Stenotrophomonas maltophilia for degrading polyglycolic acid plastics and application of stenotrophomonas maltophilia
By isolating Stenotrophomonas maltophilia strain B51 from landfill soil samples and directly applying it to the degradation of polyglycolic acid plastics, the problem of lack of microbial degradation of polyglycolic acid plastics was solved and significant degradation effects were achieved.
Patent Information
- Application Number
- CN202510883940.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-30
- Publication Date
- 2025-09-19
AI Technical Summary
There is little research on the microbial degradation of polyglycolic acid plastics in the existing technology, and there is a lack of effective degradation methods.
Provided is a Stenotrophomonas maltophilia strain B51, which is directly isolated from a landfill soil sample and applied to the degradation of polyglycolic acid plastics. The bacterium degrades the plastic under mild conditions by secreting substances such as esterase.
Within 14 days, the degradation rate of polyglycolic acid plastic particles reached 17.22%. Pits, pores, and cracks appeared on the surface of the plastic particles, and the chemical structure changed, showing an efficient degradation effect.
Smart Images
Figure CN120665771A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of microorganisms, in particular to a kind of Stenotrophomonas maltophilia capable of degrading polyglycolic acid plastic and application thereof. Background Art
[0002] Plastics are widely used in food packaging, clothing, electronics, construction, and various other industrial fields due to their excellent properties, such as chemical resistance, low production costs, and simple processing. However, these same properties make most plastics difficult to degrade, contributing to environmental pollution. Polyglycolic acid (PGA), also known as polyglycolide, is the simplest linear aliphatic polyester with a chemical structure. PGA is a fully biodegradable material that degrades completely within 1 to 3 months. It is non-toxic, harmless, and environmentally friendly. Early applications of PGA materials were primarily in medical sutures, but later expanded to the crude oil extraction industry, including fracturing balls or temporary plugging balls (bridge plugs) used in shale oil production, as well as improved knotted products as technological requirements increased. Beyond the shale oil industry, the use of temporary plugging balls can also further increase oil production in traditional oil fields with declining or depleted oil wells. In addition, the use of fully biodegradable materials in the packaging field is a general trend. In this field, 10% to 20% of high-performance packaging materials can be replaced by fully biodegradable materials PGA, which will have a market demand of 210,000 tons. PGA has certain preliminary applications in this field due to its good mechanical properties and fully biodegradable characteristics. With the gradual increase in its output and the reduction of production costs, PGA will have a wide range of applications in the packaging field.
[0003] Currently, there are many types of biodegradable plastics on the market, such as poly(adipate-co-butylene terephthalate), which is well known for its biodegradability by microorganisms and enzymes and is widely used as a raw material for compostable plastics. These biodegradable plastics are primarily engineered to express corresponding degradation enzymes in microorganisms. For example, CN118360268A discloses a poly(adipate-co-butylene terephthalate) degradation enzyme, which is produced by constructing recombinant bacteria containing the cutinase encoding genes Cut04 or Cut10 to express Cut04 or Cut10.
[0004] However, few studies have focused on the microbial degradation of PGA in natural environments, and research on the types and conditions of PGA-degrading microorganisms is very limited. Therefore, it is of great significance to isolate and identify microorganisms that can effectively promote the degradation of PGA under mild conditions. Summary of the Invention
[0005] The present invention aims to address the current lack of microbial degradation methods for polyglycolic acid plastics by providing a strain of Stenotrophomonas maltophilia for degrading polyglycolic acid plastics and its application. The present invention's Stenotrophomonas maltophilia strain B51 is a natural strain isolated directly from landfill soil samples. It exhibits strong adaptability, reduces biosafety risks, and can be directly applied to degrade polyglycolic acid plastics without the need for genetic modification.
[0006] The purpose of the present invention can be achieved by the following technical solutions:
[0007] One of the technical solutions of the present invention is to provide a Stenotrophomonas maltophilia for degrading polyglycolic acid plastic. The Stenotrophomonas maltophilia is Stenotrophomonas maltophilia strain B51, and its deposit number is CGMCC No.34495.
[0008] In some embodiments, the inoculation amount of 5% Stenotrophomonas maltophilia strain B51 can achieve a degradation rate of 17.22% for polyglycolic acid plastic particles in 14 days, so that the infrared spectrum of the polyglycolic acid plastic particles at 1750 cm -1 and 1150cm -1 The absorption peak at the position weakened, X-ray diffraction showed that the crystallinity of the polyglycolic acid plastic particles decreased, and scanning electron microscopy showed that the polyglycolic acid plastic particles changed from a smooth surface to a morphology of pits, pores, and cracks.
