Construction method and kit of sgRNA and Zeste enhancer homolog 2 gene stable knockout cell strain and application of sgRNA and Zeste enhancer homolog 2 gene stable knockout cell strain

Abstract

The invention discloses an sgRNA, Zeste enhancer homolog 2 gene stable knockout cell strain construction method, a kit and application, sgRNA specifically targets a first exon of a pig-derived Zeste enhancer homolog 2 gene, and by combining with Cas9 protein, the Zeste enhancer homolog 2 gene can be effectively knocked out, and then the stable knockout cell strain is obtained. The sgRNA can be used for constructing a cell strain with the resistance phenotype of the porcine circovirus type 2, and a reliable cell tool is provided for further analysis and other subsequent researches of an interaction network of the porcine circovirus type 2 and a host.

Description

Technical Field

[0001] The present invention relates to genetic engineering technology, and in particular to a method for constructing a stable knockout cell line of sgRNA and Zeste enhancer homolog 2 gene, a kit and applications. Background Art

[0002] Porcine circovirus type 2 (PCV2) is one of the most devastating pathogens in the Circoviridae family. Its virus particles are approximately 17 nm in diameter and lack an envelope. They consist of 60 Cap protein subunits assembled into an icosahedral capsid encapsidating a single-stranded circular DNA genome. PCV2 can survive for long periods in feces, sewage, and on surfaces of livestock and poultry equipment, demonstrating its high transmissibility. PCV2 infection primarily causes diseases such as post-weaning multisystemic wasting syndrome (PMWS) and porcine dermatitis and nephropathy syndrome (PDNS). Clinical manifestations include progressive weight loss, dyspnea, lymphadenopathy, and inflammation of multiple organs, with a mortality rate exceeding 30%. Furthermore, PCV2 often co-infects with other viruses, such as porcine reproductive and respiratory syndrome virus (PRRSV) and porcine parvovirus (PPV), exacerbating immunosuppression by disrupting immune cell function, leading to secondary bacterial infections and vaccine failure, resulting in significant economic losses annually. Although vaccination and biosafety measures have been widely used in PCV2 prevention and control, traditional prevention and control methods lack effective intervention against viral mutations and latent infections, and there is an urgent need to develop new prevention and control strategies based on host targets.

[0003] Existing studies have shown that by regulating the expression of key host genes, the viral life cycle can be targeted and blocked or the innate immune response can be enhanced, thereby avoiding the escape risk brought by viral mutations. Enhancer of zeste homolog 2 (EZH2), as the core catalytic subunit of the polycomb repressive complex 2 (PRC2), plays a central role in epigenetic regulation. In addition to participating in physiological and pathological processes such as embryonic development, cell differentiation, and tumorigenesis, this gene has also been shown to dynamically regulate interferon signaling pathway-related genes and cell cycle regulatory factors, and plays an important role in maintaining immune homeostasis. However, there are currently no available EZH2 target-related cell tools. Summary of the Invention

[0004] Purpose of the invention: The purpose of the present invention is to provide a sgRNA that can be used to construct a stable knockout cell line of Zeste enhancer homolog 2 gene; the second purpose is to provide a method for constructing a stable knockout cell line of this gene; the third purpose is to provide related kits and applications.

[0005] Technical solution: The sgRNA described in the present invention specifically targets exon 1 of the porcine Zeste enhancer homolog 2 gene.

[0006] Preferably, the sgRNA specifically targets the sequence shown in SEQ ID NO: 1, and the sgRNA has the sequence shown in SEQ ID NO: 4.

[0007] The method for constructing a stable knockout cell line of the porcine enhancer of Zeste homolog 2 gene of the present invention comprises the following steps:

[0008] (1) constructing a knockout system based on the sgRNA according to any one of claims 1 to 3;

[0009] (2) The obtained knockout system is introduced into the target porcine cells, and a stable knockout cell line is obtained by screening.

