Application and method of csrhy1a gene in improving resistance to citrus huanglongbing

By overexpressing the CsRHY1A gene in citrus, the problem of improving resistance to Huanglongbing (HLB) in citrus was solved, and the pathogen titer was significantly reduced, providing an efficient bioengineering method.

CN120665891BActive Publication Date: 2026-05-29SOUTHWEST UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SOUTHWEST UNIV
Filing Date
2025-06-19
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing technologies are insufficient to quickly and effectively improve the resistance of citrus to Huanglongbing (HLB). Traditional breeding methods have long cycles, and chemical control poses environmental pollution problems, while biological control is unstable and costly.

Method used

By cloning the CsRHY1A gene of citrus, constructing an overexpression vector and transforming citrus, the overexpression of the CsRHY1A gene in citrus was achieved, thereby improving the resistance of citrus to Huanglongbing (HLB).

Benefits of technology

Significantly reducing Huanglongbing (HLB) titers and delaying pathogen colonization in citrus provides an efficient bioengineering method to improve citrus disease resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120665891B_ABST
    Figure CN120665891B_ABST
Patent Text Reader

Abstract

The application discloses application and method of CsRHY1A gene in improving resistance of citrus to Huanglongbing, belongs to the technical field of agricultural biological gene engineering, and relates to application of the CsRHY1A gene in improving resistance of citrus to Huanglongbing, wherein the nucleotide sequence of the CsRHY1A gene is shown in SEQ ID NO.1, and a method for improving resistance of citrus to Huanglongbing by using the CsRHY1A gene, comprising the following steps: S1, cloning of the citrus CsRHY1A gene; S2, construction of a CsRHY1A overexpression vector pLGNe-CsRHY1A; S3, transformation of the citrus by the overexpression vector pLGNe-CsRHY1A obtained in S2, and identification of transgenic plants with improved resistance to Huanglongbing. The application provides a new selection for improving the resistance of citrus to Huanglongbing, effectively improves the resistance of citrus to Huanglongbing, and has great application value for breeding of citrus resistant to Huanglongbing.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of agricultural bioengineering technology, specifically relating to the application and method of the CsRHY1A gene in improving resistance to Huanglongbing in citrus. Background Technology

[0002] Citrus is one of the most important fruit crops. Citrus Huanglongbing (HLB) is the most destructive disease affecting all commercial citrus varieties. HLB is caused by *Alpha-Proteobacterium*, a bacterium belonging to the genus *Phyllobacterium*, which colonizes the phloem. Candidatus Liberibacter spp., including the heat-resistant Asian species ( Ca L. asiaticus, C Las), the earliest American species discovered in Brazil ( Ca L. americanus, C Lam) and the African species prevalent in South Africa ( Ca L. africanus, C Laf). Among them, the Asian citrus psyllid (ACP, Diaphorina citri ) spread C Las is a major threat to citrus production due to its wide distribution and high pathogenicity.

[0003] Currently, the strategy for controlling Huanglongbing (HLB) typically employs integrated management, primarily using chemical control (to kill psyllid vectors) supplemented by biological control. However, chemical methods suffer from environmental pollution and high consumption of manpower and resources, while biological control is unstable in effectiveness and costly. Traditional hybridization breeding has a long cycle (the juvenile stage of citrus crops generally lasts 5-8 years), resulting in low breeding efficiency and difficulty in quickly responding to disease outbreaks. With the development of molecular biotechnology, using genetic engineering to improve citrus HLB resistance is a popular method. Related studies have shown that overexpression of the Arabidopsis NPR1 gene in sweet orange varieties 'Hamlin' and 'Valencia' enhances resistance to HLB. Overexpression of CiNPR3 and CiNPR4 from the HLB-resistant grapefruit variety 'Jackson' in late-ripening oranges enhances the resistance of transgenic late-ripening oranges to HLB. Overexpression of CsSAMT1 in late-ripening oranges significantly increases SA and MeSA levels, enhancing the resistance of transgenic plants to HLB. There are currently no studies or applications on using the CsRHY1A gene to improve the resistance of citrus to Huanglongbing (HLB). Summary of the Invention

[0004] This invention aims to provide the application and method of the CsRHY1A gene in improving the resistance of citrus to Huanglongbing (HLB), offering a new option for enhancing citrus resistance to HLB. The application involves integrating the citrus CsRHY1A gene into citrus through an expression vector, effectively improving the resistance of citrus to HLB. This has significant application value for breeding citrus resistant to HLB.

