Curcuma wenyujin-sourced multifunctional sesquiterpene synthase as well as coding gene and application thereof

By cloning the Curcuma sesquiterpene synthase gene CwTPS5 and expressing it in yeast and Escherichia coli, the problems of high production cost and supply shortage of Curcuma sesquiterpene active ingredients were solved, and the efficient production of various sesquiterpene compounds was achieved.

CN120665847APending Publication Date: 2025-09-19HANGZHOU NORMAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510507203.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-22
Publication Date
2025-09-19

AI Technical Summary

Technical Problem

The production cost of sesquiterpenoid compounds, the active ingredient of Curcuma aromatica medicinal materials, is high, the conversion efficiency is low, and long-term asexual reproduction leads to germplasm degeneration, which cannot meet the needs of clinical use and industrial production, and the market is in short supply.

Method used

The sesquiterpene synthase gene CwTPS5 was cloned from Curcuma zedoaria and expressed in yeast and Escherichia coli. The MVA or MEP pathway in the host was used to catalyze farnesyl pyrophosphate (FPP) to produce various sesquiterpene products. The catalytic performance of the enzyme was optimized by site-directed mutagenesis.

Benefits of technology

The efficient production of various sesquiterpenoid compounds in microbial cell factories was achieved, the production ratio of specific products was increased, and a sustainable production solution for the active ingredients of Curcuma zedoaria was provided.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120665847A_ABST
    Figure CN120665847A_ABST
Patent Text Reader

Abstract

The invention discloses a curcuma wenyujin-sourced multifunctional sesquiterpene synthase as well as a coding gene and application thereof, and belongs to the technical field of bioengineering. A novel sesquiterpene synthase gene CwTPS5 is cloned from curcuma wenyujin, the sesquiterpene synthase gene codes a multifunctional sesquiterpene synthase, the amino acid sequence of the sesquiterpene synthase gene CwTPS5 is as shown in SEQ ID NO.2, and the sesquiterpene synthase gene CwTPS5 can catalyze farnesyl pyrophosphate (FPP) to generate various sesquiterpene products. The proportion of hydroxylated products generated by FPP catalyzed by mutants L295A and C404A obtained by site-specific mutagenesis of sesquiterpene synthase is remarkably increased, and the proportion of gemene A generated by FPP catalyzed by mutants R456A and R456E is remarkably increased. The sesquiterpene synthase provided by the invention has a good application prospect in catalyzing FPP to produce a natural product sesquiterpene.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of bioengineering, and in particular to a multifunctional sesquiterpene synthase derived from Curcuma zedoariae, a coding gene thereof and an application thereof. Background Art

[0002] Wen Yujin ( Curcuma wenyujin YH Chen et C. Ling (YH Chen et C. Ling) is a perennial herbaceous plant of the genus Curcuma in the Zingiberaceae family and is a traditional Chinese medicinal material. A single plant, Curcuma wenyujin (Wen Yujin), can be processed into three types of decoction slices. The cleaned rhizome, steamed, and then sun-dried, is the traditional Chinese medicine Curcuma wenyujin (Wen Yujin), which has the effects of promoting blood circulation and relieving pain, promoting qi and relieving depression, and promoting bile secretion and relieving jaundice. The cleaned rhizome, sliced ​​lengthwise into thin slices, and then sun-dried directly, is the traditional Chinese medicine Curcuma wenyujin (Wen Curcuma wenyujin), which has the effects of promoting blood circulation and qi, promoting menstruation and relieving pain. The cleaned rhizome, removed of its fibrous roots and rough bark, steamed, and then sun-dried, is the traditional Chinese medicine Curcuma wenyuzhu (Wen Curcuma wenyuzhu), which has the effects of promoting blood circulation and qi, eliminating accumulation and relieving pain. The volatile oil from Curcuma wenyuzhu is also used medicinally. The finished product, Curcuma wenyuzhu oil, is effective in treating colds, cholera, vomiting and diarrhea, and other ailments.

[0003] Because Curcuma longa has significant pharmacological activities, many studies have focused on the isolation of its active ingredients. It has been found that sesquiterpenes and curcumin are the main active ingredients of Curcuma longa (Liu Mei et al. Research progress on the chemical composition and pharmacological effects of Curcuma longa [J]. Modern Drugs and Clinics, 2021, 36(01): 204-208.). These biologically active sesquiterpenoids are commonly found in the volatile oil of Curcuma longa and have shown multiple pharmacological activities such as anti-tumor, anti-inflammatory, antipyretic and analgesic.

[0004] Due to the high cost of chemical synthesis, low conversion efficiency, many by-products and easy pollution, it does not conform to the current concept of green production. At present, the development of the active ingredients of Curcuma wenyujin is mainly based on extraction. However, Curcuma wenyujin mainly reproduces by rhizomes. Long-term asexual reproduction has caused it to become viral and the germplasm has seriously degenerated. In recent years, most of the seeds used for production of Curcuma wenyujin are already degenerated seed stems, which has led to a decrease in the content of active ingredients such as volatile oils. In addition, due to the huge clinical and industrial production amounts of Curcuma wenyujin, there has been a situation of supply exceeding demand in the market. This has also led to the continuous increase in the production cost of Curcuma wenyujin series products, which has hindered the clinical application and sustainable development of Curcuma wenyujin related medicinal materials.

[0005] In recent years, many successful cases of natural product biosynthesis have shown that engineering microbial cell factories will be a promising alternative for producing these high-value natural products (FU X, et al . High-Level PatchoulolBiosynthesis in Artemisia annua L.[J]. Frontiers in Bioengineering andBiotechnology , 2021, 8.; SMITH AB, CHEKAN J R. Engineering yeast for industrial-level production of the antimalarial drug artemisinin [J]. Trends in Biotechnology , 2023, 41(3): 267-269). Therefore, it is of great significance to reveal the molecular mechanism of sesquiterpene synthase forming sesquiterpene skeleton and the biosynthesis of sesquiterpene in Curcuma zedoaria. Summary of the Invention

[0006] The purpose of the present invention is to clone the coding gene involved in the biosynthesis of sesquiterpenes from Curcuma zedoariae and produce sesquiterpenoid natural products by using microbial cell factories.