[0010] Preferably, the knockout system in step 1 is a nucleic acid molecule capable of expressing Cas9 protein containing the sgRNA according to any one of claims 1 to 3, or a combination of the sgRNA according to any one of claims 1 to 3 and a nucleic acid molecule capable of expressing Cas9 protein. Preferably, the nucleic acid molecule is mRNA or a plasmid.

[0011] Preferably, the introduction method in step 2 includes viral vector, non-viral vector or electroporation transfection.

[0012] Preferably, the porcine-derived target cells in step 2 are porcine kidney cell line PK-15.

[0013] The kit of the present invention contains the aforementioned sgRNA.

[0014] Use of the sgRNA or kit of the present invention in constructing a stable knockout cell line of the porcine enhancer of Zeste homolog 2 gene.

[0015] Beneficial effects: Compared with the existing technology, the present invention has the following significant advantages: 1. The sgRNA obtained based on rational design is used in combination with the Cas9 protein to effectively achieve the knockout of the Zeste enhancer homolog 2 gene; 2. The sgRNA can be used to construct a Zeste enhancer homolog 2 gene knockout cell line with a porcine circovirus type 2 resistance phenotype, which can provide a reliable cell tool for further analysis and subsequent research on the interaction network between porcine circovirus type 2 and the host. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The peak diagram of sequencing at the target site after different sgRNA knockout, where the blue rectangle is the sgRNA target sequence;

[0017] Figure 2 This is a comparison of sequencing peaks between different monoclonal cells and wild-type cells after sgRNA3 knockout, where the blue rectangle represents the sgRNA target sequence;

[0018] Figure 3 The figure shows the results of EZH2 protein expression level detection in the monoclonal PK-15 cell line after knockout using sgRNA3;

[0019] Figure 4 This is a diagram showing the cell activity test results of the monoclonal cell line PK-15KO-EZH2;

[0020] Figure 5 Figure 2 is the result of EZH2 expression level detection after continuous passage of the monoclonal cell line PK-15KO-EZH2, where A is the detection result at the gene level and B is the detection result at the protein level. DETAILED DESCRIPTION

[0021] The technical solution of the present invention is further described below.

[0022] Example 1: Design and synthesis of sgRNA

[0023] Based on the porcine EZH2 coding gene sequence as shown in Gene ID: 100625497, sgRNAs with the sequences shown in Table 1 were designed for different exon regions and synthesized by GenScript Biotech. The PAM corresponding to the sgRNA target sequence is NGG.

[0024] At the same time, PCR amplification primers were designed for the locations of the four sgRNAs (as shown in Table 2).

[0025] Table 1 sgRNA sequences

[0026]

[0027] Among them, the underlined part is the target sequence, and the rest is the scaffold sequence.

[0028] Table 2 sgRNA amplification primers

[0029]

[0030]

[0031] Example 2: Construction and verification of EZH2 knockout PK-15 cell monoclonal clone

[0032] 1. Construction of homozygous monoclonal EZH2 knockout PK-15 cells

[0033] (1) 1×10 6PK-15 cells were cultured, and when the confluence reached 50±10%, the four sgRNAs obtained in Example 1 were delivered into the cells using the Bioscan gene knockout kit (Cat. No. Q051208, containing Cas9 mRNA);

[0034] (2) 24 h after transfection, cells were collected and lysed with cell lysis buffer to obtain DNA. The target site fragment was amplified by PCR. The amplification primers were shown in Table 2, the amplification system was shown in Table 3, and the reaction conditions were shown in Table 4. The obtained product was sent to Qingke Biotechnology Company for Sanger sequencing.

