Construction method and application of B2m gene knockout SKOV3 cell line

Abstract

The invention discloses a construction method and application of a B2m gene knockout SKOV3 cell line, the B2m gene knockout SKOV3 cell line is creatively constructed for the first time, establishment of a cell model will promote precise research of ovarian cancer immunotherapy, a theoretical basis is provided for an individualized treatment strategy of a B2M deletion patient, and the cell model has a good application prospect. The method has a good application prospect and important conversion significance.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology, and in particular relates to a method for constructing and applying a B2m gene knockout SKOV3 cell line. Background Art

[0002] Establishing tumor cell gene knockout cell lines has multiple important significances in cancer research, such as: (1) Targeted verification of oncogenes: By knocking out specific genes (such as proto-oncogenes or epigenetic regulatory factors), their effects on tumor cell proliferation, apoptosis, migration or invasion can be directly observed, clarifying the role of genes in tumor occurrence and development. (2) Verification of therapeutic targets: After knocking out potential target genes, if tumor cell growth is inhibited or drug sensitivity is increased (such as chemotherapy, targeted drugs), the clinical value of the gene can be demonstrated. (3) Identification of drug-resistant genes: Knocking out candidate genes can simulate drug-resistant phenotypes or reverse drug resistance, guiding strategies to overcome drug resistance. (4) Genotype-phenotype association: Knocking out other genes in a specific mutation background (such as KRAS mutant tumors), screening synthetic lethal pairs, and guiding patient stratification treatment. (5) Immune escape mechanism: Knocking out immune checkpoint-related genes (such as PD-L1) or antigen presentation genes (such as MHC) to study the interaction between tumors and immune cells. (6) High-precision tools such as CRISPR-Cas9: They enable efficient and specific knockout, and combined with conditional knockout (such as inducible systems), they can study spatiotemporal specific effects. Gene knockout cell lines are cornerstone tools in cancer research, promoting the understanding of tumors and the development of intervention strategies from molecular mechanisms to therapeutic applications. Their value lies not only in "subtraction" research, but also in providing actionable targets and models for translational medicine.

[0003] Loss of antigen presentation due to MHC class I deficiency is a key mechanism of tumor immune escape, enabling tumor cells to evade immune surveillance and killing by cytotoxic CD8+ T lymphocytes. Multiple molecular mechanisms contribute to MHC class I deficiency, including somatic mutations and epigenetic modifications in genes involved in antigen presentation, or factors in the tumor microenvironment (e.g., hypoxia). Throughout the tumor lifecycle, immune surveillance acts as a selective pressure, driving the emergence of MHC class I-deficient cancer cells. The widespread use of cancer immunotherapy, particularly immune checkpoint inhibitors (e.g., PD-1 or CTLA-4 blocking antibodies), has further facilitated tumor evasion of T cell immunity and is associated with an increase in the emergence of MHC class I-deficient tumors, including those with inactivating mutations in MHC class I molecules, genes involved in the interferon (IFN) response pathway, or the protein encoding β2-microglobulin (B2M). Understanding the consequences of MHC class I deficiency and developing therapeutic strategies to circumvent and address these challenges are crucial for improving the outcomes of cancer immunotherapy.

[0004] Currently, a major challenge in ovarian cancer immunotherapy research is the lack of reliable B2M knockout (B2M-KO) cell models. B2M (β2-microglobulin) is a key component of MHC class I molecules. Its loss can lead to tumor cell immune escape, impairing T cell and NK cell recognition and killing. However, the existing SKOV3 wild-type cell line cannot accurately mimic clinical B2M-deficient ovarian cancer subtypes, limiting the study of related mechanisms and the development of therapeutic strategies. Summary of the Invention

[0005] In view of this, the purpose of the present invention is to provide a method for constructing a B2m gene knockout SKOV3 cell line and its application in the art, so as to fill the technical gap of the current lack of B2M gene knockout cell lines in the art.

[0006] The present invention adopts the following technical solutions to achieve the above-mentioned invention objectives:

[0007] The first aspect of the present invention provides a specific sgRNA for targeted knockout of the human B2M gene.

[0008] Furthermore, the target sequence of the sgRNA is shown in SEQ ID NO: 3.

[0009] In this invention, the human B2M gene refers to human β2-microglobulin (beta-2-microglobulin [Homo sapiens (human)]), also known as B2m, with Gene ID 567 in NCBI (https: / / www.ncbi.nlm.nih.gov / ). B2M is a key component of MHC class I molecules. Its loss can lead to tumor cell immune escape, impairing the recognition and killing of T cells and NK cells. This invention creatively constructs a B2m gene-knockout SKOV3 cell line for the first time and finds that knocking out the B2M gene in SKOV3 cells can resist the killing effect of CD8+ T cells. This invention achieves technical benefits that would be unexpected by those skilled in the art based on prior art.

[0010] A second aspect of the present invention provides a CRISPR / Cas recombinant lentiviral vector for targeted knockout of the human B2M gene.

[0011] Furthermore, the CRISPR / Cas recombinant lentiviral vector comprises the target sequence of the sgRNA described in the first aspect of the present invention.

[0012] Furthermore, the CRISPR / Cas recombinant lentiviral vector is obtained by connecting the target sequence of the sgRNA described in the first aspect of the present invention with the enzyme-cleaved LentiCRISPR-V2 vector.

[0013] Furthermore, the target sequence of the sgRNA in the CRISPR / Cas recombinant lentiviral vector is transcribed in the cell to form the sgRNA described in the first aspect of the present invention.

[0014] In the present invention, the CRISPR / Cas recombinant lentiviral vector is a gene editing tool vector based on lentiviral modification.