[0005] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:

[0006] Application of the CsRHY1A gene in improving resistance to Huanglongbing in citrus, the nucleotide sequence of the CsRHY1A gene is shown in SEQ ID NO.1.

[0007] Preferably, the improvement of citrus resistance to Huanglongbing is achieved by regulating the expression level of the citrus CsRHY1A gene, thereby increasing the resistance of citrus to Huanglongbing.

[0008] The present invention also provides an overexpression vector to enhance resistance to Huanglongbing in citrus, wherein the overexpression vector includes the CsRHY1A gene.

[0009] The present invention also provides a strain that enhances resistance to Huanglongbing in citrus, the strain comprising the overexpression vector described above.

[0010] This invention also provides a method for improving citrus Huanglongbing resistance using the CsRHY1A gene, comprising the following steps:

[0011] S1, Cloning the CsRHY1A gene of citrus;

[0012] S2. Construct the CsRHY1A overexpression vector pLGNe-CsRHY1A;

[0013] The overexpression vector pLGNe-CsRHY1A obtained in S3 and S2 was used to transform citrus, and the transgenic plants with improved resistance to Huanglongbing were identified.

[0014] Preferably, in S1, the cloned citrus CsRHY1A gene specifically comprises:

[0015] Total RNA was extracted from citrus and reverse transcribed into cDNA. Using cDNA as a template, PCR amplification was performed using primers OE-CsRHY1A-F and OE-CsRHY1A-R. The CsRHY1A gene was obtained by digestion with BamHI and EcoRI.

[0016] The nucleotide sequence of primer OE-CsRHY1A-F is shown in SEQ ID NO.2, and the nucleotide sequence of primer OE-CsRHY1A-R is shown in SEQ ID NO.3.

[0017] Preferably, in S2, the construction of the CsRHY1A overexpression vector pLGNe-CsRHY1A specifically involves: ligating the CsRHY1A gene obtained in S1 into the pLGNe vector recovered by BamHI and EcoRI enzyme digestion to construct the overexpression vector pLGNe-CsRHY1A.

[0018] Preferably, in S3, the transformation of citrus by the overexpression vector pLGNe-CsRHY1A obtained in S2 is specifically as follows: the overexpression vector pLGNe-CsRHY1A obtained in S2 is transformed into Agrobacterium tumefaciens EHA105 by heat shock method, and then the citrus explants are transformed by Agrobacterium-mediated transformation. After genetic transformation, the explant cells are identified by GUS staining, PCR identification, and qRT-PCR analysis of CsRHY1A expression level to obtain transgenic plants.

[0019] Preferably, in the PCR identification, the PCR amplification primers are ID-CsRHY1A-F and ID-CsRHY1A-R;

[0020] The nucleotide sequence of primer ID-CsRHY1A-F is shown in SEQ ID NO.4, and the nucleotide sequence of primer ID-CsRHY1A-R is shown in SEQ ID NO.5.

[0021] Preferably, in the qRT-PCR analysis, the primers for qRT-PCR detection are RT-CsRHY1A-F and RT-CsRHY1A-R;

[0022] The nucleotide sequence of the primer RT-CsRHY1A-F is shown in SEQ ID NO.6, and the nucleotide sequence of the primer RT-CsRHY1A-R is shown in SEQ ID NO.7.

[0023] Compared with the prior art, the present invention has the following advantages and technical effects:

[0024] This invention provides a method for improving citrus Huanglongbing (HLB) resistance based on CsRHY1A gene overexpression. By cloning the CsRHY1A coding sequence of citrus, constructing an overexpression vector, and then transforming citrus, this method can delay HLB colonization in citrus and significantly reduce HLB titer. In summary, this invention represents a promising bioengineering technology for improving citrus HLB resistance and has significant value for molecular breeding of citrus resistant to (and tolerant of) HLB.

[0025] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description

[0026] Figure 1Bioinformatics characteristics of CsRHY1A in this invention: A is the chromosomal location of the citrus CsRHY1A gene, where bp represents a base; B is the gene structure of citrus CsRHY1A; C is the functional domain of citrus CsRHY1A, where aa represents an amino acid.