[0009] A second technical solution of the present invention is to provide a Stenotrophomonas maltophilia preparation for degrading polyglycolic acid plastic, which contains the Stenotrophomonas maltophilia strain B51 bacterial cells as described in one of the above technical solutions.
[0010] In some specific embodiments, the Stenotrophomonas maltophilia preparation for degrading polyglycolic acid plastic is a liquid preparation or a solid powder preparation.
[0011] In some embodiments, when the preparation of Stenotrophomonas maltophilia for degrading polyglycolic acid plastic is a liquid preparation, the concentration of Stenotrophomonas maltophilia strain B51 is: OD 600 >0.2;
[0012] When the Stenotrophomonas maltophilia preparation for degrading polyglycolic acid plastic is a solid powder preparation, the content of the Stenotrophomonas maltophilia strain B51 is: (0.05-0.15) mg / mL.
[0013] A third technical solution of the present invention is to provide an application of Stenotrophomonas maltophilia as described in one of the above technical solutions in degrading plastics. The method for degrading plastics using Stenotrophomonas maltophilia strain B51 is as follows: adding Stenotrophomonas maltophilia strain B51 to a degradation culture medium with polyglycolic acid plastic as the sole carbon source to degrade the polyglycolic acid plastic.
[0014] In some embodiments, the Stenotrophomonas maltophilia strain B51 is first enriched and cultured, comprising the following steps:
[0015] A single colony of Stenotrophomonas maltophilia strain B51 was picked and placed in LB liquid medium, and cultured at 37° C. and 180 rpm with shaking until the logarithmic phase to obtain a seed solution of Stenotrophomonas maltophilia strain B51.
[0016] In some specific embodiments, the amount of the Stenotrophomonas maltophilia strain B51 seed solution added is 5% of the volume of the degradation culture medium.
[0017] In some specific embodiments, the degradation medium comprises the following components: KH2PO4 0.6 g / L, Na2HPO4 0.5 g / L, NH4Cl 2.0 g / L, KCl 1.0 g / L, MgSO4 0.5 g / L, FeSO4 7H2O 6 mg / L, ZnSO4 7H2O 6 mg / L, CaCl2 7.5 mg / L, and water.
[0018] In some specific embodiments, the temperature of the degradation treatment of the polyglycolic acid plastic is 37° C. and the time is at least 48 hours.
[0019] Compared to existing technologies, the present invention isolates a strain of Stenotrophomonas maltophilia strain B51 from landfill soil samples, capable of degrading polyglycolic acid plastic particles. This strain can effectively degrade plastic particles. Fourteen days after the start of the degradation experiment, Stenotrophomonas maltophilia strain B51 achieved a degradation rate of 17.22% for polyglycolic acid plastic particles. Scanning electron microscopy revealed the appearance of pits, pores, and cracks on the surface of the plastic particles. Fourier transform infrared spectroscopy and X-ray diffraction analysis revealed significant changes in the chemical structure of the plastic particles.
[0020] In addition, the Stenotrophomonas maltophiliastrain B51 isolated by the present invention can grow and reproduce using polyglycolic acid plastic as the sole carbon source, and has the advantages of fast reproduction and growth, low culture cost and components, simple expansion culture method, and efficient degradation of polyglycolic acid plastic.
[0021] Stenotrophomonas maltophilia strain B51 can degrade and transform polyglycolic acid plastics under relatively mild conditions by secreting substances such as esterases with degradation effects, converting polyglycolic acid plastics into low-molecular substances such as carbon dioxide. It can be used to degrade different types of polyglycolic acid or in the regeneration or pretreatment of polyglycolic acid plastics. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 Phylogenetic analysis of Stenotrophomonas maltophilia strain B51.
[0023] Figure 2 This is the growth curve of Stenotrophomonas maltophilia strain B51 using polyglycolic acid plastic particles as a carbon source and the weight loss rate of the plastic particles after the degradation experiment.
[0024] Figure 3 This is the SEM image of the surface morphology changes of polyglycolic acid plastic particles during the degradation experiment.
[0025] Figure 4 This is the Fourier infrared spectrum analysis diagram of polyglycolic acid plastic particles after the degradation experiment.