[0015] In a specific embodiment of the present invention, CMV-Puro (mutated version)-T2A-EGFP-pLentiCRISPRV2GFP is used as the original vector, and a specific sgRNA target sequence for the human B2M gene (as shown in SEQ ID NO: 3) is inserted downstream of the U6 promoter, while retaining elements such as the Cas9 nuclease gene, EGFP marker gene, and PuroR resistance gene. After enzyme digestion, ligation, transformation, and other steps, it is constructed and packaged into lentiviral particles in a packaging cell line for delivering sgRNA and Cas9 to SKOV3 cells to achieve knockout of the B2M gene. This vector integrates the CRISPR-Cas9 gene editing system with the efficient infection and stable integration characteristics of lentivirus, providing a key tool for the construction of a B2m gene knockout SKOV3 cell line.

[0016] In a specific embodiment of the present invention, the original vector used is CMV-Puro (mutant version)-T2A-EGFP-pLentiCRISPRV2GFP, which contains the following core elements:

[0017] U6 promoter: drives sgRNA transcription and ensures constitutive expression;

[0018] Cas9 nuclease gene: encoding SpCas9 protein;

[0019] Marker genes: EGFP (green fluorescent protein) was used for flow cytometry screening, and PuroR (puromycin resistance gene) was used for stable transfection screening.

[0020] In a specific embodiment of the present invention, the vector is double-digested with BsmBI restriction endonuclease at 37° C. for 2 h, and the linearization efficiency of the digested product is verified by 1% agarose gel electrophoresis.

[0021] In a specific embodiment of the present invention, when the target sequence of the sgRNA anneals to form double-stranded DNA, a gradient annealing program (gradual cooling from 90°C to 25°C) is used to ensure the stability of the double-stranded structure; the amount of T4 DNA ligase used in the ligation system is 10U / μL, incubated at 16°C overnight, transformed into DH5α competent cells, and then positive clones are screened by ampicillin resistance plates.

[0022] The third aspect of the present invention provides a lentivirus for targeted knockout of the human B2M gene.

[0023] Furthermore, the lentivirus comprises the CRISPR / Cas recombinant lentiviral vector described in the second aspect of the present invention.

[0024] In the present invention, the lentivirus refers to inserting a specific sgRNA target sequence for the B2M gene (as shown in SEQ ID NO: 3) into the LentiCRISPR-V2 vector, which is then packaged into viral particles after enzyme digestion and ligation to construct a recombinant vector. The lentivirus can efficiently infect SKOV3 cells and achieve targeted knockout of the B2M gene using the CRISPR / Cas9 system. The EGFP marker gene and PuroR resistance gene carried by the lentivirus facilitate infection efficiency monitoring and positive cell screening, providing a stable and efficient gene editing tool for constructing a B2M gene-knockout SKOV3 cell line.

[0025] In some embodiments, lentiviral packaging includes steps such as packaging cell lines, co-transfection of three plasmids, and virus collection. It should be noted that the present invention is not particularly limited to the specific steps of lentiviral packaging, and those skilled in the art can use conventional lentiviral packaging steps known in the art for packaging.

[0026] In some embodiments, the preparation process of the lentivirus further includes virus titer determination and purification.

[0027] The fourth aspect of the present invention provides a B2M gene knockout SKOV3 cell line.

[0028] Furthermore, the cell line is a cell line obtained by knocking out the human B2M gene in the SKOV3 cell line using the CRISPR / Cas recombinant lentiviral vector described in the second aspect of the present invention.

[0029] The fifth aspect of the present invention provides a method for constructing a B2M gene knockout SKOV3 cell line.

[0030] Furthermore, the method comprises the following steps:

[0031] (1) synthesizing the target sequence of the sgRNA described in the first aspect of the present invention;

[0032] (2) connecting the target sequence of the sgRNA to the enzyme-cleaved LentiCRISPR-V2 vector and converting it into the CRISPR / Cas recombinant lentiviral vector described in the second aspect of the present invention;

[0033] (3) co-transfecting the CRISPR / Cas recombinant lentiviral vector and the packaging plasmid into a mammalian packaging cell line to obtain the lentivirus described in the third aspect of the present invention;

[0034] (4) Infecting the SKOV3 cell line with the lentivirus to knock out the human B2M gene, thereby obtaining a B2M gene-knockout SKOV3 cell line;

[0035] Optionally, the packaging plasmid is pMD2.G or psPAX2;

[0036] Optionally, the mass ratio of the CRISPR / Cas recombinant lentiviral vector, pMD2.G, and psPAX2 is 4:3:1.

[0037] In a specific embodiment of the present invention, the step of co-transfecting the CRISPR / Cas recombinant lentiviral vector and the packaging plasmid into a mammalian packaging cell line is as follows:

[0038] Cell preparation: Culture 293T cells in DMEM supplemented with 10% FBS and 1% penicillin / streptomycin. The day before the experiment, seed the cells into a 10 cm dish to a confluency of 70%-80% at the time of transfection.

[0039] Preparation of DNA-liposome complexes: The mass ratio of recombinant lentiviral vector, pMD2.G, and psPAX2 packaging plasmids is 4:3:1. Specifically, the total amount of DNA used per 10 cm culture dish is 20 μg, including 10 μg of recombinant lentiviral vector, 7.5 μg of pMD2.G, and 2.5 μg of psPAX2. The DNA is mixed with Opti-MEM medium in a total volume of 500 μL. At the same time, 50 μL of Lipofectamine 2000 transfection reagent is mixed with 500 μL of Opti-MEM medium and incubated at room temperature for 5 minutes. Subsequently, the DNA solution is mixed with the transfection reagent solution, gently pipetting evenly, and incubated at room temperature for 20 minutes.

