3': AAGGAGGTGATCCAGCC.

[0028] use PCR amplification was performed using Flash Master Mix High-Fidelity PCR Kit (Novagen).

[0029] The PCR reaction conditions were as follows: initial denaturation at 98°C for 30 s; denaturation at 98°C for 10 s, annealing at 56°C for 5 s, and extension at 72°C for 15 s, for a total of 35 cycles; final extension at 72°C for 5 min;

[0030] The PCR amplification system was: 2× FlashMasterMix 7.5 μL, F 0.5 μL, R 0.5 μL, DNA template 1 μL, and ddH2O 5.5 μL.

[0031] Sanger sequencing was used to obtain the sequence information of the target fragment, and the NCBI database was used for Blast (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome) to determine the bacterial genus.

[0032] We extracted a total of 22 fast-growing rhizobia from saline-alkali soil and inoculated Williams82, Zhongliandou 1505, and Zhongliandou 1510, respectively. Twenty-one days after inoculation, we identified the number of nodules, aboveground fresh weight, underground fresh weight, aboveground dry weight, and underground dry weight of the soybean plants. We performed principal component analysis on these indicators and comprehensively evaluated the nodulation and nitrogen fixation abilities of these fast-growing rhizobia. We found that fast-growing rhizobia No. 17 could form a good symbiosis with soybeans and promote soybean growth (Table 1).

[0033] Table 1 Comprehensive evaluation of 22 fast-growing rhizobia

[0034]

[0035] The main morphological and biological characteristics of Rhizobium No. 17 are: the colonies on YMB medium plates are white with smooth edges and convexities. They can grow on plates with mannitol, yeast extract, glucose, and lactose as carbon sources at 28°C. The optimal pH for growth is pH 6-pH 9. They are resistant to streptomycin, spectinomycin, kanamycin, nalidixic acid, and chloramphenicol. Figure 3 Based on the morphological characteristics, phylogenetic tree analysis of 16S rDNA gene sequence and genome sequencing analysis of strain 17, strain 17 was identified as belonging to the genus Sinorhizobium fredii and named SAS17 ( Figure 2 ).

[0036] This specific embodiment is merely an explanation of the present invention and is not intended to limit the present invention. After reading this specification, those skilled in the art may make non-creative modifications to this embodiment as needed. However, as long as such modifications are within the scope of the claims of the present invention, they are protected by patent law.

Claims

1. A high-efficiency, nitrogen-fixing, and fast-growing rhizobium strain SAS17 for soybeans grown in saline-alkali soil, characterized by: The fast-growing rhizobium bacteria SAS17 is deposited with CGMCC No. 34035.

2. A bacterial agent containing the saline-alkali soil soybean efficient nitrogen-fixing and fast-growing rhizobium SAS17 according to claim 1, characterized in that: The bacterial agent uses fast-growing rhizobium bacteria SAS17 as an active ingredient.

3. A biological fertilizer containing the saline-alkali soil soybean efficient nitrogen-fixing and fast-growing rhizobium SAS17 according to claim 1, characterized in that: The bacterial fertilizer comprises fast-growing rhizobium bacteria SAS17 and a fertilizer carrier.

4. The saline-alkali soil soybean efficient nitrogen-fixing and fast-growing rhizobium SAS17 bacterial solution according to claim 1, characterized in that: The fast-growing rhizobium SAS17 bacterial solution is prepared by adding the fast-growing rhizobium SAS17 into a plant nutrient solution and mixing the mixture until the bacterial solution concentration OD600 is 0.

1.

5. The saline-alkali soil soybean efficient nitrogen-fixing and fast-growing rhizobium SAS17 bacterial solution according to claim 4, characterized in that: The plant nutrient solution is a nitrogen-free nutrient solution.

6. The use of the soybean high-efficiency nitrogen-fixing and fast-growing rhizobium SAS17 in saline-alkali soil according to claim 1, characterized in that: Inoculating the fast-growing rhizobium SAS17 into the soybean roots or the soybean rhizosphere soil can improve soybean stress tolerance, promote soybean nodulation and nitrogen fixation, promote the growth and development of soybean plants, and increase soybean yield.

Images