[0007] To achieve the above object, the present invention adopts the following technical solutions: The present invention successfully cloned a new sesquiterpene synthase gene from Curcuma wenyujin, and its open reading frame sequence is shown in SEQ ID NO.1. The amino acid sequence of the protein encoded by this gene is shown in SEQ ID NO.2, which is named Cw TPS5. The coding gene was constructed into an engineered strain of Saccharomyces cerevisiae to express sesquiterpene synthase, and the substrates accumulated by the MVA pathway or MEP pathway in the host were used to perform in vivo catalytic reactions. The product function was identified by GC-MS, and the results showed that in Saccharomyces cerevisiae, Cw TPS5 is a multifunctional sesquiterpene synthase that catalyzes farnesyl pyrophosphate (FPP) to produce 17 sesquiterpene products with at least five skeleton types. To eliminate the influence of the acidic environment in Saccharomyces cerevisiae cells and further characterize the function of sesquiterpene synthase, we selected Escherichia coli with a neutral intracellular pH as a heterologous host for in vivo functional verification. The results showed that Cw The fermentation products of TPS5 in E. coli are basically consistent with those detected in Saccharomyces cerevisiae. In order to exclude the influence of the intracellular environment on the function of sesquiterpene synthase, we expressed Cw The purified TPS5 recombinant protein was mixed with the substrate FPP for in vitro enzymatic assays. The results were similar to the in vivo functional validation results, showing that it could catalyze FPP to produce a variety of sesquiterpenoid products.

[0008] Therefore, the present invention provides a sesquiterpene synthase, the amino acid sequence of which is shown in SEQ ID NO. 2. Among the sesquiterpene products produced by catalyzing farnesyl pyrophosphate (FPP) by the sesquiterpene synthase, α-serene and β-serene are the main products.

[0009] The present invention conducts site-directed mutagenesis on the sesquiterpene synthase, i.e., mutates the leucine (L) at position 295 of the amino acid sequence shown in SEQ ID NO. 2 to alanine (A), thereby obtaining a mutant L295A, the amino acid sequence of which is shown in SEQ ID NO. 3. The mutant catalyzes the conversion of the main sesquiterpene product produced by FPP from olefins to hydroxylated compounds neointermedeol and selin-6-en-4α-ol.

[0010] The present invention mutates the cysteine ​​(C) at position 404 of the amino acid sequence shown in SEQ ID NO. 2 to alanine (A) to obtain a mutant C404A, whose amino acid sequence is shown in SEQ ID NO. 4. The mutant C404A catalyzes the production of hydroxylated products such as monohydroxysesquiterpenes hedycaryol and γ-eudesmol, which significantly increases the proportion of hydroxylated products such as monohydroxysesquiterpenes hedycaryol and γ-eudesmol.

[0011] The present invention mutates the arginine (R) at position 456 of the amino acid sequence shown in SEQ ID NO. 2 to alanine (A), obtaining mutant R456A, whose amino acid sequence is shown in SEQ ID NO. 5. The main product of this mutant is germane A instead of serene. The arginine (R) at position 456 of the amino acid sequence shown in SEQ ID NO. 2 is mutated to glutamic acid (E), obtaining mutant R456E, whose amino acid sequence is shown in SEQ ID NO. 6. The proportion of germane A in the product is further increased.

[0012] Conservative substitutions at other amino acid positions of the sesquiterpene synthase, additions or deletions of one or several amino acids, amino-terminal truncation, and carboxyl-terminal truncation mutants are also included in the scope of the present invention.

[0013] The present invention also provides a gene encoding the sesquiterpene synthase. Specifically, the nucleotide sequence of the gene encoding the sesquiterpene synthase having the amino acid sequence shown in SEQ ID NO. 2 is shown in SEQ ID NO. 1. The mutant encoding gene sequence can be directly synthesized artificially, or site-directed mutagenesis primers can be designed and PCR amplified using a plasmid carrying the encoding gene having the nucleotide sequence shown in SEQ ID NO. 1 as a template. The primers are then used to introduce point mutations to obtain a mutant encoding gene with site-directed mutagenesis.

[0014] The present invention also provides a recombinant plasmid comprising the sesquiterpene synthase encoding gene. Preferably, the original vector of the recombinant plasmid is a pESC vector or a pMAL vector.

[0015] The present invention also provides a recombinant genetically engineered bacterium comprising the recombinant plasmid. The recombinant plasmid is transformed into a host cell to obtain the recombinant genetically engineered bacterium. The host cell can be any conventional host cell in the art. Preferably, the host bacterium is yeast or Escherichia coli.

[0016] The present invention can utilize recombinant genetically engineered bacteria to overexpress and produce sesquiterpene synthase; and can also construct genetically engineered bacteria having a sesquiterpene biosynthesis metabolic pathway to produce sesquiterpene through in vivo metabolism.

[0017] Another object of the present invention is to provide the use of the sesquiterpene synthase in catalyzing farnesyl pyrophosphate to produce sesquiterpene. The sesquiterpene is a terpene compound containing 15 carbon atoms in the molecule and having three isoprene units in the molecular structure.

[0018] As a specific embodiment of the present invention, the application includes: using wet bacteria obtained by centrifugation after fermentation and culture of an engineered bacterium containing the gene encoding the sesquiterpene synthase, wet bacteria immobilized cells, enzyme extracted after ultrasonic disruption of wet bacteria, or immobilized enzyme as a catalyst, using farnesyl pyrophosphate as a substrate, and a buffer solution with a pH of 6-8 as a reaction medium, reacting at 25-30°C and 100-150 rpm, and after the reaction is completed, separating and purifying the reaction liquid to obtain sesquiterpene.

[0019] The present invention uses biosynthesized sesquiterpene synthase as a catalyst to catalyze farnesyl pyrophosphate in vitro to produce sesquiterpene. The sesquiterpene synthase can be used in the form of whole cells of an engineered bacterium, in the form of an unpurified crude enzyme, or in the form of a partially purified or completely purified enzyme. The sesquiterpene synthase can also be prepared into a biocatalyst in the form of an immobilized enzyme or immobilized cells using immobilization techniques known in the art.

[0020] As another specific embodiment of the present invention, the application includes: cloning the coding gene of the sesquiterpene synthase into an expression vector to construct a recombinant plasmid, then transforming the recombinant plasmid into a host bacterium with an MVA pathway or an MEP pathway to construct a recombinant genetically engineered bacterium, performing fermentation culture, and isolating and purifying the fermentation product to obtain sesquiterpene.

[0021] Host bacteria with the MVA or MEP pathway are capable of synthesizing the five-carbon building block isopentenyl pyrophosphate (IPP) and its isomer dimethylallyl pyrophosphate (DMAPP). In plants, IPP and DMAPP are synthesized via the 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway in plastids or the mevalonate (MVA) pathway in the cytoplasm. IPP and DMAPP are catalyzed by farnesyl diphosphate synthases (FPPs) through the sequential condensation of two IPP molecules with one DMAPP molecule to produce farnesyl pyrophosphate (FPP), a C15 backbone. FPP is then specifically recognized and catalyzed by sesquiterpene synthases (Ses-TPSs), leading to the formation of diverse sesquiterpene nuclei (such as germarane and eudesmane) through multi-step cyclization, rearrangement, or cleavage reactions.