[0040] Transfection Procedure: Aspirate the old culture medium from the dish and gently rinse the cells once with PBS. Add 4 mL of fresh DMEM (without antibiotics) to the dish. Add the DNA-liposome complex dropwise to the dish and gently shake to mix.

[0041] Transfection conditions and subsequent processing: Incubate the culture dish in a 37°C, 5% CO2 incubator for 6-8 hours. After 6-8 hours, replace the culture medium with fresh DMEM supplemented with 10% FBS (antibiotics may be added). Collect the supernatant containing lentivirus 48 and 72 hours after transfection.

[0042] In a specific embodiment of the present invention, the steps of infecting the SKOV3 cell line with the lentivirus to knock out the human B2M gene and obtaining the B2M gene knockout SKOV3 cell line are as follows:

[0043] Day 1: Seed cells. Prepare a cell density of 3-5×10 4 The specific cell density of the cell suspension can be adjusted according to the size of the cultured cells. The corresponding number of cells should be seeded into the culture plate. Incubate at 37°C for 16-24 hours until the cell confluence reaches 20-30%.

[0044] Day 2: Infection. Add the appropriate amount of virus based on the cell MOI and viral titer, using the formula: Virus volume = (MOI x number of cells) / viral titer. Incubate at 37°C for 16 hours, then replace with complete medium and continue incubation. (If cell morphology changes, change the medium 8 hours earlier to maintain normal cell growth.)

[0045] Day 3-4: Continue to culture and change the cell medium to maintain cell activity.

[0046] Day 5: Observe infection efficiency. About 72 hours after infection, observe the infection efficiency.

[0047] The sixth aspect of the present invention provides the use of the sgRNA described in the first aspect of the present invention, the CRISPR / Cas recombinant lentiviral vector described in the second aspect of the present invention, or the lentivirus described in the third aspect of the present invention in preparing a B2M gene-knockout SKOV3 cell line in vitro for non-therapeutic purposes.

[0048] The seventh aspect of the present invention provides use of the method according to the fifth aspect of the present invention in constructing a B2m gene knockout SKOV3 cell line.

[0049] The eighth aspect of the present invention provides use of the cell line according to the fourth aspect of the present invention in any of the following aspects:

[0050] (1) Use of the cell line described in the fourth aspect of the present invention in preparing a cell model for screening therapeutic drugs for ovarian cancer subtypes with B2M deletion;

[0051] (2) Use of the cell line described in the fourth aspect of the present invention in preparing an animal model for screening therapeutic drugs for ovarian cancer subtypes with B2M deletion;

[0052] (3) Use of the cell line described in the fourth aspect of the present invention in preparing a cell model for studying the mechanism by which B2M deficiency inhibits CD8+ T cells from recognizing and killing tumors;

[0053] (4) Use of the cell line described in the fourth aspect of the present invention in preparing an animal model for studying the mechanism by which B2M deficiency inhibits CD8+ T cells from recognizing and killing tumors;

[0054] (5) Use of the cell line described in the fourth aspect of the present invention in studying tumor immune escape mechanisms, evaluating the efficacy of immunotherapy drugs, or screening alternative targets for tumor immunotherapy.

[0055] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0056] This study innovatively constructed a B2M gene-knockout SKOV3 cell line (B2M-KO SKOV3 cell line), providing key tools for the following studies: ① Immune escape mechanism analysis: clarifying how B2M loss affects MHC I expression and sensitivity to PD-1 / PD-L1 inhibitors; ② Evaluation of novel immunotherapies: testing the efficacy of CAR-T, bispecific antibodies, or NK cell therapies in B2M-deficient tumors; ③ Drug resistance studies: exploring whether B2M loss leads to immunotherapy resistance and identifying alternative targets (such as CD47 or the LILRB family); and ④ Preclinical model optimization: combining humanized mice to create an experimental system that more closely resembles the patient tumor microenvironment. B2M / MHC I loss occurs in approximately 10-30% of ovarian cancers. This model can be used for personalized treatment studies. B2M-KO SKOV3 cells can be transplanted into mice with humanized immune systems to assess immunotherapy responses. The establishment of this cell model will promote the precision research of ovarian cancer immunotherapy and provide a theoretical basis for individualized treatment strategies for patients with B2M deficiency. It has good application prospects and important translational significance. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] Figure 1 :CMV-Puro (mutant version)-T2A-EGFP-pLentiCRISPRV2GFP vector plasmid map;

[0058] Figure 2 :Sequencing results of the vector;

[0059] Figure 3 :Agarose gel electrophoresis detection results;

[0060] Figure 4 : Sequencing alignment and peak diagram display;

[0061] Figure 5 : RTCA and CCK-8 were used to detect whether SKOV3 cells could resist the killing effect of CD8+ T cells after knocking out the B2m gene. DETAILED DESCRIPTION

[0062] The present invention will be further described below in conjunction with specific examples. The following specific examples are only used to explain the present invention and are not to be construed as limiting the present invention. Those skilled in the art will appreciate that various changes, modifications, substitutions, and variations may be made to these embodiments without departing from the principles and purpose of the present invention, and that the scope of the present invention is defined by the claims and their equivalents. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art to which the present invention belongs. In order to facilitate understanding of the present invention, the following terms involved in the present invention are explained here:

[0063] The reagents, raw materials, and experimental consumables used in the present invention are readily available to those of ordinary skill in the art and, unless otherwise specified, can be obtained commercially. Experimental methods for which specific conditions are not specified in the present invention are generally performed under conventional conditions or as recommended by the manufacturer. In particular, the following examples are intended only to illustrate the present invention and should not limit the scope of the present invention in any way. It should be noted that the experimental conditions and results described in the following examples are intended only to illustrate the present invention and should not, and will not, limit the present invention described in detail in the claims.