[0027] Figure 2 This is an electrophoresis diagram of the PCR amplification of the CsRHY1A gene clone of the present invention: CDS represents the CsRHY1A coding sequence; M represents the DNA molecular weight standard;

[0028] Figure 3 The structural diagram of the CsRHY1A plant overexpression vector of this invention is as follows: 35S represents a constitutive strong promoter; GUS: NPTII: marker gene for screening transgenic citrus; NOS: transcription termination sequence; LB: left arm of T-DNA; RB: right arm of T-DNA;

[0029] Figure 4 GUS staining diagram of the transgenic plants of this invention: OE-1, OE-2, and OE-6 represent transgenic plants, WT represents wild-type Late Orange plants, and + represents plasmid pLGNe-CsRHY1A;

[0030] Figure 5 PCR identification diagram of transgenic plants of this invention: M, Marker; +, plasmid pLGNe-CsRHY1A; WT, wild-type control; OE-#, transgenic plant;

[0031] Figure 6 The following is a graph showing the expression level analysis of transgenic plants in this invention: * asterisk indicates a significant difference compared with the WT control (**p<0.01, ***p<0.001, ****p<0.0001, one-way ANOVA).

[0032] Figure 7 This is a phenotypic diagram of CsRHY1A overexpressing plants of the present invention;

[0033] Figure 8 The image shows the results of pathogen content detection in transgenic plants: MAI indicates month after infection. Detailed Implementation

[0034] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0035] Unless otherwise defined, the technical or scientific terms used in this invention shall have the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains.

[0036] Source of experimental materials:

[0037] In this embodiment, the late-ripening orange was used as the test subject.

[0038] In this invention, unless otherwise specified, all other test materials and instruments are conventional test materials in the field and can be purchased through commercial channels.

[0039] Example 1

[0040] I. Bioinformatics Analysis of the Citrus CsRHY1A Gene

[0041] The citrus CsRHY1A gene is located on citrus chromosome 4, between 153439 bp and 155402 bp. The full-length chromosome is 19953105 bp, and its CDS sequence is 624 bp, encoding 207 amino acids. Analysis of the protein sequence yielded the following results: Figure 1 .

[0042] Figure 1 The results show the existence of a distinct RING structure functional domain.

[0043] The CsRHY1A gene has the nucleotide sequence shown in SEQ ID NO.1.

[0044] SEQ ID NO.1: (CDS sequence of CsRHY1A, ATG to stop codon)

[0045] ATGGCTGGTATGCTACCTGGAGTTGAATGTGCAAGAAGAAGAAGGATTCATCAAAGTGGAGGAGGGTGCAGCTCAGCCTCAGATGGCTTGGCGCCAACGTGGTCTTCTATGTCTATGTCTATGAGCAGAAGGTCCTCTTTTTGTTTATACACAAGC AGCCACGAGTCTCATCACACTTCTTCTATCTCTTCTCTGAGAAGCATAATCAACCAAGCGTGTGAAGATGAGCAGCTTGCAGGAGTAGCTAGAGAAGCTAAAGAAAGGTTAGATGAGAGACTCGGAACTCAAAGGAAATCCTCAGATAGCAATAGC AGGCAAAATGGCAAAGAGAGCTCAGTATTGATGAATATTAATAAGTCTACGGTGTTACATACACAAGTGTTTGGATCAAAGAAGAGTGGTTCAAAAAGGTTTAGTTGGTCCAAGTTGAGCTGGAAAGCTTGTGAGCAAGAAGAGTGTGCAATTTGC CTCGAGAGATTCAAGGTTGGTGACACCTTGGTGCACTTGCCTTGTGCTCATAGGTTTCATGCAAGGTGCTTGTTGCCATGGCTTGCCACCAATGCTCATAATTGCCCCTGTTGCAGAATGCAAATCCTGGACCCTGCAGCTTCATCAGCAGATTAA

[0046] II. Cloning of the Citrus CsRHY1A coding sequence

[0047] 1. RNA extraction and cDNA synthesis

[0048] Total RNA was extracted from citrus (Late Orange) leaves using a plant total RNA extraction kit (Adley, CAT: RN09). RNA quality was verified by agarose gel electrophoresis, and its concentration was determined using a concentration meter. cDNA was synthesized using a reverse transcription kit PrimeScript RTMaster Mix (TaKaRa, CAT: RR036A).