[0022] The present invention utilizes microorganisms that inherently possess the MVA pathway or the MEP pathway as host cells. Alternatively, the MVA pathway or the MEP pathway can be artificially introduced into the microorganism to construct the recombinant genetically engineered bacteria. Yeast possesses a complete MVA pathway, while E. coli possesses an incomplete MEP pathway. These pathways can be enhanced by overexpressing heterologous enzymes. Therefore, yeast and E. coli are both ideal host cells for heterologous sesquiterpenoid synthesis.

[0023] Preferably, the host bacteria is Escherichia coli or Saccharomyces cerevisiae containing the plasmid pBbA5c-MevT-MBIS. Further preferably, the Saccharomyces cerevisiae is Saccharomyces cerevisiae FY94.

[0024] The present invention has the following beneficial effects: The present invention cloned a new sesquiterpene synthase gene from Curcuma zedoariae CwTPS5 The enzyme encodes a multifunctional sesquiterpene synthase capable of catalyzing farnesyl pyrophosphate (FPP) to produce a variety of sesquiterpene products. Mutants L295A and C404A, obtained by site-directed mutagenesis of the sesquiterpene synthase, significantly increased the proportion of hydroxylated products produced by FPP, while mutants R456A and R456E significantly increased the proportion of germarene A produced by FPP. The sesquiterpene synthase provided by the present invention has promising application prospects in catalyzing FPP to produce natural sesquiterpene products. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 for Cw GC-MS detection results of TPS5 fermentation products in Saccharomyces cerevisiae.

[0026] Figure 2 for Cw Comparison results of mass spectra of fermentation products of TPS5 Saccharomyces cerevisiae with those of NIST library standards.

[0027] Figure 3 for Cw Functional verification of TPS5 in Escherichia coli by GC-MS analysis.

[0028] Figure 4 for Cw SDS-PAGE image of TPS5 protease, where lane M: SDS-PAGE protein marker; lane 1: precipitate after cell wall disruption of whole pMAL-his cells; lane 2: supernatant after cell wall disruption of whole pMAL-his cells; lane 3: precipitate after cell wall disruption of pMAL-his-CwTPS5 cells; lane 4: supernatant after cell wall disruption of whole pMAL-his-CwTPS5 cells; lane 5: flow-through (FT); lane 6: normal buffer; lane 7: washing of impurities with 10 mM imidazole; lane 8: elution of target protein with 250 mM imidazole; lane 9: normal buffer.

[0029] Figure 5 for Cw GC-MS detection results for the in vitro enzymatic function verification of TPS5.

[0030] Figure 6 for Cw Molecular docking and site-directed mutagenesis studies of TPS5, where A is Cw Molecular docking of TPS5 with its substrate FPP. The labeled amino acids represent key residues in the active pocket. B shows quantitative analysis of mutant products generated by site-directed mutagenesis of amino acids adjacent to the active pocket. Data are mean ± SD, n = 4. C shows GC-MS analysis of mutant amino acid residues near the active pocket.

[0031] Figure 7 for Cw Molecular docking and site-directed mutagenesis of amino acid residues at the G1-G2 helical junction of TPS5, where A is the GC-MS analysis of mutant products of the G1-G2 helical junction residues; B is Cw TPS5 and mutants Cw TPS5 S402P Docking with FPP; C is Cw TPS5 and mutants Cw TPS5 G403T Docking with FPP; D is Cw TPS5 and mutants Cw TPS5 C404A Docking with FPP. Cw Mg on the active site of TPS5 2+ Ions are represented by blue or green spheres, FPPs are represented by green sticks, and PPi are represented by red sticks. Cw TPS5 S402PProteins are represented by blue and gray bands. Cw The TPS5G403T is indicated by yellow and gray bands. Cw TPS5 C404A Indicated by blue and gray bands. DETAILED DESCRIPTION

[0032] The present invention will be further described below in conjunction with specific examples. The following examples are only used to illustrate the present invention and are not intended to limit the scope of application of the present invention. Without departing from the spirit and essence of the present invention, modifications or replacements made to the inventive method, steps or conditions all fall within the scope of the present invention.

[0033] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; the materials and reagents used are commercially available reagents and materials unless otherwise specified.

[0034] LB medium recipe: 1 g yeast extract, 2 g tryptone, 2 g sodium chloride, and make up to 200 mL with ddH2O. Prepare fixed medium by adding 4 g agar. Sterilize at 121°C and autoclave for 20 min.

[0035] TB medium formula: 24 g yeast extract, 12 g tryptone, 4 g glycerol, 2.3 g KH2PO4, 10.6 g K2HPO4, 4 g anhydrous glucose, and make up to 200 mL with ddH2O. Sterilize at 121°C and autoclave for 20 min.

[0036] Synthetic Dropout Medium (SD) formulation: 1.6 g SD-His-Trp, 2 g anhydrous glucose (for activation), 2 g galactose (for fermentation), 4 g agar (for solid culture), and ddH2O to make up to 200 mL. Adjust the pH to 5.8-6.0 and sterilize by autoclaving at 115°C for 15 min.

[0037] The nucleotide sequence is from 5' to 3' from left to right.

[0038] Example 1: Gene cloning 1. Acquisition of Curcuma wenyujin cDNA The plants of Curcuma zedoaria were collected from Shazhou Village, Taoshan Town, Ruian City, Wenzhou, the authentic production area of ​​Curcuma zedoaria, and their flowers, leaves and tubers were preserved separately.

[0039] The RNA of Curcuma australis leaves induced by methyl jasmonate was extracted using the plant total RNA extraction kit from Nanjing Novozymes, and reverse transcribed using the PrimeScript RT reagent Kit with gDNA Eraser to obtain cDNA.

[0040] 2. CwTPS5 ORF amplification Full-length cloning was performed using cDNA as a template using primers TPS5-F: GGGACAAATCTCAATTAAGATGG and TPS5-R: GGAGTCATACTCTTATATGGGAAG.

[0041] PCR system: forward primer F 2 μL, reverse primer R 2 μL, 2×Phanta Max Master Mix 25 μL, template cDNA 100 ng, ddH2O to 50 μL.

[0042] PCR reaction conditions: initial denaturation at 95°C for 3 min; 35 cycles of 95°C for 15 s, 58°C for 15 s, and 72°C for 1 min 30 s; and 72°C for 5 min.

[0043] 3. PCR product purification and recovery The PCR products obtained above were detected by agarose gel electrophoresis, and a DNA band of about 1650 bp was cut out and recovered and purified according to the instructions of the Nanjing Novozymes FastPureGelDNA Extraction Mini Kit, and the concentration of the recovered DNA was measured.

[0044] 4. CwTPS5 Cloning vector construction and transformation According to the instructions of the pEASY-Blunt-Zero Cloning Vector Kit, 1 μL of pEASY-Blunt-Zero vector was taken, and 4 μL CwTPS5 Purify the DNA fragments, mix well, and ligate at 25°C for 20 min.