[0064] Example Construction and related verification of B2m gene knockout SKOV3 cell line (B2M-KO SKOV3 cell line)

[0065] 1. Experimental Materials

[0066] The experimental reagents and instruments are shown in Tables 1 and 2 below, respectively.

[0067] Table 1 Experimental reagents

[0068]

[0069]

[0070] Table 2 Instruments and equipment

[0071] name factory model Clean bench Suzhou Group Antai Air Technology Co., Ltd. BBS-SDC Electric constant temperature blast drying oven Changzhou Zhongcheng Instrument Manufacturing Co., Ltd. DHG-9101-3A -80℃ ultra-low temperature refrigerator Thermo Fisher Scientific (Suzhou) Instrument Co., Ltd. ULTS1368 pipette Eppendorf - Ultra-micro nucleic acid analyzer Hangzhou Aosheng Instrument Co., Ltd. Nano-200 Reverse osmosis ultrapure water machine Colton Smart-DUVF Vertical circular pressure steam sterilizer Jiangyin Binjiang Medical Equipment Co., Ltd. LS-50HD centrifuge Hunan Xiangyi Laboratory Instrument Development Co., Ltd. H1650-W PCR instrument Beijing Donglin Changsheng Technology Co., Ltd. DL9700 Biochemical incubator Shanghai Yiheng Biotechnology Co., Ltd. LKH-70 Gel imaging system Tianneng Bio Tanon 1600 Constant temperature oscillator Changzhou Zhongcheng DHZ-C Constant temperature water bath Beijing Yongguangming Medical Instruments DZKW-S-4 electronic balance Xiangyi Tianping Instrument Equipment Co., Ltd. TP-520A

[0072] 2. Construct sgRNA knockout vector to knock out the expression of h-B2M gene in cells

[0073] (1) Primer design: The sequence information of sgRNA-1, sgRNA-2, and sgRNA-3 is as follows, and the target sequence information is shown in Table 3 below.

[0074] Table 3 Target sequence information

[0075]

[0076] (2) Vector information: The original vector is CMV-Puro (mutant version)-T2A-EGFP-pLentiCRISPRV 2GFP, purchased from Fenghui Biotechnology Co., Ltd. The corresponding map of the vector plasmid is as follows Figure 1 shown.

[0077] (3) Grow the bacterial suspension containing the vector plasmid overnight and extract the plasmid using 3-5 mL of fresh bacterial suspension. Refer to the QIAGEN plasmid extraction instructions for specific methods.

[0078] (4) Take 2 μg of fresh plasmid and perform double digestion with the corresponding restriction endonucleases. The digestion system is shown in Table 4. Digestion is carried out at 37°C for approximately 2 h.

[0079] Table 4 Enzyme digestion system

[0080] carrier 2 μg green Buffer 4μL BsmB 1.5 μL <![CDATA[ddH2O]]> Make up to 40 μL

[0081] (5) The digested product was subjected to agarose gel electrophoresis. After electrophoresis, the gel was recovered as follows: Under UV light, the gel strip containing the target fragment was cut. The total weight was weighed on a scale and the weight of the empty tube was subtracted to calculate the weight of the gel. The volume of the gel was calculated as 100 mg = 100 μL. 1 times the volume of the gel was added to the binging solution and the gel was completely melted in a 65°C water bath. During this period, the EP tube was shaken appropriately to accelerate the dissolution of the gel.

[0082] (6) Transfer all the above liquids into the filter column and centrifuge at 13,000 rpm for 30 seconds (can be repeated once). Then discard the liquid in the tube, add 500 μL of WA Solution to the column, and centrifuge at 13,000 rpm for 30 seconds. Discard the liquid in the tube, add 500 μL of Wash Solution to the column, and centrifuge at 13,000 rpm for 30 seconds (can be repeated once). Then empty for 3 minutes. Place the filter column in a new 1.5 mL EP tube and dry it at room temperature. Finally, add 35 μL of ddH2O to the column, let it stand for 5 minutes, and centrifuge at 13,000 rpm for 1.5 minutes. In order to improve the recovery rate, the dissolved DNA can be added to the column again and centrifuged for one minute. Discard the column to obtain the recovered vector fragment and measure the concentration.

[0083] (7) Annealing of sgRNA

[0084] ① Dilute the synthesized primers into a stock solution with a final concentration of 100 nmol / L.

[0085] ② The primer annealing system is shown in Table 5 below.

[0086] Table 5 Primer annealing system

[0087] Primer-F 2μL Primer-R 2μL NaCl 2μL <![CDATA[ddH2O]]> Make up to 20 μL

[0088] Add the above materials to a thin-walled tube, mix thoroughly, and then place in a PCR instrument. Select the appropriate annealing and extension temperatures. The reaction conditions are shown in Table 6 below.

[0089] Table 6 Reaction conditions

[0090] 90℃ 4min 70℃ 10min 55℃ 10min 37℃ 5min 25℃ 10min 4℃ ∞

[0091] (8) Perform T4 ligation reaction

[0092] Since the annealing product matched the sticky ends of the vector, T4 ligase was used to connect the recovered fragment to the linearized vector to complete the recombination process of the recovered target gene and the vector.