[0035] The sequencing results are as follows Figure 1 As shown, only after knockout using sgRNA 3, overlapping peaks appeared, so sgRNA 3 was selected for subsequent experiments;

[0036] Table 3 Amplification reaction system

[0037]

[0038] Table 4 PCR reaction conditions

[0039]

[0040] (3) The cells transfected with sgRNA 3 were diluted to a concentration of 5 cells / mL using the limiting dilution method, and 100 μL per well was seeded into a 96-well plate and cultured for 3 weeks to form a monoclonal cell population;

[0041] (4) Monoclonal cell clusters were observed and selected using a microscope. After trypsin digestion, the cell lysis buffer was used to lyse the DNA. The target site fragment was amplified by PCR. The amplification primers were shown in Table 2, the amplification system was shown in Table 3, and the reaction conditions were shown in Table 4. The obtained products were sent to Qingke Biotechnology Company for Sanger sequencing, and the gene fragment mutation was analyzed by sequence alignment.

[0042] The sequencing results are as follows Figure 2 As shown, EZH2-KO-2 monoclonal cells without additional inserted sequences were selected and passaged into 24-well plates for expansion culture.

[0043] 2. Protein expression identification of homozygous monoclonal EZH2 knockout PK-15 cells

[0044] (1) The EZH2-KO-2 monoclonal cells obtained above were cultured and lysed with RIPA lysis buffer. The cells were centrifuged at 12,000 rpm and 4°C for 20 min. The supernatant was aspirated to obtain the total cell protein. The protein concentration was determined using the BCA assay. According to the standard curve, the corresponding volume of 5× Loading Buffer and enzyme-free water was added to the protein solution to calibrate the protein concentration to 1.17 mg / mL. The protein was denatured at 98°C for 10 min.

[0045] (2) Separate the denatured protein sample by polyacrylamide gel electrophoresis and transfer the protein to a PVDF membrane;

[0046] (3) After blocking with 5% skim milk at room temperature for 1 h, the membrane was washed with TBST and rabbit anti-swine EZH2 and mouse anti-swine GAPDH were used as primary antibodies, respectively. The membrane was incubated overnight at 4°C on a shaker. After washing with TBST, the secondary antibody with the corresponding species resistance was added and incubated at room temperature for 2 h. After washing with TBST, the membrane was exposed and developed using ECL chemiluminescence detection reagent.

[0047] The results are as follows Figure 3 As shown in the figure, compared with wild-type cells, EZH2 protein was not significantly expressed in EZH2 knockout cells. Combined with the DNA sequencing results, it was shown that EZH2-KO-2 monoclonal cells were the successfully constructed porcine EZH2 gene knockout monoclonal cells PK-15KO-EZH2.

[0048] Example 3 Evaluation of Cell Activity of Monoclonal Cell Line PK-15KO-EZH2

[0049] 1×10 5 PK-15KO-EZH2 cells obtained in Example 2 were seeded in 96-well plates and cultured in a cell culture incubator at 37°C and 5% CO2 to a density of 70%. 10 μL of CCK-8 reagent was added to each well of the 96-well plate, and a blank control was set up. After incubation in the cell culture incubator for 1 hour, the absorbance was measured at a wavelength of 450 nm using a microplate reader. Six replicates were set for each sample, and cell viability was calculated using the following formula:

[0050] Cell viability (%) = (As-Ab) / (Ac-Ab) × 100

[0051] Where As, Ab, and Ac are the absorbances of the sample, blank control, and negative control, respectively.

[0052] Example 4 Detection of EZH2 expression level after continuous passage of monoclonal cell line PK-15KO-EZH2

[0053] 1. qPCR detection of EZH2 gene expression in PK-15KO-EZH2

[0054] The monoclonal cell line PK-15KO-EZH2 obtained in Example 2 was passaged 10 times, and RNA was extracted using Trizol reagent and reverse transcribed to obtain a total mass of 1000 ng of cDNA, which was used as a qPCR reaction template to amplify the target sequence.

[0055] qPCR primers, listed in Table 5, were designed using GAPDH as the internal reference gene and synthesized by Beijing Qingke Biotechnology Co., Ltd. The qPCR reaction mixture and reaction conditions are shown in Table 6 and Table 7, respectively. Three replicate qPCR reactions were performed to obtain the average Ct value of the EZH2 gene in the monoclonal PK-15 cell line undergoing continuous passage, and the relative expression level of the EZH2 gene was calculated.