[0045] Transform the ligation product into Trans-T1 cloning competent cells according to the instructions of the All-Gold Trans-T1 Cloning Competent Cell Transformation Kit. Apply LB solid medium containing 50 mg / L Kan and incubate at 37°C for 10-14 hours. Once a single colony has grown on the plate, perform PCR on the bacterial suspension using All-Gold 2× TransFastTaq PCR SuperMix.

[0046] PCR system: forward primer F 0.8 μL, reverse primer R 0.8 μL, 2×TransFast Taq PCRSuperMix 10 μL, bacterial solution 1 μL, and ddH2O to 20 μL.

[0047] PCR reaction conditions: initial denaturation at 94°C for 3 min; 35 cycles of 94°C for 5 s, 58°C for 15 s, and 72°C for 1 min; and 72°C for 5 min.

[0048] The PCR product is tested by agarose gel electrophoresis. If the target band appears, the corresponding bacterial culture is sent to a sequencing company for sequencing. If the sequencing result aligns correctly with the expected sequence, the gene is successfully cloned. CwTPS5 The nucleotide sequence of the gene ORF is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2.

[0049] will contain CwTPS 5 full-length sequences of the strains were maintained, and the plasmid was extracted and named pEASY- Cw TPS5, spare.

[0050] Example 2: Cw Construction of TPS5 eukaryotic expression vector 1. Enzyme digestion of eukaryotic expression vector Will CwTPS5 The ORF was constructed into the yeast eukaryotic expression vector pESC-Trp, and BamHI was selected as the restriction site.

[0051] Enzyme digestion system: vector plasmid 1000 ng, BamHI 3 μL, 10× Fast Digest buffer 5 μL, ddH2O to 50 μL.

[0052] Reaction conditions: 37 °C, 2 h.

[0053] 2. CwTPS5 PCR amplification The pEASY- Cw TPS5 was used as a template, and primers with 15-20 bp homologous sequences near the BamHI site of the pESC-Trp vector were used to amplify the insert fragment by PCR. The PCR system and conditions were the same as those in Example 1. The primer sequences are as follows: Trp-TPS5-F: TCAAGGAGAAAAAAACCCCGATGGAGAAGCAATCACTAGCTCTT; Trp-TPS5-R: TAGTGAGTCGTATTACGTTATATGGGAAGAGGTTCAATC.

[0054] 3. Recovery and purification of linearized vector and target DNA fragment The digested vector and PCR product were subjected to 1.5% agarose gel electrophoresis, and the bands of approximately 7800 bp and 1650 bp were cut out, respectively. The target fragments were recovered using the Nanjing Novozymes FastPure Gel DNA Extraction Mini Kit, and the concentration of the recovered DNA was measured and set aside.

[0055] 4. Seamless cloning The purified vector and CwTPS5 The gene fragments were mixed at a molar ratio of 1:3 and homologous recombination reaction was performed using the Beyotime Seamless Cloning Kit.

[0056] Homologous recombination reaction system: linearized vector pESC-Trp 100 ng, CwTPS5 300 ng of gene fragment, 25 μL of 2×Phanta Max Master Mix, and ddH2O to make up to 50 μL.

[0057] Reaction conditions: 50℃, 30 min.

[0058] After the reaction is complete, transform the reaction mixture into Trans1-T1 cloning competent cells, apply LB solid medium containing 100 mg / L Amp, and incubate for 10-14 hours. Once a single clone has grown, verify the clone by PCR. Submit the clone containing the target band to a sequencing company for sequencing. If the sequence is confirmed to be correctly connected, save the glycerol stock and extract the recombinant plasmid.

[0059] Example 3: Cw Construction of TPS5 prokaryotic expression vector 1. Enzyme digestion of prokaryotic expression vector Will CwTPS5 The ORF was constructed into the prokaryotic expression vector pMAL-his, and BamH I was selected as the restriction site.

[0060] System: vector plasmid 1000 ng, BamHI 3 μL, 10× Fast Digest buffer 5 μL, ddH2O to 50 μL.

[0061] Reaction conditions: 37 °C, 2 h.

[0062] 2. CwTPS5 PCR amplification Using pEASY-CwTPS5 obtained in Example 1 as a template, primers with 15-20 bp of homologous sequence near the BamHI site of the pMAL-his vector were used to amplify the insert. The PCR system and conditions were the same as in Example 1, and the primer sequences were as follows: his-TPS5-F:GAAGGATTTCAGAATTCACGATGGAGAAGCAATCACTAGCTCTT; his-TPS5-R:GGTGGTGGTGGTGGTGCAGTATGGGAAGAGGTTCAATCAACA.

[0063] 3. Recovery and purification of linearized vector and target DNA fragment Same as Example 2.

[0064] 4. Seamless cloning The purified vector and CwTPS5 The gene fragments were mixed at a molar ratio of 1:3 and homologous recombination reaction was performed using the Beyotime Seamless Cloning Kit.

[0065] System: linearized vector pMAL-his 100 ng, CwTPS5 300 ng, 2×Phanta Max Master Mix 25 μL, and ddH2O to make up to 50 μL.

[0066] Reaction conditions: 50℃, 30 min.

[0067] After the reaction is complete, transform the reaction mixture into Trans-T1 cloning competent cells, apply LB solid medium containing 100 mg / L Amp, and incubate for 10-14 hours. Once a single clone has grown, verify the clone by PCR. Submit the clone containing the target band to a sequencing company for sequencing. If the sequence is confirmed to be correctly connected, save the glycerol stock and extract the recombinant plasmid.

[0068] Example 4: Cw Functional identification of TPS5 in yeast 1. Preparation of yeast competent cells and transformation of eukaryotic expression vectors The terpene pathway of Saccharomyces cerevisiae FY94 was selected (see reference HU Y, et al . Screening and modification of (+)-germacrene A synthase for the production of the anti-tumor drug (−)-β-elemene in engineered Saccharomyces cerevisiae[J]. International Journal of Biological Macromolecules, 2024, 279: 1354-55.) was used as the host cell. Yeast competent cells were prepared according to the Zymo Frozen-EZ Yeast Transformation II Kit™ instructions. The recombinant plasmid constructed in Example 2 was transformed into FY94 competent cells. The cells were plated on SD-His-Trp solid medium and incubated at 30°C for 2-3 days. Once a single colony emerged, colony PCR was performed using a high-fidelity PCR polymerase. Positive single colonies were activated using liquid medium, streaked onto SD-Trp solid medium, and stored as glycerol stocks.