[0093] (9) Transformation

[0094] ① Place the competent cells on ice (4°C) and wait for them to thaw naturally. Then, add 10 μL of the ligation product to the competent cells and place them on ice (4°C) for 30 minutes.

[0095] ②Then heat shock in a 42℃ water bath for 90 seconds. Then quickly place on ice (4℃) for 2-3 minutes.

[0096] ③ Add 500 μL of SOC culture medium without antibiotics and culture at 37°C and 225 rpm with shaking for 45 min.

[0097] ④ Centrifuge at 3000 rpm for 2 min, discard 900 μL of the supernatant, blow off the bacterial solution at the bottom of the tube to disperse it, add it to the culture plate containing the corresponding resistance on the carrier (ampicin or kanamycin, etc.), spread it evenly with a sterilized applicator (the temperature of the applicator should not be too high to avoid scalding the bacteria), and invert it in a 37°C constant temperature incubator for overnight culture.

[0098] (10) Clone identification: Pick up multiple clone transformants from the plate for sequencing identification and preserve the strain.

[0099] (11) Plasmid extraction

[0100] ① Inoculate the plasmid-containing bacteria into a 50 mL culture flask containing 10-15 mL of LB / antibiotic medium and culture on a shaking bed at 37°C for 12-16 hours to amplify the plasmid.

[0101] ② Centrifuge at 3,000-5,000×g for 10 minutes and collect 10-15 mL of bacterial suspension.

[0102] ③ Discard the culture medium and gently tap on absorbent paper to remove any remaining liquid. Add 500 μL of Buffer P1 / RNase A mixture and vortex to resuspend the bacteria. Ensure that RNase A has been added to Buffer P1 before use. Thorough resuspension of the bacteria is crucial for achieving high yields; no cell clumps should be visible after resuspension.

[0103] ④ Transfer the resuspension to a 2mL centrifuge tube. Add 500μL of Buffer P2. Gently invert 8-10 times. Incubate at room temperature for 2 minutes, occasionally inverting to mix thoroughly. Invert gently to mix thoroughly; do not vortex, as this may cause genomic DNA fragmentation and contamination. If the bacterial suspension exceeds 10mL, the lysis solution will be very viscous and difficult to mix. After sufficient lysis, the solution will become viscous and clear. If necessary, continue to gently invert until the lysate becomes clear, but this step should not exceed 4 minutes.

[0104] ⑤ Add 700μL of Buffer NP3 and immediately invert the tube 15-20 times to mix thoroughly. Immediately after adding Buffer NP3, invert the tube to mix thoroughly to prevent precipitate clumping and affecting neutralization. Mix gently. Neutralization can be more difficult with larger volumes of bacterial solution; increase the number of inversions until the solution is completely neutralized.

[0105] ⑥ Centrifuge at 13,000×g for 10 minutes at room temperature.

[0106] ⑦ Place the HiPure DNA Mini Column III in a collection tube. Transfer half the supernatant to the column. Centrifuge at 13,000 × g for 30–60 seconds.

[0107] ⑧ Discard the flow-through and return the column to the collection tube. Transfer the remaining supernatant to the column. Centrifuge at 13,000 × g for 30-60 seconds.

[0108] ⑨ Discard the filtrate and return the column to the collection tube. Add 500μL Buffer PW1 to the column. Centrifuge at 13,000×g for 30-60 seconds. This step can be omitted when dealing with nuclease-knockout strains (end A-), such as DH5 and JM109. This step cannot be omitted when dealing with nuclease-rich strains (end A+), such as HB101. Buffer PW1 contains a protein denaturant; please wear gloves when handling it. When dealing with strains containing nucleases, it is recommended to use HiPure Plasmid Plus Kits to improve the stability of the plasmid.

[0109] ⑩ Discard the filtrate, return the column to the collection tube, and add 600 μL of Buffer PW2 (diluted with anhydrous ethanol) to the column. Centrifuge at 13,000 × g for 30-60 seconds. Buffer PW2 must be diluted with anhydrous ethanol before use. Follow the dilution instructions on the bottle label.

[0110] Discard the filtrate, return the column to the collection tube, add 600 μL of Buffer PW2 to the column, and centrifuge at 13,000 × g for 30-60 seconds.

[0111] The filtrate was discarded, the column was put back into the collection tube, and the column was dried by centrifugation at 13,000 × g for 3 minutes.

[0112] Place the column in a sterile 1.5 mL centrifuge tube. Add 60-100 μL of Elution Buffer or sterile water to the center of the column membrane. Let stand for 2 minutes, then centrifuge at 12,000 × g for 1 minute.

[0113] The concentration and OD260 / 280 of the extracted plasmid were detected by ultra-micro nucleic acid detector, and the plasmid was stored at -20°C.

[0114] The steps for lentiviral packaging are as follows:

[0115] Cell preparation: Culture 293T cells in DMEM supplemented with 10% FBS and 1% penicillin / streptomycin. The day before the experiment, seed the cells into a 10 cm dish to a confluency of 70%-80% at the time of transfection.

[0116] Preparation of DNA-liposome complexes: The mass ratio of recombinant lentiviral vector, pMD2.G, and psPAX2 packaging plasmids is 4:3:1. Specifically, the total amount of DNA used per 10 cm culture dish is 20 μg, including 10 μg of recombinant lentiviral vector, 7.5 μg of pMD2.G, and 2.5 μg of psPAX2. The DNA is mixed with Opti-MEM medium in a total volume of 500 μL. At the same time, 50 μL of Lipofectamine 2000 transfection reagent is mixed with 500 μL of Opti-MEM medium and incubated at room temperature for 5 minutes. Subsequently, the DNA solution is mixed with the transfection reagent solution, gently pipetting evenly, and incubated at room temperature for 20 minutes.