[0026] Figure 5This is the X-ray diffraction analysis diagram of polyglycolic acid plastic particles after the degradation experiment. DETAILED DESCRIPTION
[0027] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments. This embodiment is implemented based on the technical solution of the present invention, and provides a detailed implementation method and specific operation process, but the protection scope of the present invention is not limited to the following embodiments.
[0028] In the following examples, unless otherwise specified, raw materials or processing techniques are conventional commercially available raw materials or conventional processing techniques in the art.
[0029] Example 1:
[0030] 1.1 Enrichment and isolation of polyglycolic acid plastic-degrading microorganisms
[0031] The microorganisms isolated in this example that have the ability to degrade polyglycolic acid plastics were derived from a soil sample from a garbage dump in Zhujiajiao Town, Qingpu District, Shanghai.
[0032] The separation and acquisition process is as follows:
[0033] Step 1) Preparation of enrichment medium: Prepare an enrichment medium capable of enriching microorganisms from the landfill soil sample. The enrichment medium composition (g / L) is: 10.0% NaCl, 2.0% yeast extract, 5.0% peptone, and water. Finally, adjust the pH of the enrichment medium to neutral to provide a suitable growth environment for the microorganisms.
[0034] Step 2) Enrichment of degradation bacteria: 5 mL of the supernatant from the garbage dump soil sample was inoculated into a 250 mL conical flask containing 100 mL of enrichment medium and cultured in a shaking incubator at 37°C and 180 rpm. The successfully enriched microorganisms were then transferred to an enrichment medium containing polyglycolic acid plastic particles, and the carbon source was gradually reduced until the enrichment medium contained only polyglycolic acid plastic particles as a carbon source. The transfer cycle was determined by the growth of the microorganisms. Continuous subculture was performed to achieve large-scale enrichment of the bacteria and obtain an enriched bacterial solution.
[0035] Step 3) Isolation and purification of degradation bacteria: The enriched bacterial solution was diluted with sterile saline to a dilution of 10 -7 , 10 -8 , 10 -9 , 10 -10The dilution was then spread onto a solid culture medium plate using the spread plate method. The solid culture medium consisted of 10 g / L NaCl, 5 g / L yeast extract, 10 g / L tryptone, 25 g / L agar powder, 10 μg / mL vancomycin, and water. The plate was then incubated at 37°C. Colonies with regular morphology and uniform color were then selected for streaking. Individual colonies that emerged from the streaking were then purified by multiple streaking to obtain a pure strain capable of degrading polyglycolic acid plastic particles.
[0036] 1.2 Identification of microorganisms isolated from landfill soil samples
[0037] The genome of a pure bacterial strain was amplified using 16S rRNA. The universal bacterial primers 27F and 1492R are shown in SEQ ID NOs. 1 and 2, respectively. The PCR protocol was as follows: initial denaturation at 94°C for 5 minutes; 32 cycles of 94°C for 10 seconds, 56°C for 20 seconds, and 72°C for 30 seconds, followed by a post-extension at 72°C for 5 minutes. The PCR amplification system consisted of 16 µL of 2× TransStart FastPfu Fly PCR SuperMix, 10 µL of ddH2O, 1 µL of primer 27F, 1 µL of primer 1492R, and 2 µL of template.
[0038] After the amplification step, spot 6 μL of unpurified DNA sample onto a 1% agarose gel and run it at 160V for 30 minutes. The gel should then be transferred to a gel imaging system for imaging to verify bacterial genome extraction. If a positive result is detected by agarose gel electrophoresis, subsequent DNA sequencing will be performed by Guangdong Meige Gene Technology Co., Ltd.
[0039] After the sequencing results were processed by MEGA 7.0.26, the strain sequences were submitted to the NCBI website (https: / / www.ncbi.nlm.nih.gov / ) and subjected to Blast sequence alignment analysis. The DNA sequences of adjacent species were aligned using Clustal W, and the phylogenetic tree was constructed using MEGA 7.0.26, as shown in Figure 2 . Figure 1Identification results showed that the microorganism belonged to the genus Stenotrophomonas maltophilia and was named Stenotrophomonas maltophilia strain B51. The strain was found to be homologous to Stenotrophomonas maltophilia strain 5633, with a similarity of 99.08%. However, Stenotrophomonas maltophilia strain 5633 has not been reported to be able to degrade plastics.
[0040] Stenotrophomonas maltophilia strain B51 is deposited in the China General Microbiological Culture Collection Center, located at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC No. 34495 and the deposit date May 9, 2025.