[0056] Table 5 qPCR primers

[0057] Primer name Primer sequence (5'→3') EZH2-Pig-qPCR-F CGATGATGATGACGATGATG EZH2-Pig-qPCR-R CTTCCGCTTGTAAGTATTGG GAPDH-Pig-qPCR-F ACATCATCCCTGCTTCTACTGG GAPDH-Pig-qPCR-R CTCGGACGCCTGCTTCAC

[0058] Table 6 qPCR reaction system

[0059] Ingredients volume SYBR Green Master Mix 5μL 10 μM upstream primer 0.2μL 10 μM downstream primer 0.2μL cDNA 1 μL <![CDATA[ddH2O]]> Make up to 10 μL

[0060] Table 7 qPCR reaction conditions

[0061]

[0062] 2. Western blot detection of EZH2 protein expression in PK-15KO-EZH2

[0063] (1) The monoclonal cell line PK-15KO-EZH2 obtained in Example 2 was passaged 10 times, and then lysed with RIPA lysis buffer and centrifuged at 12,000 rpm and 4°C for 20 min. The supernatant was aspirated to obtain total cell protein, and the protein concentration was determined using the BCA assay. According to the standard curve, the corresponding volume of 5× Loading Buffer and enzyme-free water was added to the protein solution to calibrate the protein concentration to 2.20 mg / mL. The protein was denatured at 98°C for 10 min.

[0064] (2) Separate the denatured protein sample using polyacrylamide gel electrophoresis and transfer the protein to a PVDF membrane after electrophoresis.

[0065] (3) After blocking with 5% skim milk at room temperature for 1 h, the membrane was washed with TBST and rabbit anti-swine EZH2 and mouse anti-swine GAPDH were used as primary antibodies, respectively. The membrane was incubated overnight at 4°C on a shaker. After washing with TBST, the corresponding secondary antibody was added and incubated at room temperature for 2 h. After washing with TBST, the membrane was exposed and developed using ECL chemiluminescence detection reagent.

[0066] The results are as follows Figure 5 As shown, no significant expression of EZH2 gene and protein was observed after serial passage (P < 0.05), indicating that the EZH2 gene knockout monoclonal cell line PK-15KO-EZH2 is a porcine kidney cell line with stable EZH2 knockout.

Claims

1. An sgRNA, characterized in that The sgRNA specifically targets exon 1 of the porcine Zeste enhancer homolog 2 gene.

2. The sgRNA according to claim 1, characterized in that The sgRNA specifically targets the sequence shown in SEQ ID NO:

1.

3. The sgRNA according to claim 1 or 2, characterized in that The sgRNA has the sequence shown in SEQ ID NO:

4.

4. A method for constructing a stable knockout cell line of porcine Zeste enhancer homolog 2 gene, characterized in that the steps include: (1) constructing a knockout system based on the sgRNA according to any one of claims 1 to 3; (2) The obtained knockout system is introduced into the target porcine cells, and a stable knockout cell line is obtained by screening.

5. The knockout method according to claim 4, wherein The knockout system in step 1 is a nucleic acid molecule capable of expressing Cas9 protein containing the sgRNA according to any one of claims 1 to 3, or a combination of the sgRNA according to any one of claims 1 to 3 and a nucleic acid molecule capable of expressing Cas9 protein.

6. The knockout method according to claim 5, characterized in that The nucleic acid molecule is a plasmid or mRNA.

7. The knockout method according to claim 4, wherein The introduction method described in step 2 includes viral vector, non-viral vector or electroporation transfection.

8. The knockout method according to claim 4, wherein The porcine target cells in step 2 are porcine kidney cell line PK-15.

9. A kit, characterized in that The kit contains the sgRNA according to any one of claims 1 to 3.

10. Use of the sgRNA according to any one of claims 1 to 3 or the kit according to claim 9 in constructing a stable knockout cell line of the porcine enhancer of Zeste homolog 2 gene.

Images