[0117] Transfection Procedure: Aspirate the old culture medium from the dish and gently rinse the cells once with PBS. Add 4 mL of fresh DMEM (without antibiotics) to the dish. Add the DNA-liposome complex dropwise to the dish and gently shake to mix.

[0118] Transfection conditions and subsequent processing: Incubate the culture dish in a 37°C, 5% CO2 incubator for 6-8 hours. After 6-8 hours, replace the culture medium with fresh DMEM supplemented with 10% FBS (antibiotics may be added). Collect the supernatant containing lentivirus 48 and 72 hours after transfection.

[0119] 3. Virus infection of SKOV3 cells to knock down B2m gene expression

[0120] Conduct a pilot infection experiment to determine the optimal MOI (Multiple Infection Index) for lentiviral infection of cells and optimal infection conditions, such as the choice of infection reagent, total infection volume, and post-infection medium exchange timing. These conditions will provide a reference for the final experiment. The MOI (Multiplicity of Infection) index (MII) refers to the ability of the virus to infect cells. A higher MOI indicates a greater difficulty in infecting cells. The MOI for a particular cell line is typically calculated as the ratio of the number of viral particles required to infect 80% of the cells to the number of cells. MOI = (Viral titer × Viral volume) / Number of cells.

[0121] Day 1: Inoculate cells. Prepare 2 mL of complete culture medium at a density of 3-5×10 4 Prepare a 100 μL / mL cell suspension. The specific cell density can be adjusted according to the cell size used in the experiment. Take 100 μL and add it to 12 wells in a 96-well plate, of which 3 wells serve as the control group. Culture at 37°C for 16-24 hours until the cell confluence reaches 20-30%.

[0122] Day 2: Infect cells. Take the virus out of the refrigerator and slowly thaw it on ice. Dilute the virus to a titer of 1×10 8 TU / mL, 5×10 7 TU / mL, 1×10 7 TU / mL, with a minimum of 35 μL per group after dilution. Aspirate the supernatant from each well, replace the culture medium according to Table 7 below, add the virus and the corresponding infection enhancer, mix well, and continue incubation. Replace the medium with complete culture medium 16 hours after infection to maintain normal cell growth. Observe cell morphology during the process and change the medium 8 hours earlier if changes occur.

[0123] Table 7 Lentivirus dilution concentration

[0124]

[0125] Day 5: Confirm infection efficacy. After approximately 72 hours of infection, when fluorescence expression is high, observe under a microscope. If infection efficiency is approximately 80% and cells are growing well, the infection conditions and MOI corresponding to the group will serve as the basis for subsequent infection experiments.

[0126] Lentivirus expression takes a long time. Generally, GFP fluorescence (or RFP red fluorescence) can be observed after 48 hours in cells with high metabolism. In cells with slower metabolism (such as primary cultured cells, neural stem cells, and embryonic stem cells), GFP (RFP) protein expression takes longer, with GFP (RFP) fluorescence observed 72-96 hours or even longer after infection. During the later stages of infection, cells should be cultured or passaged based on their growth to ensure optimal growth.

[0127] After determining the optimal infection conditions and MOI value for the cells, the formal experiment began.

[0128] Day 1: Seed cells. Prepare a cell density of 3-5×10 4 The specific cell density of the cell suspension (cells / mL) can be adjusted based on the cell size to be cultured. The corresponding number of cells should be seeded into the culture plate according to the table below. Incubate at 37°C for 16-24 hours, until the cell confluence reaches 20-30%. See Table 8 for the cell infection concentration.

[0129] Table 8 Cell infection concentration

[0130]

[0131]

[0132] Day 2: Infection. Add the appropriate amount of virus based on the cell MOI and viral titer, using the formula: Virus volume = (MOI x number of cells) / viral titer. Incubate at 37°C for 16 hours, then replace with complete medium and continue incubation. (If cell morphology changes, change the medium 8 hours earlier to maintain normal cell growth.)

[0133] Day 3-4: Continue to culture and change the cell medium to maintain cell activity.

[0134] Day 5: Observe infection efficiency. Observe infection efficiency approximately 72 hours after infection. Select an appropriate time point based on subsequent experimental requirements. Adjust the MOI based on actual infection conditions.

[0135] 4. Genomic testing of the B2M gene

[0136] (1) PCR sample preparation

[0137] ① Centrifuge the cells at 12,000 rpm for 1 min, discard the supernatant, add 200 μL Buffer GA, and vortex until thoroughly suspended.

[0138] ②Add 20μL Proteinase K and mix well.

[0139] ③ Add 200 μL of Buffer GB to the digestion solution, vortex to mix, and then incubate in a 56°C water bath for 30 min.

[0140] ④ Add 200 μL of anhydrous ethanol to the digestion solution and vortex to mix.

[0141] ⑤ Place the adsorption column in the collection tube, then transfer the mixed solution obtained in the previous step to the adsorption column and centrifuge at 12,000 rpm for 1 minute.

[0142] ⑥ Discard the waste liquid, place the adsorption column back into the collection tube, add 500 μL Buffer WB1 to the adsorption column, and centrifuge at 12,000 rpm for 30 seconds.

[0143] ⑦ Discard the waste liquid, return the adsorption column to the collection tube, add 600 μL of Buffer WB2 to the adsorption column, and centrifuge at 12,000 rpm (~13,400 × g) for 30 seconds; repeat the step once.