[0049] 2. PCR amplification of the CsRHY1A coding sequence

[0050] The CsRHY1A coding sequence DNA fragment was amplified from citrus cDNA using primers OE-CsRHY1A-F (SEQ ID No. 2), OE-CsRHY1A-R (SEQ ID No. 3), and the high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045A). The fragment length was 624 bp (e.g., ...). Figure 2 As shown in the figure, the amplified DNA fragment was sequenced and identified as the coding sequence of the citrus CsRHY1A gene (SEQ ID No. 1). Under UV light, the agarose gel block containing the target fragment was cut off with a clean blade, and the DNA fragment was recovered using a kit (Tiangen, CAT: DP214).

[0051] PCR amplification program: 98℃, 5 min; 98℃, 30 s, 56℃, 30 s, 72℃, 1 min, 35 cycles; extension at 72℃ for 10 min.

[0052] SEQ ID No. 2: (CDS pre-cloning primer OE-CsRHY1A-F, containing restriction enzyme sites)

[0053] GGACAGGGTACCCGGGGATCCATGGCTGGTATGCTACCTGG

[0054] SEQ ID No. 3: (CDS clone primer OE-CsRHY1A-R, containing restriction enzyme sites)

[0055] TCTCATTAAAGCAGGGAATTCTTAATCTGCTGATGAAGCTGC

[0056] III. Construction of CsRHY1A expression vector and transformation of Agrobacterium tumefaciens

[0057] 1. Construction of overexpression vectors

[0058] The CsRHY1A coding sequence DNA fragment and the overexpression vector pLGNe were respectively processed with restriction endonucleases. BamH I and EcoR I. After double digestion with ThermoFisher enzymes, the residue was recovered by gel extraction and ligated at 37°C using a homologous recombination kit (Novizan, CAT: C112). The ligation product was transformed into E. coli DH5α, and plasmids of positive clones were extracted using a plasmid extraction kit (Tiangen, CAT: DP103) to obtain the CsRHY1A overexpression vector pLGNe-CsRHY1A (e.g., pLGNe-CsRHY1A). Figure 3 (As shown).

[0059] 2. Transformation of Agrobacterium with overexpression vector

[0060] The constructed overexpression vector pLGNe-CsRHY1A was introduced into Agrobacterium tumefaciens EHA105 using the heat shock method. The method is as follows: 50 μL of frozen Agrobacterium competent cells EHA105 were thawed on ice; 2 μL of the plasmid of the overexpression vector was added to the competent cells, mixed by pipetting, and placed on ice for 5 min; the cells were then flash-frozen in liquid nitrogen for 5 min; immediately transferred to a 37℃ water bath for 5 min; 1 mL of LB liquid medium was added, mixed by pipetting, and cultured at 220 rpm in a shaker at 28℃ for 60 min; the bacterial culture was centrifuged at 10000 rpm for 1 min, the supernatant was discarded (approximately 100 μL of bacterial cells remained for resuspending), the resuspended cells were spread, and cultured upside down in the dark at 28℃ for 2 days; after the colonies grew, single colonies were verified by PCR using primers OE-CsRHY1A-F (SEQ ID No. 2) and OE-CsRHY1A-R (SEQ ID No. 3).

[0061] PCR reaction conditions: 95℃ for 3 min; 95℃ for 30 s, 58℃ for 30 s, 72℃ for 1 min, 30 cycles; 72℃ for 10 min.

[0062] IV. Agrobacterium tumefaciens-mediated genetic transformation of citrus

[0063] 1. Obtaining the hypocotyl from citrus seedlings

[0064] Fresh citrus fruits were washed, surface-sterilized with 70% alcohol, and seeds were extracted under aseptic conditions. The seed coats were peeled off, and the seeds were germinated on seed germination medium. They were cultured in the dark at 28°C for 2 weeks, and then cultured under 16h light / 8h dark conditions for 1 week. Under aseptic conditions, the epicotyls of the germinated seedlings were cut into 1cm stem segments for Agrobacterium tumefaciens-mediated genetic transformation.

[0065] 2. Preparation of Agrobacterium tumefaciens bacterial suspension

[0066] Before transfection, Agrobacterium for transfection (containing pLGNe-CsRHY1A vector) was streaked on LB solid medium containing 50 mg / L kanamycin. Single colonies were picked and inoculated into 25 mL of LB liquid medium containing the same antibiotic and cultured overnight at 28°C with shaking. The bacterial culture was diluted to OD600=0.1 and cultured until OD600=0.5. After centrifugation at 5000 r / min for 10 min, the supernatant was discarded and the culture was resuspended in MS liquid medium at pH 5.4 for transfection.