[0069] 2. Fermentation of recombinant strains (1) Pick out the recombinant strain single clone and the empty vector transformed strain single clone and transfer them into 5 mL SD-His-Trp liquid medium, shake at 30°C, 200 rpm for 24 h until OD 600 About 5; (2) The bacterial solution in (1) was adjusted to the final concentration OD 600 =0.05 was diluted into 100 mL of SD-His-Trp liquid medium with glucose as the carbon source. After culturing for 2 days, the carbon source was changed to galactose and fermented at 30°C and 200 rpm for 2 days, with a total fermentation time of 4 days.

[0070] 3. Fermentation product extraction After induction, add an equal volume of n-hexane (analytical grade) and perform ultrasonic extraction three times for 20 minutes each. Collect the supernatant, dehydrate with anhydrous sodium sulfate, and transfer to a round-bottom flask for rotary evaporation in a water bath set at 42°C at 50 rpm. After rotary evaporation, reconstitute with 1.2 mL of n-hexane (chromatographic grade), filter through a 0.22 μm organic filter membrane, transfer to a liquid phase vial, and store sealed at 4°C until use.

[0071] 4. GC-MS detection GC / MS analysis was performed using a Dikma DM-200 column (30 m × 0.25 mm i.d. × 0.25 μm film) and an Agilent 8890-7000 GC / TQ gas chromatograph-tandem triple quadrupole mass spectrometer (Agilent, US, CA) equipped with a PAL RTC 120 autosampler (CTC). +Two masses of each analyte were monitored at 400 nm (70 eV), with a solvent delay time of 5 minutes. Splitless injection was used, with an injection volume of 1 μL and an aspirated air volume of 1 μL. The inlet temperature was 220°C, and helium carrier gas was used at a constant flow rate of 1 mL / min. The sample was scanned from 30 to 350 m / z. The temperature program consisted of an initial temperature of 80°C, followed by an increase at 10°C / min to 240°C, a hold for 2 minutes, and then an increase at 20°C / min to 260°C, where it was held for 2 minutes.

[0072] 5. Results Analysis In previous studies, we engineered a Saccharomyces cerevisiae strain that could produce high levels of the sesquiterpene precursor FPP and established a platform for rapid identification of sesquiterpene synthase gene functions. CwTPS5 The products were cloned into eukaryotic expression vectors and transformed into FY94 strains for fermentation and product analysis. GC-MS analysis showed that Cw TPS5 is a multifunctional sesquiterpene synthase that catalyzes FPP to produce at least 17 sesquiterpene compounds.

[0073] like Figure 1 As shown, compared with known standards or genes with characterized functions, Cw TPS5 produced nine identified products: germacrene A (1), germacrene B (2), β-caryophyllene (4), α-humulene (7), α-selinene (8), β-selinene (9), hedycaryol (10), γ-eudesmol (14), and cryptomeridiol (17). Among them, α-selinene (8) and β-selinene (9) were the major products.

[0074] like Figure 2 As shown in the figure, other products were preliminarily identified based on retention time and mass spectra, and they were predicted to be gemene D (3), γ-selinene (γ-selinene, 5), naphthalene (6), guaiol (guaiol, 11), agarospirol (agarospirol, 12), neointermedeol (13), pogostol (pogostol, 15), and selin-6-en-4α-ol (16).

[0075] Some of these products can undergo Cope rearrangement to form other products: gemmarene A (1), gemmarene B (2) and hedycaryol (10) can rearrange to form elemene-type compounds β-elemene (1'), γ-elemene (2') and elemenol (10'), respectively.

[0076] Example 5: Cw In vivo functional characterization of TPS5 in Escherichia coli Literature reports indicate that the catalytic activity of sesquiterpene synthases is affected by pH. Given the acidic intracellular environment of yeast, where some sesquiterpene compounds are easily converted to other compounds, we selected Escherichia coli, which has a neutral intracellular pH, as a heterologous host to further validate the function of CwTPS.

[0077] 1. Transformation of MM engineered bacteria pBbA5c-MevT-MBIS (abbreviated as MM) was constructed by Jay Keasling's group and shared from Addgen (www.addgene.org). Five μL of the pBbA5c-MevT-MBIS plasmid was transformed into 50 μL of BL21 Star (DE3) competent cells and cultured overnight at 37°C. Single colonies were then isolated and verified by PCR. Positive strains were designated MM engineered strains, which can synthesize FPP, a common precursor of sesquiterpenes.

[0078] 2. Preparation of MM competent cells (1) Strain activation: The MM engineered bacteria stored in a -80°C ultra-low temperature freezer were streaked onto LB solid medium containing chloramphenicol for activation and cultured at 37°C overnight; (2) Pick a single clone, add 5 mL of LB liquid medium containing chloramphenicol, and culture at 37°C with shaking at 200 rpm for 12 h; (3) Inoculate the culture medium into 10 mL of LB liquid medium containing 34 mg / L chloramphenicol at a ratio of 1:100 and culture at 37°C with shaking at 200 rpm for 3-4 hours to determine the OD value. 600 =0.4-0.6; (4) Place on ice for 30 min and transfer to a 15 mL centrifuge tube; (5) Centrifuge at 4000 rpm for 10 min at 4°C and discard the supernatant. (6) Add 8 mL of 0.1 M pre-chilled CaCl2, resuspend the cells, centrifuge at 4000 rpm for 10 min at 4°C, and discard the supernatant; (7) Add 400 μL of 0.05 M pre-chilled CaCl2 to resuspend the cells, then add 300 μL of pre-chilled 50% glycerol and mix thoroughly; (8) Aliquot the sample into 1.5 mL centrifuge tubes, 50 μL per tube, snap-freeze in liquid nitrogen, and store in a -80°C freezer.

[0079] 3. Conversion Verification The recombinant expression plasmid was transformed into MM competent cells: 3 μL of pMAL-his:: constructed in Example 3 was taken. Cw Add the TPS5 recombinant expression plasmid to 50 μL of MM competent cells. Transform the empty vector pMAL-his into these competent cells as a negative control. Pick a single colony and verify it by PCR. Store the resulting positive bacteria in a -80°C freezer.

[0080] 4. Fermentation of recombinant strains Positive single clones were selected and transferred to 5 mL of LB liquid medium containing 100 mg / L ampicillin and 34 mg / L chloramphenicol. The culture was shaken at 37°C and 200 rpm for 12 h for activation. The bacterial liquid was then inoculated into 100 mL of the same medium at a ratio of 1:100 and cultured at 37°C and 200 rpm until the OD 600 When the concentration reaches 0.6-0.8, 0.4 mM isopropyl β-D-thiogalactopyranoside (IPTG) is added and induced at 25°C for 16-20 h.

[0081] 5. Product extraction After induction, add an equal volume of n-hexane (analytical grade) and perform ultrasonic extraction three times for 20 minutes each. Collect the supernatant, dehydrate with anhydrous sodium sulfate, and transfer to a round-bottom flask for rotary evaporation in a water bath set at 42°C at 50 rpm. After rotary evaporation, reconstitute the solution with 1.2 mL of n-hexane (chromatographic grade), filter through a 0.22 μm organic filter membrane, transfer to a liquid phase vial, and store sealed at 4°C until use.