[0041] Stenotrophomonas maltophilia strain B51 is a Gram-negative bacillus with 1-8 extreme flagella, motile, non-spore-forming, non-capsulated, non-hemolytic colonies, and a yellow pigment. Its optimal growth temperature is 35°C; no growth occurs at 4°C, but nearly half of the colonies grow at 42°C.
[0042] SEQ ID NO. 1 (primer 27): AGAGTTTGATCCTGGCTCAG
[0043] SEQ ID NO.2 (primer 1492R): TACGGYTACCTTGTTAYGACTT
[0044] 1.3 Degradation of polyglycolic acid plastic particles by Stenotrophomonas maltophilia strain B51
[0045] 1.3.1. Experimental materials
[0046] Degradation medium: KH2PO4 0.6 g / L, Na2HPO4 0.5 g / L, NH4Cl 2.0 g / L, KCl 1.0 g / L, MgSO4 0.5 g / L, FeSO4 7H2O 6 mg / L, ZnSO4 7H2O 6 mg / L, CaCl2 7.5 mg / L, water;
[0047] LB medium: sodium chloride 10.0 g / L, yeast powder 5.0 g / L, tryptone 10.0 g / L, water.
[0048] All the above reagents were commercially available analytical grade products.
[0049] Experimental procedures
[0050] A single colony of Stenotrophomonas maltophilia strain B51 was picked into a 250 mL conical flask containing 100 mL LB medium, cultured in a shaking incubator at 37°C and 180 rpm to the logarithmic growth phase, and inoculated into 100 mL degradation medium containing 0.5 g of polyglycolic acid plastic particles according to an inoculum size of 5%, and cultured in a shaking incubator at 37°C and 180 rpm. At the same time, the degradation medium not inoculated with Stenotrophomonas maltophilia strain B51 and the polyglycolic acid plastic particles were cultured under the same conditions as a non-inoculation control group, and the degradation medium inoculated with Stenotrophomonas maltophilia strain B51 was cultured under the same conditions as a no-substrate control group.
[0051] The polyglycolic acid plastic particles used in the experiment were soaked in 75% ethanol solution for 3 hours before the experiment, washed with sterile water 3 times, air-dried in a clean bench, and then irradiated with ultraviolet light for 3 hours to achieve the effect of sterilization. 600 Monitor the concentration of bacteria in the culture medium and estimate the bacterial growth.
[0052] Detection methods
[0053] After 14 days of incubation, the remaining polyglycolic acid plastic particles were recovered from the degradation medium and then cleaned in a 75% ethanol solution for 2 hours in an ultrasonic cleaner. After washing with sterile water for another 2 hours, the particles were air-dried in a clean bench to a constant weight. The polyglycolic acid plastic particles in the uninoculated control group were treated in the same manner. The degradation efficiency of the polyglycolic acid plastic particles was evaluated based on the weight loss rate using the following formula: Where W0 is the initial weight of the polyglycolic acid plastic particles, and W is the remaining weight of the polyglycolic acid plastic particles after degradation.
[0054] The growth curve of Stenotrophomonas maltophilia strain B51 using polyglycolic acid plastic particles as the sole carbon source and the degradation weight loss rate of the polyglycolic acid plastic particles in Example 1 were measured.
[0055] By Figure 2 As shown in the growth curve, the bacterial concentration of Stenotrophomonas maltophiliastrain B51 in the degradation medium increased exponentially from 0.20084 to 0.8431 from the beginning to 48 hours. After 48 hours, the bacterial growth rate decreased, and the OD 600 The increase from 0.8431 to 0.9700 indicates that the strain has ended the exponential growth phase and has just entered the stable phase. Stenotrophomonas maltophilia strain B51 can maintain a stable bacterial concentration within a certain period of time in the experimental group with the addition of polyglycolic acid plastic particles. In the substrate-free control group without the addition of plastic, the absorbance value began to decrease at the 48th hour of the experiment, and the bacterial concentration gradually decreased. This indicates that Stenotrophomonas maltophilia strain B51 can use polyglycolic acid plastic particles as energy substances for growth metabolism. Figure 2 As shown, after a 14-day degradation experiment, the weight loss of polyglycolic acid plastic particles not treated with Stenotrophomonas maltophilia strain B51 was approximately 1.59%, while the weight loss of polyglycolic acid plastic particles treated with Stenotrophomonas maltophilia strain B51 was approximately 17.22%, indicating that the isolated Stenotrophomonas maltophilia strain B51 has the ability to degrade polyglycolic acid plastic particles. The Stenotrophomonas maltophilia strain B51 that degraded the polyglycolic acid plastic particles was separated from the culture medium and weighed, and the content of Stenotrophomonas maltophilia strain B51 was 0.097 mg / mL.