[0067] 3. Citrus epicotyl transformation

[0068] After soaking the citrus hypocotyl stem segments in Agrobacterium tumefaciens solution for 13 minutes and drying them, the stem segments were transferred to a co-culture medium and cultured in the dark at 28°C for 2 days. After co-culture, the hypocotyls were transferred to a selection medium and cultured in the dark at 28°C for 7 days. The hypocotyls were cultured at 28°C under 16h light / 8h dark conditions, and subcultured every two weeks. The buds that grew were identified by GUS staining.

[0069] 4. Seedling culture of transformants

[0070] When the seedlings grow to more than 1cm, they are cut off and grafted onto the late-maturing orange seedlings in sterile test tubes and cultured in the seedling culture medium; when the seedlings grow to about 5cm, they are grafted onto trifoliate orange seedlings and cultured in a greenhouse at 28℃.

[0071] The culture medium used in this embodiment is as follows:

[0072] Seed germination medium: MS + 30 g / L sucrose + 2.5 g / L ELrite, pH 5.8.

[0073] Co-culture medium: MS + 2 mg / L BA + 0.5 mg / L IAA + 1 mg / L 2,4–D + 100 μmol AS + 30 g / L sucrose + 2.5 g / L Gelrite, pH 5.8.

[0074] Screening medium: MS + 2 mg / L BA + 0.5 mg / L IAA + 500 mg / L Cef + 50 mg / L Kan + 30 g / L sucrose + 2.5 g / L Gelrite, pH 5.8.

[0075] Seedling culture medium: MS + 30 g / L sucrose, pH 5.8.

[0076] V. CsRHY1A overexpression transgenic plants inhibit pathogen proliferation

[0077] 1. GUS staining identification of transgenic plants

[0078] Leaves from the transgenic plants obtained in the initial screening were cut into leaf discs (7 mm in diameter) and subjected to GUS histochemical staining (24 h). The leaf discs from positive plants showed blue edges, while the leaf discs from WT plants did not show color (due to...). Figure 4 (As shown).

[0079] 2. PCR identification of transgenic plants

[0080] Genomic DNA was extracted from 100 mg of leaves from transgenic plants using a DNA extraction kit (Bioflux, CAT: BSC13S1B). PCR was used to detect the integration of the CsRHY1A coding sequence into the citrus genome. The detection primers were ID-CsRHY1A-F (SEQ ID No. 4) and ID-CsRHY1A-R (SEQ ID No. 5). Positive plants yielded a 1040 bp amplified fragment, while WT plants showed no amplification (due to…). Figure 5 (As shown).

[0081] SEQ ID No. 4 (Primer ID-CsRHY1A-F1 for pre-identification of transgenic plants, designed within CaMV 35S): CGACACGCTTGTCTACTCCA

[0082] SEQ ID No. 5 (Primer ID-CsRHY1A-R designed in CDS after identification of transgenic plants): TTAATCTGCTGATGAAGCTGC

[0083] PCR reaction conditions: 94℃ for 3 min; 94℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s, 30 cycles; 72℃ for 10 min.

[0084] 3. qRT-PCR analysis of transgenic plants

[0085] Total RNA (Adelaide, CAT No: RN09) was extracted from leaves of transgenic plants and cDNA was synthesized using the PrimeScript RT Master Mix reverse transcription kit (TaKaRa, CAT: RR036A). The expression level of the target gene was detected by qRT-PCR. The detection primers were RT-CsRHY1A-F (SEQ ID No. 6) and RT-CsRHY1A-R (SEQ ID No. 7). Two... -△△Ct The relative expression level of the CsRHY1A gene in transgenic plants was calculated as follows: The water-treated sample was defined as the reference factor, with its CsRHY1A expression level set at 1. Then, the fold increase in gene expression relative to the reference factor in transgenic citrus was calculated as 2. -△△Ct The results showed that the CsRHY1A gene was expressed at a higher level in transgenic plants compared to wild-type plants (e.g., ...). Figure 6 (As shown).

[0086] SEQ ID No. 6 (Primers RT-CsRHY1A-F for RT-PCR identification of transgenic plants, designed in CDS): GTATGCTACCTGGAGTTGAATG

[0087] SEQ ID No. 7 (Primers RT-CsRHY1A-R, designed in CDS, after RT-PCR identification of transgenic plants): ACTCGTGGCTGCTTGTGTAT

[0088] qRT-PCR reaction conditions: 95℃ for 3 min, 94℃ for 10 s; 56℃ for 10 s, 72℃ for 10 s, 40 cycles; 72℃ for 10 min.