[0082] 6. GC-MS detection Same as Example 4.

[0083] 7. Results Analysis The results showed that the types and proportions of products produced by CwTPS5 in E. coli were basically consistent with the results of in vivo verification in yeast. Figure 3As shown in the results, 14 sesquiterpenes were detected in the fermentation extract: gemene A (1), β-caryophyllene (4), γ-serene (5), naphthalene (6), α-humulene (7), α-serene (8), α-serene (9), hedycaryol (10), guaiacol (11), linalool (12), neointermedeol (13), γ-eudesmol (14), patchouliol (15) and selin-6-en-4α-ol (16), among which α-serene (8) and β-serene (9) were still the main products. Other products were not detected because their yields were too low and below the detection limit of GC-MS.

[0084] Example 6: Cw In vitro functional validation of TPS5 The results of in vivo experiments showed that Cw TPS5 can produce a series of sesquiterpenoids with different skeleton structures. To avoid the influence of the in vivo environment on the enzyme function, we also verified its function through in vitro enzymatic reactions.

[0085] 1. Reagent preparation 1× SDS running buffer: Tris 3.02 g, glycine 18.8 g, SDS 1 g, and ddH2O to make up to 1 L.

[0086] Coomassie brilliant blue dye: Coomassie brilliant blue 0.25 g, methanol 45 mL, glacial acetic acid 10 mL, and ddH2O to 200 mL.

[0087] Decolorization solution: 100 mL of glacial acetic acid, 250 mL of anhydrous ethanol, and ddH2O to make up to 1 L.

[0088] Buffer required for protein purification: Lysis buffer: Tris-HCl (pH 8.0) 40 mM, imidazole 20 mM, NaCl 250 mM.

[0089] Normal buffer: Tris-HCl (pH 8.0) 20 mM, NaCl 250 mM.

[0090] Buffer A: Tris-HCl (pH 8.0) 20 mM, imidazole 10 mM, NaCl 250 mM.

[0091] Buffer B: Tris-HCl (pH 8.0) 20 mM, imidazole 250 mM, NaCl 250 mM.

[0092] Enzymatic buffer: HEPES 50 mM, MgCl2 10 mM, DTT 5 mM, glycerol (v / v) 5%, pH adjusted to 7.5.

[0093] 2. Construction of recombinant protein inducible expression strain 5 μL of the pMAL-his::CwTPS5 recombinant expression plasmid constructed in Example 3 was added to 50 μL of TransettaDE3 competent cells. Empty vector pMAL-his was transformed into these competent cells as a negative control. Single clones were selected and verified by PCR. Positive bacteria were stored in a -80°C freezer.

[0094] 3. Induction of recombinant protein Positive single clones were selected and transferred to 5 mL of LB liquid medium containing 100 mg / L ampicillin. The culture was shaken at 37°C and 200 rpm for 12 h for activation. The bacterial liquid was then inoculated into 100 mL of the same medium at a ratio of 1:100 and cultured at 37°C and 200 rpm until the OD 600 When the concentration reaches 0.6-0.8, add 0.5 mM IPTG and induce at 20℃ and 180 rpm for 16-20 h.

[0095] 4. Extraction and purification of recombinant protein (1) After induction, the cells were harvested by centrifugation, resuspended in lysis buffer, and then ultrasonically disrupted. The ultrasonic disruption conditions were: power 200 W, ultrasonication for 10 s, pause for 3 s, and continue for 5 min. Avoid the generation of foam during the ultrasonication process. (2) After disruption, centrifuge at 4°C, 9000 rpm for 45 min, and collect the supernatant and bacteria. 2+ Combine and shake in a shaker at 4°C for 2 h.

[0096] (3) Pre-equilibrate the nickel-nickel triacetate-NTA (Ni-NTA) column with three volumes of standard buffer. Transfer the protein supernatant to the Ni-NTA column and wash the impurities with buffer A. Elute the target protein with buffer B and collect all of it. Concentrate the eluted protein using an ultrafiltration tube.

[0097] 5. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (1) Prepare 7.5% PAGE gel using the YAZE rapid gel preparation kit; (2) Prepare liquid samples for washing impurities and eluting target proteins, as well as protein supernatants before and after disruption. Use frozen lysis buffer (dilute to the same level as the supernatant) to precipitate the bacteria before and after disruption. Take 8 μL of each supernatant and precipitate sample and mix them with 14 μL of frozen lysis buffer A and 10 μL of 10× Protein Loading Buffer, respectively. Boil the prepared spot sample in boiling water for 10 minutes and then centrifuge it instantaneously to prepare the loading sample. (3) Pour 1× SDS electrophoresis buffer into the electrophoresis tank, immerse the gel plate, remove the comb, take 5 μL of protein marker and spot it in the middle hole, then take 8 μL of sample and spot it in each gel hole; (4) The gel electrophoresis voltage condition is initially 80 V for 30 min. After all sample proteins have entered the separation gel layer, the voltage condition is adjusted to 120 V for 1 h. The instrument can be turned off when the bromophenol blue indicator reaches the appropriate position. (5) Carefully remove the protein gel from the gel plate, pour in an appropriate amount of Coomassie Brilliant Blue dye solution, place on a shaker for 40 minutes, then decolorize with a special decolorizing solution for 30 minutes, repeat twice, and decolorize overnight until the protein gel background is transparent and the bands are clear. The SDS-PAGE results are as follows Figure 4 shown.

[0098] 6. Enzymatic reaction The protein obtained in step 4 was dissolved in enzymatic buffer and the protein concentration was determined using the Beyotime BCA protein assay kit with bovine serum albumin (BSA) as the standard.

[0099] The purified protein supernatant was incubated with the substrates geranyl pyrophosphate (GPP), farnesyl diphosphate (FPP), and geranylgeranyl pyrophosphate (GGPP) at 30°C and 100 rpm for 12 h. After the reaction, the reaction mixture was extracted three times with an equal volume of n-hexane (chromatographic grade). The combined organic layers were concentrated to 200 μL using nitrogen, transferred to a liquid phase vial, and stored at 4°C.

[0100] 7. GC-MS detection Same as Example 4.

[0101] 8. Results Analysis Heterologous expression in Escherichia coli Cw The purified TPS5 recombinant protein was incubated with the substrates GPP, FPP and GGPP respectively for in vitro enzymatic reaction. Cw TPS5 can specifically catalyze FPP to produce a variety of sesquiterpene products.

[0102] like Figure 5 As shown, it is consistent with the in vivo verification results. Cw The products of TPS5 include gemene A (1), β-caryophyllene (4), γ-serene (5), naphthalene (6), α-humulene (7), α-serene (8), β-serene (9), hedycaryol (10), neointermedeol (13), patchouliol (15), and selin-6-en-4α-ol (16). α-serene (8) and β-serene (9) remain the major products. Other products were not detected, possibly due to their low yields.