[0056] Example 2: Surface morphology changes of polyglycolic acid plastic particles degraded by Stenotrophomonas maltophilia strain B51
[0057] To observe the degradation effect of polyglycolic acid plastic, polyglycolic acid plastic particles that had been treated with degradation culture medium and Stenotrophomonas maltophilia strain B51 for 14 days were cleaned in an ultrasonic cleaner with 75% ethanol and distilled water for 2 hours each to completely remove the biofilm. Before being loaded onto the electron microscope, the following sample preparation operations were performed: conductive glue was applied to an iron surface, an appropriate amount of sample was fixed on the conductive glue, and 4nm of gold was sprayed. After the above operations, electron microscopy observation was performed.
[0058] like Figure 3 As shown in the figure, we found that pits, pores, cracks and other phenomena appeared on the surface of polyglycolic acid plastic particles co-cultured with Stenotrophomonas maltophilia strain B51, while the surface cracks of plastic particles treated with water were smaller than those treated with Stenotrophomonas maltophilia strain B51. The surface of plastic particles not treated with Stenotrophomonas maltophilia strain B51 was relatively smooth and flat. These phenomena indicate that Stenotrophomonas maltophilia strain B51 can corrode and destroy the surface of polyglycolic acid plastic, causing significant changes in the surface morphology of polyglycolic acid plastic.
[0059] Example 3: Changes in functional groups and crystallinity of polyglycolic acid particles after degradation by Stenotrophomonas maltophilia strain B51
[0060] The polyglycolic acid plastic particles treated with the degradation medium and Stenotrophomonas maltophilia strain B51 for 14 days were cleaned in an ultrasonic cleaner with 75% ethanol and distilled water for 2 hours each, and air-dried in an ultra-clean workbench for analysis by Fourier transform infrared spectroscopy and gel permeation chromatography.
[0061] like Figure 4 As shown in the figure, the infrared spectrum (FTIR) of the untreated polyglycolic acid plastic particles was analyzed, and the presence of some functional groups in the polyglycolic acid plastic particles can be determined, such as at 3300 cm -1 This is the characteristic peak of hydroxyl (OH), which is used to confirm the presence of hydroxyl in polyglycolic acid plastic particles; 1750 cm -1This is the characteristic peak of carbonyl (C=O), indicating the presence of carbonyl in polyglycolic acid plastic particles; 1400 cm -1 This is the bending vibration peak of methylene (CH2); 1150cm -1 This is the stretching vibration peak of COC, indicating the presence of ether bonds in polyglycolic acid plastic particles. Polyglycolic acid plastic particles treated with Stenotrophomonasmaltophilia strain B51 have a peak at 3000 cm -1 The absorption peak at 1750 cm-1 is not much different from that of the untreated plastic particles and the ultrapure water-treated plastic particles of Stenotrophomonas maltophilia strain B51, while the absorption peak of the polyglycolic acid plastic particles at 1750 cm-1 is not much different from that of the untreated plastic particles and the ultrapure water-treated plastic particles. -1 The carbonyl absorption peak around 1150cm -1 The COC stretching vibration peaks also changed, reflecting changes in the molecular structure of the polyglycolic acid plastic particles. Water molecules penetrated the amorphous regions of the polymer matrix, breaking ester bonds and causing the polymer chains to break into oligomers and monomers. Under the further action of Stenotrophomonas maltophilia strain B51, glycolic acid was further decomposed into small molecules. Compared with polyglycolic acid plastic particles not treated with Stenotrophomonas maltophilia strain B51, the absorption peak of polyglycolic acid plastic particles treated with Stenotrophomonas maltophilia strain B51 was significantly weakened. The weakening effect of the absorption peak was even more significant when treated with Stenotrophomonas maltophilia strain B51 than when treated with ultrapure water. This indicates that the degradation effect of Stenotrophomonas maltophilia strain B51 on polyglycolic acid plastic particles within 14 days was more significant than that of ultrapure water.