[0144] ⑧ Discard the waste liquid, return the adsorption column to the collection tube, and centrifuge the empty tube at 12,000 rpm for 2 minutes. Leave the adsorption column at room temperature for a few minutes to completely dry any remaining rinse solution.

[0145] ⑨ Place the adsorption column in a new 1.5mL centrifuge tube, add 50-100μL ddH2O to the middle of the adsorption membrane (the effect is better after a 65℃ heat bath), leave it at room temperature for 5 minutes, centrifuge at 12,000rpm for 2 minutes, and collect the DNA solution.

[0146] ⑩DNA quality inspection: Use a nucleic acid analyzer to detect RNA concentration and purity (OD260 / OD280 between 1.8-2.1), and use agarose gel electrophoresis to examine DNA bands.

[0147] (2) Detection primer design: Detection primers are shown in Table 9.

[0148] Table 9 Detection primer sequences

[0149] B2M-GF1 TGGCTTGGAGACAGGTGACGG(SEQ ID NO:4) B2M-GR1 AGGCTGCTGTTCCTACCCATG(SEQ ID NO:5)

[0150] sgRNA1 target sequence: AGTCACATGGTTCACACGGC;

[0151] sgRNA3 target sequence: GAGTAGCGCGAGCACAGCTA.

[0152] (3) Agarose gel electrophoresis detection

[0153] ① Take 10 mL of 50×TAE buffer and add water to 500 mL to prepare 1×TAE dilution buffer for later use.

[0154] ② Preparation of gel solution: Select the gel size based on the number of samples. Weigh 0.21g of agarose per 1 / 4 gel slab and place it in a 100mL conical flask. Add 30mL of 1× TAE dilution buffer (scale up by multiples for 1 / 2 and full gel slabs). Heat in a microwave until the agarose is completely melted. Remove and shake well. This is the 0.7% agarose gel solution. Shake occasionally during heating to dissolve any agarose particles adhering to the flask wall. Cover with parafilm during heating to minimize evaporation.

[0155] ③ Preparation of the glue plate: When making glue, first clean and dry the glue tank and the bottom plate thoroughly, place the glue tank on a horizontal support, insert the sample comb, and pay attention to observe that the lower edge of the comb teeth should maintain a gap of about 1mm with the bottom surface of the glue tank.

[0156] ④ Add a 1 / 10,000 solution of nucleic acid dye (DuRed 10000X) to the agarose gel solution cooled to 50-60°C. The temperature during pouring should be moderate, as this will result in uneven solidification, and the pouring speed should be moderate, as this will result in the formation of bubbles. Once the gel has completely solidified, remove the comb, taking care not to damage the gel at the bottom of the comb. Then, add 1× TAE dilution buffer to the electrophoresis tank until the liquid level just covers the upper surface of the gel.

[0157] ⑤ Sample addition: Mix the PCR reaction stock solution with 1 μL of 6× DNA Loading Buffer and carefully add it to the sample well using a micropipette. Replace the pipette tip after adding each sample to prevent cross-contamination. Exercise caution when loading the sample to avoid damaging the gel or puncturing the gel at the bottom of the sample well.

[0158] ⑥ Electrophoresis: Immediately after adding the sample, turn on the power supply. Keep the voltage at 110V and the current above 100mA. After 30 minutes, stop the electrophoresis. Store the gel electrophoresis image.

[0159] 5. Experimental Examples Using SKOV3 B2m KO Cells

[0160] (1) CCK-8 assay

[0161] ① Set up a control group (WT + PBS group), a WT + CD8+ T cell group, a KO cell group, and a KO + CD8+ T cell group. Add 100 μL of tumor cell suspension to each well of a 96-well plate, with 8,000 cells per well, in triplicate. Incubate the plates at 37°C, 5% CO2 for 24 hours.

[0162] ②Add CD8+T cells with an effector-target ratio of 1:1 to the CD8+T cell group, and the other groups were left untreated and incubated in the incubator for a certain period of time.

[0163] ③ Aspirate the cell supernatant from all wells, rinse the cells twice with PBS, add 100 μL of fresh culture medium again, and then add 10 μL of CCK-8 solution to each well.

[0164] ④ Incubate the culture plate in a 37°C incubator for 2 hours and measure the absorbance at 450 nm using a microplate reader.

[0165] ⑤ Calculate the cell viability value according to the absorbance value. The calculation method is as follows: Viability calculation: cell viability (%) = [A(experimental) - A(blank)] / [A(control) - A(blank)] × 100%;

[0166] A (experimental): absorbance of cells and CCK-8 solution after NK-EVs intervention;

[0167] A (blank): absorbance of the well with culture medium, CCK-8 solution, and no cells;

[0168] A (control): absorbance of wells with cells and CCK-8 solution but no NK-EVs intervention.

[0169] (2) RTCA testing

[0170] ① Set parameters in the RTCA program, including the amount of cells added to each well, intervention conditions, monitoring time, detection time point, etc.

[0171] ② A control group (WT + PBS group), a WT + CD8 + T cell group, a KO cell group, and a KO + CD8 + T cell group were set up. 8,000 tumor cells were added, and the monitoring period was one week, with Cell Index values ​​collected every 15 minutes.

[0172] ③ Prepare a cell suspension of appropriate density. Collect and count cells in the logarithmic phase and adjust the cell suspension concentration. First, add 50 μL of culture medium to the E-Plate assay plate and measure the background impedance. Pause the monitoring program, remove the E-Plate assay plate, and add 100 μL of cell suspension to the wells. Incubate in a clean hood at room temperature for 5 minutes.

[0173] ④ Place the E-Plate test plate with cells in the test station and continue to monitor cell proliferation in real time.