[0103] Example 7: Curcuma sesquiterpene synthase Cw Study on the catalytic mechanism of TPS5 1. Molecular docking The structural model of CwTPS5 was generated using the SWISS-MODEL online tool (http: / / swissmodel.expasy.org). The model template is 5-epi-aristolochene synthase (SMTLID: 5ik9.1). The FPP small molecule conformation used for docking simulations was derived from energy minimization calculations using ChemBio3D Ultra 14.0. The resulting conformation was used to generate a PDB file for further analysis. Molecular docking was performed using AutodockVina. The receptor protein was processed by removing all bound water molecules and adding hydrogen atoms to the protein. The active site was defined as the amino acid residues within a sphere with a radius of 5 Å centered on the DDxxD cavity. The modeled structure of CwTPS5 and the generated FPP conformation were used as input for docking simulations. Finally, the docked complex was visualized and analyzed using PyMOL 4.4.

[0104] 2. Site-directed mutagenesis (1) Vector construction See Example 3.

[0105] (2) Site-directed mutagenesis The Fast Mutagenesis System site-directed mutagenesis kit (TransGene Biotech, Beijing, China) was used according to the manufacturer's instructions. CwTPS5 Site-directed mutagenesis was performed. The primers used for site-directed mutagenesis are shown in Table 1 and were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0106] Table 1. Primer sequences Primer Sequence (5ʹ-3ʹ) C404A-F GTTAATCTCCTCTGGGGCTTCTACAGTCA C404A-R GCCCCAGAGGAGATTAACGAACTATGCAA F513A-F TGAAAGAATAGTCAACGCCTCAAGATCAA F513A-R GCGTTGACTATTCTTTCAAAAATAGGTCG W274A-F TGTGGAAAGTTATTATGCGATTCTTACTG W274A-R GCATAATAACTTTCCACAACTCGGTCACG Y527A-F TAGGTACATTGATATGGCCACCAATTCTG Y527A-R GCCATATCAATGTACCTATATATTTCTTC R456A-F TGAGCTGGAGCAAGGGGCAGACCATACCG R456A-R GCCCCTTGCTCCAGCTCATGTGATCTTAT L295A-F GATTTGCTCCAAAGTGGCTTCTCTTCTAT L295A-R GCCACTTTGGAGCAAATCACTCGTGCACG L298A-F CAAAGTGCTTTCTCTTGCATCAATTACGG L298A-R GCAAGAGAAAGCACTTTGGAGCAAATCAC S402P-F TAGTTCGTTAATCTCCCCTGGGTGTTCT S402P-R GGGAGATTAACGAACTATGCAAGTGTTC G403T-F TTCGTTAATCTCCTCTACGTGTTCTACAG G403T-R GTAGAGGAGATTAACGAACTATGCAAGTG C404Y-F TTAATCTCCTCTGGGTATTCTACAGTCA C404Y-R TACCCAGAGGAGATTAACGAACTATGCA R456E-F TGAGCTGGAGCAAGGGGAAGACCATACCG R456E-R TCCCCTTGCTCCAGCTCATGTGATCTTAT Y527F-F AGGTACATTGATATGTTCACCAATTCTG Y527F-R AACATATCAATGTACCTATATATTTCTT Mutation PCR preparation system: forward primer F 2 μL, reverse primer R 2 μL, 2×TransStart FastPfuFly PCR 25 μL, pMAL-his::CwTPS5 plasmid template 100 ng, ddH2O to 50 μL.

[0107] The reaction conditions were as follows: 94°C for 5 min; 25 cycles of 94°C for 20 s, 56°C for 20 s, and 72°C for 5 min; and 72°C for 10 min.

[0108] After the reaction was completed, 0.5 μL of DMT enzyme was added to the above reaction system for digestion at 37°C for 1 h.

[0109] Transformation, bacterial solution PCR, sequencing, and bacterial maintenance were the same as in Example 3.

[0110] 3. Quantitative fermentation experiment The resulting CwTPS5 mutation-positive plasmid was transformed into E. coli BL21 Star-MM competent cells to increase FPP metabolic flux. The recombinant strain was cultured in 5 mL of LB medium containing 100 mg / L ampicillin at 37°C with shaking at 200 rpm overnight. The culture was then transferred to 20 mL of TB medium and cultured until the OD value reached 0. 600 The pH value reached 0.6-0.8. Protein expression was induced by adding 0.5 mM IPTG, and the culture was incubated at 20°C and 180 rpm for 48 h. Four biological replicates were performed for each strain.

[0111] 4. Product extraction After fermentation, an equal volume of n-hexane (analytical grade) was added, and the mixture was sonicated three times for 20 minutes each. The supernatant was collected, dehydrated over anhydrous sodium sulfate, transferred to a round-bottom flask, and rotary evaporated at 42°C and 50 rpm. The concentrated extract was resuspended in two equal portions in 1.6 mL of n-hexane (chromatographic grade), filtered through a 0.22 μm organic filter membrane, transferred to a liquid phase flask, and stored at 4°C.

[0112] 5. GC-MS detection The method was the same as that in Example 4. The characteristic fragment ion peaks of sesquiterpenes 161, 189, and 204 m / z were selected and the product was quantified using SIM mode.

[0113] 6. Qualitative testing For the standard samples β-elemene, β-caryophyllene, γ-eudesmol, and cedarwooddiol, samples were prepared at concentrations ranging from 25 mg / L to 50 mg / L. These samples were dissolved in chromatography-grade n-hexane, filtered through a 0.22 μm organic membrane, transferred to a liquid chromatography bottle, and stored at 4°C. For the positive control genes α-humulene (AB247331.1), α-serene (MF614112.1), β-serene (MF614112.1), and elemenol (XP_006354694), fermentation was performed according to step 3, and product extraction was performed as in step 4. GC-MS analysis was performed using the same batch of quantitative test samples.

[0114] 7. Standard curve determination Prepare a 500 mg / L stock solution of the standard: weigh 1 mg of the β-elemene standard and dissolve it in 2 mL of chromatographic-grade n-hexane. Then, gradient dilution with chromatographic-grade n-hexane to 12.5 mg / L, 6.25 mg / L, 0.5 mg / L, 0.1 mg / L, and 0.05 mg / L was performed. The solution was placed in a liquid chromatography vial for GC-MS analysis. Weigh 0.5 mg of the β-cineole standard and dissolve it in 5 mL of chromatographic-grade n-hexane to create a 100 mg / L stock solution. The solution was then gradient diluted with chromatographic-grade n-hexane to 5 mg / L, 0.5 mg / L, 0.1 mg / L, and 0.05 mg / L. The solution was placed in a liquid chromatography vial for GC-MS analysis.