[0062] like Figure 5As shown in the figure, X-ray diffractometer analysis revealed that the crystallinity of polyglycolic acid (PGA) plastic particles treated with Stenotrophomonas maltophilia strain B51 decreased significantly compared to those not treated. During degradation by Stenotrophomonas maltophilia strain B51, enzymes secreted by Stenotrophomonas maltophilia strain B51 primarily attack the amorphous regions of the PGA plastic particles, resulting in a decrease in the proportion of crystalline regions. During hydrolysis, ester bonds break down, disrupting the polymer chains and affecting the crystallinity of the PGA plastic particles. During hydrolysis, the crystallinity of the PGA plastic particles initially increases and then decreases. This is because water molecules attack the links in the polymer backbone, disrupting the amorphous regions and causing a temporary increase in crystallinity. These processes work together to reduce the crystallinity of polyglycolic acid plastic particles, indicating that the polyglycolic acid plastic particles treated with Stenotrophomonas maltophilia strain B51 have undergone significant degradation, which shows that Stenotrophomonas maltophilia strain B51 has the ability to degrade polyglycolic acid plastic particles.
[0063] The above description of the embodiments is intended to facilitate understanding and use of the invention by those skilled in the art. It will be apparent that those skilled in the art can readily make various modifications to these embodiments and apply the general principles described herein to other embodiments without requiring inventive effort. Therefore, the present invention is not limited to the above-described embodiments. Improvements and modifications made by those skilled in the art based on the disclosure of the present invention, without departing from the scope of the present invention, should be within the scope of protection of the present invention.
Claims
1. A strain of Stenotrophomonas maltophilia that degrades polyglycolic acid plastic, characterized in that: The Stenotrophomonas maltophilia is Stenotrophomonas maltophilia strain B51, and its preservation number is CGMCC No.34495.
2. The Stenotrophomonas maltophilia according to claim 1, characterized in that The inoculation amount of Stenotrophomonas maltophilia strain B51 was 5% and the degradation rate of polyglycolic acid plastic particles reached 17.22% in 14 days, making the infrared spectrum of polyglycolic acid plastic particles at 1750 cm -1 and 1150cm -1 The absorption peak at the position weakened, X-ray diffraction showed that the crystallinity of the polyglycolic acid plastic particles decreased, and scanning electron microscopy showed that the polyglycolic acid plastic particles changed from a smooth surface to a morphology of pits, pores, and cracks.
3. A Stenotrophomonas maltophilia preparation for degrading polyglycolic acid plastics, characterized in that: The method comprises the bacterial cells of Stenotrophomonas maltophilia strain B51 according to claim 1 or 2.
4. The Stenotrophomonas maltophilia preparation according to claim 3, characterized in that The Stenotrophomonas maltophilia preparation for degrading polyglycolic acid plastic is a liquid preparation or a solid powder preparation.
5. The Stenotrophomonas maltophilia preparation according to claim 4, characterized in that When the Stenotrophomonas maltophilia preparation for degrading polyglycolic acid plastic is a liquid preparation, the concentration of the Stenotrophomonas maltophilia strain B51 is: OD 600 >0.2; When the Stenotrophomonas maltophilia preparation for degrading polyglycolic acid plastic is a solid powder preparation, the content of the Stenotrophomonas maltophilia strain B51 is: (0.05-0.15) mg / mL.
6. A use of the Stenotrophomonas maltophilia according to claim 1 or 2 in degrading plastics, wherein the method for degrading plastics using the Stenotrophomonas maltophilia strain B51 comprises adding Stenotrophomonas maltophilia strain B51 to a degradation medium containing polyglycolic acid plastic as the sole carbon source to degrade the polyglycolic acid plastic.
7. The use according to claim 6, characterized in that The Stenotrophomonas maltophilia strain B51 is first enriched and cultured, comprising the following steps: A single colony of Stenotrophomonas maltophilia strain B51 was picked and placed in LB liquid medium, and cultured at 37° C. and 180 rpm with shaking until the logarithmic phase to obtain a seed solution of Stenotrophomonas maltophilia strain B51.
8. The use according to claim 7, characterized in that The added amount of the Stenotrophomonas maltophilia strain B51 seed liquid is 5% of the volume of the degradation culture medium.
9. The use according to claim 6, characterized in that The degradation medium contains the following components: KH2PO4 0.6 g / L, Na2HPO4 0.5 g / L, NH4Cl 2.0 g / L, KCl 1.0 g / L, MgSO4 0.5 g / L, FeSO4 7H2O 6 mg / L, ZnSO4 7H2O 6 mg / L, CaCl2 7.5 mg / L, and water.
10. The use according to claim 6, characterized in that The temperature for the degradation treatment of the polyglycolic acid plastic is 37° C. and the time is at least 48 hours.
Citation Information
Patent Citations
Plastic degrading enzyme and application thereof
CN118360268A