[0174] ⑤ When the Cell Index value is approximately 1, remove the test plate and add CD8+ T cells at an effector-target ratio of 1:1 to each well. Then put the test plate back and continue the real-time dynamic cell proliferation detection.

[0175] ⑥ After the test is completed, the effect curve of the cancer cells and the IC50 values ​​at different time periods can be obtained. The raw data are exported for cell inhibition analysis. The inhibition rate is calculated as follows: Inhibition rate (%) = (Control group Cell index - Experimental group Cell index / Control group Cell index) × 100%.

[0176] 6. Experimental Results

[0177] The sequencing results of the vector are as follows Figure 2 As shown, after comparison, the base sequence in the vector is consistent with the expected sequence, confirming that the construction of the sgRNA vector is complete.

[0178] After testing, the knockout cell line SKOV3-sg-B2M-3 (monoclonal strain) was sequenced and showed obvious gene editing bands (such as Figure 3 After sequencing, the expected shearing was found at the B2M genomic position (as shown). Figure 4 As shown, lane SKOV3-sg-B2M-3 is a KO-type band), therefore, the knockout was determined to be successful.

[0179] RTCA and CCK-8 experiments have shown that SKOV3 cells with B2m gene knockout can resist the killing effect of CD8+ T cells, while wild-type (WT) SKOV3 cells can still be killed by CD8+ T cells (e.g. Figure 5 ). However, the article "CD4 T Cell–Dependent Rejection of Beta-2 Microglobulin Null Mismatch Repair–Deficient Tumors, 2021, CANCER DISCOVERY" clearly states that knocking out B2m in colorectal cancer CT26 cells does not affect the efficacy of CD8+ T cells in colorectal cancer, nor does it affect the efficacy of immune checkpoint inhibitors in colorectal tumors. This shows that knocking out the B2m gene does not inhibit CD8+ T cells from recognizing and killing these tumor cells in all types of tumor cells. However, the present invention, after knocking out the B2m gene in SKOV3 cells, can resist the killing effect of CD8+ T cells. In other words, the present invention achieves technical effects that would not be anticipated by those skilled in the art based on the prior art.

Claims

1. A specific sgRNA for targeted knockout of the human B2M gene, characterized in that: The target sequence of the sgRNA is shown in SEQ ID NO:

3.

2. A CRISPR / Cas recombinant lentiviral vector for targeted knockout of the human B2M gene, characterized in that: The CRISPR / Cas recombinant lentiviral vector comprises the target sequence of the sgRNA according to claim 1.

3. The CRISPR / Cas recombinant lentiviral vector according to claim 2, characterized in that The CRISPR / Cas recombinant lentiviral vector is obtained by connecting the target sequence of the sgRNA according to claim 1 to the enzyme-cleaved LentiCRISPR-V2 vector.

4. The CRISPR / Cas recombinant lentiviral vector according to claim 2, wherein The target sequence of the sgRNA in the CRISPR / Cas recombinant lentiviral vector is transcribed in the cell to form the sgRNA according to claim 1.

5. A lentivirus for targeted knockout of the human B2M gene, characterized in that: The lentivirus comprises the CRISPR / Cas recombinant lentiviral vector according to any one of claims 2 to 4.

6. A B2M gene knockout SKOV3 cell line, characterized in that: The cell line is a cell line obtained by knocking out the human B2M gene in the SKOV3 cell line using the CRISPR / Cas recombinant lentiviral vector according to any one of claims 2 to 4.

7. A method for constructing a B2M gene knockout SKOV3 cell line, characterized in that: The method comprises the following steps: (1) synthesizing the target sequence of the sgRNA according to claim 1; (2) connecting the target sequence of the sgRNA to the enzyme-cleaved LentiCRISPR-V2 vector and converting it into the CRISPR / Cas recombinant lentiviral vector of any one of claims 2 to 4; (3) co-transfecting the CRISPR / Cas recombinant lentiviral vector and the packaging plasmid into a mammalian packaging cell line to obtain the lentivirus according to claim 5; (4) Infecting the SKOV3 cell line with the lentivirus to knock out the human B2M gene, thereby obtaining a B2M gene-knockout SKOV3 cell line; Optionally, the packaging plasmid is pMD2.G or psPAX2; Optionally, the mass ratio of the CRISPR / Cas recombinant lentiviral vector, pMD2.G, and psPAX2 is 4:3:

1.

8. Use of the sgRNA according to claim 1, the CRISPR / Cas recombinant lentiviral vector according to any one of claims 2 to 4, or the lentivirus according to claim 5 in preparing a B2M gene-knockout SKOV3 cell line in vitro for non-therapeutic purposes.

9. Use of the method according to claim 7 in constructing a B2M gene knockout SKOV3 cell line.

10. Use of the cell line according to claim 6 in any of the following aspects: (1) Use of the cell line according to claim 6 in preparing a cell model for screening therapeutic drugs for ovarian cancer subtypes with B2M deletion; (2) Use of the cell line of claim 6 in preparing an animal model for screening therapeutic drugs for ovarian cancer subtypes with B2M deletion; (3) Use of the cell line described in claim 6 in preparing a cell model for studying the mechanism by which B2M deficiency inhibits CD8+ T cells from recognizing and killing tumors; (4) Use of the cell line of claim 6 in preparing an animal model for studying the mechanism by which B2M deficiency inhibits CD8+ T cells from recognizing and killing tumors; (5) Use of the cell line described in claim 6 in studying the mechanism of tumor immune escape, evaluating the efficacy of immunotherapy drugs, or screening alternative targets for tumor immunotherapy.

Images