[0115] 8. Experimental Results 8.1 Cw The influence of amino acids near the active pocket of TPS5 on its catalytic function Previous studies have shown that aromatic amino acids near the active pocket can stabilize carbocation intermediates. Based on this, we first studied the role of Trp274, Phe513, and Tyr527 located near the carbon chain of the FPP substrate ( Figure 6 A). First, we mutated the aforementioned amino acids to the less sterically hindered alanine (Ala, A), resulting in the mutants W274A, F513A, and Y527A. Qualitative and quantitative analysis of the mutant products revealed significantly reduced yields (Figure 6B, C), likely due to the crucial role of the π-electron cloud of the aromatic side chain in stabilizing the carbocation intermediate.

[0116] To further verify this hypothesis, we mutated Y527 to the structurally similar aromatic amino acid phenylalanine (Phe, F). The results showed that the product produced by the mutant Y527F was similar to that of the wild-type enzyme. These results further demonstrate the importance of aromatic amino acids in stabilizing reaction intermediates and promoting product synthesis. Figure 6 B, C).

[0117] Next, we also studied the role of aliphatic amino acids Leu295 and Leu298 ( Figure 6 B). The results showed that mutating these two amino acids to alanine resulted in a significant decrease in olefin production and an increase in terpene alcohol production ( Figure 6 B, C), in which the main product of the L295A mutant was converted from olefin to hydroxylated compounds neointermedeol (13) and selin-6-en-4α-ol (16) ( Figure 6 Based on the above results, it is speculated that the mutation of positions 295 and 298 to alanine, which has less steric hindrance, increases the volume of the active pocket, facilitating the entry of water molecules and thus forming more terpene alcohol products.

[0118] In addition, the positively charged arginine residue Arg456 is located near the pyrophosphate group of FPP, which may stabilize the electronegative pyrophosphate group and thus promote substrate cyclization ( Figure 6 A). To prove the above speculation, we first mutated Arg456 to neutral alanine. The results showed that the main product of the mutant changed from serene (8, 9) to germaene A (1) ( Figure 6 B, C). Subsequently, after it was mutated to negatively charged glutamic acid (Glu, E), the proportion of germene A (1) was further increased to 70.78% (Table 2). The above results indicate that the arginine located near the pyrophosphate group of the substrate FPP can stabilize the pyrophosphate group through electrostatic complementarity, while neutral or negatively charged amino acids will significantly reduce the affinity for binding to the substrate and reduce the efficiency of proton transfer of the carbon cation, making it more difficult for the germene cation to further cyclize, thereby increasing its deprotonation ratio and increasing the production of the product germene A (1).

[0119] 8.2 Cw Effects of amino acids near the TPS5 G helix on its catalytic function Furthermore, the highly conserved G1-G2 helical junction is a key catalytic region of terpene synthases, where the amino acids can significantly influence the type and abundance of products. In CwTPS5, three residues are located at the G helical junction: Ser402, Gly403, and Cys404. First, we substituted S402 with proline and found that the resulting mutant, S402P, failed to produce any product ( Figure 7 A), this may be because the introduction of the flexible amino acid proline changes the originally rigid α-helical structure into a flexible loop, destroying the stability of the local secondary structure of the G-helix ( Figure 7 B), resulting in enzyme inactivation.

[0120] Next, we replaced Gly403 with threonine ( Figure 7C). However, the mutant also lost the ability to produce sesquiterpene products ( Figure 7 A). This may be because the side chain of threonine is relatively large, causing steric hindrance and affecting the folding of the substrate FPP ( Figure 7 C). In addition, after C404 was replaced by alanine, the yield of sesquiterpenes in the mutant decreased significantly ( Figure 7 D), and the proportion of hydroxylated products increased significantly. For example, the yield of monohydroxy sesquiterpenoid hedycaryol (10) increased from 11.13% to 80.9% (Table 2), and the yield of γ-eudesmol (14) also increased compared with the control ( Figure 7 A). Previous studies have shown that the active reaction cavity of many terpenoid synthases contains water molecules, especially in the G-helix region close to the substrate, where free water molecules can interact with the substrate. Replacing cysteine ​​with a smaller alanine may cause the reaction cavity in the G-helix to become larger, making it more conducive for free water molecules to react with substrate intermediates, thereby leading to the formation of more hydroxylated products ( Figure 7 D).

[0121] In summary, the G-helix plays a vital role in protecting the substrate carbon cation intermediate from the influence of external solvents. Changes in the G-helix structure may affect the stability of the reaction intermediate, thereby leading to changes in enzyme function or complete inactivation.

[0122] Table 2. Cw Yield and product ratio of strains expressing TPS5 mutant vectors Note: Germaene A (1) and hedycaryol (10) can rearrange to form β-elemene (1') and elemenol (10'), respectively.

Claims

1. A sesquiterpene synthase, characterized in that The amino acid sequence of the sesquiterpene synthase is shown in any one of SEQ ID NO. 2 to SEQ ID NO.

6.

2. A gene encoding the sesquiterpene synthase according to claim 1.

3. A recombinant plasmid comprising the coding gene according to claim 2.

4. The recombinant plasmid according to claim 3, wherein The original vector of the recombinant plasmid is a pESC vector or a pMAL vector.

5. A recombinant genetically engineered bacterium comprising the recombinant plasmid according to claim 3 or 4.

6. The recombinant genetically engineered bacterium according to claim 5, wherein The host bacteria of the recombinant genetically engineered bacteria are yeast or Escherichia coli.

7. Use of the sesquiterpene synthase according to claim 1 in catalyzing farnesyl pyrophosphate to produce sesquiterpene.

8. The use according to claim 7, characterized in that The application includes: using wet bacteria obtained by centrifugation after fermentation and culture of an engineered bacterium containing the gene encoding the sesquiterpene synthase, wet bacteria immobilized cells, enzyme extracted after ultrasonic disruption of wet bacteria, or immobilized enzyme as a catalyst, using farnesyl pyrophosphate as a substrate, using a buffer solution with a pH of 6-8 as a reaction medium, reacting at 25-30°C and 100-150 rpm, and after the reaction is completed, separating and purifying the reaction liquid to obtain the sesquiterpene.

9. The use according to claim 7, characterized in that The application comprises: cloning the coding gene of the sesquiterpene synthase into an expression vector to construct a recombinant plasmid, then transforming the recombinant plasmid into a host bacterium having an MVA pathway or an MEP pathway to construct a recombinant genetically engineered bacterium, performing fermentation culture, and separating and purifying the fermentation product to obtain the sesquiterpene.

10. The use according to claim 9, characterized in that The host bacteria is Escherichia coli or Saccharomyces cerevisiae containing the plasmid pBbA5c-MevT-MBIS.