[0089] 4. Phenotypic observation of transgenic plants

[0090] Observation and analysis of the phenotype of the three transgenic plants revealed no obvious abnormalities in appearance or growth (e.g., Figure 7 (As shown in the image). This indicates that overexpression of the CsRHY1A gene did not have a significant effect on the plant's phenotype and development.

[0091] 5. Evaluation of Huanglongbing resistance in transgenic plants

[0092] Following the method of Zou et al. (2016), qPCR was used to detect the pathogen content in transgenic plants. Pathogen content in CsRHY1A transgenic plants was measured in February, April, and June, starting from the introduction of the virus. DNA was extracted from three leaves of each line, diluted to 10 ng / µL, and detected using primers Las16S (SEQ ID No. 8, 9) and Citrus 18S (SEQ ID No. 10, 11). The following formula was used:

[0093] ;

[0094] The relative abundance of CLas (Log10) was calculated. Wild-type plants were used as a control to assess the resistance level of CsRHY1A transgenic plants. Each treatment had three biological replicates and three technical replicates. The results showed that overexpression of CsRHY1A inhibited CLas proliferation in transgenic plants (e.g., ...). Figure 8 (As shown).

[0095] SEQ ID No.8 (16S-F): TGAGTGCTAGCTGTTGGGTG

[0096] SEQ ID No.9 (16S-R): CTGCGCGTTGCATCGAATTA

[0097] SEQ ID No.10 (Citrus 18S-F): AATTGTTGGTCTTCAACGAGGAA

[0098] SEQ ID No.11 (citrus 18S-R): AAAGGGCAGGACGTAGTCAA

[0099] Therefore, CsRHY1A overexpression can significantly reduce the pathogen titer of Huanglongbing (HLB). This gene can be used independently for molecular breeding of disease resistance, or it can be used in conjunction with other disease resistance or susceptibility genes for molecular breeding of citrus resistant to HLB.

[0100] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the technical solutions of the present invention, and these modifications or equivalent substitutions cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. The application of the CsRHY1A gene in improving resistance to Huanglongbing (HLB) in citrus, characterized by: The nucleotide sequence of the CsRHY1A gene is shown in SEQ ID NO.1; Overexpression of the CsRHY1A gene can enhance the resistance of citrus to Huanglongbing (HLB).

2. A method for improving citrus Huanglongbing resistance using the CsRHY1A gene as described in claim 1, characterized in that, Includes the following steps: S1, Cloning the CsRHY1A gene of citrus; S2. Construct the CsRHY1A overexpression vector pLGNe-CsRHY1A; The overexpression vector pLGNe-CsRHY1A obtained in S3 and S2 was used to transform citrus, and the transgenic plants with improved resistance to Huanglongbing were identified.

3. The method according to claim 2, characterized in that, In S1, the cloned citrus CsRHY1A gene is specifically: Total RNA was extracted from citrus fruits and reverse transcribed into cDNA. This cDNA was then used as a template for PCR amplification using primers OE-CsRHY1A-F and OE-CsRHY1A-R. BamH I and EcoR I. Enzyme digestion yields the CsRHY1A gene; The nucleotide sequence of primer OE-CsRHY1A-F is shown in SEQ ID NO.2, and the nucleotide sequence of primer OE-CsRHY1A-R is shown in SEQ ID NO.

3.

4. The method according to claim 2, characterized in that, In S2, the construction of the CsRHY1A overexpression vector pLGNe-CsRHY1A specifically involves: ligating the CsRHY1A gene obtained in S1 to... BamH I and EcoR I. The overexpression vector pLGNe-CsRHY1A was constructed on the pLGNe vector recovered by enzyme digestion.

5. The method according to claim 2, characterized in that, In S3, the transformation of citrus with the overexpression vector pLGNe-CsRHY1A obtained in S2 is specifically as follows: the overexpression vector pLGNe-CsRHY1A obtained in S2 is transformed into Agrobacterium tumefaciens EHA105 by heat shock method, and then Agrobacterium-mediated transformation of citrus explants is carried out. After genetic transformation, the explant cells are identified by GUS staining, PCR identification, and qRT-PCR analysis of CsRHY1A expression level to obtain transgenic plants.

6. The method according to claim 5, characterized in that, In the PCR identification, the PCR amplification primers are ID-CsRHY1A-F and ID-CsRHY1A-R; The nucleotide sequence of primer ID-CsRHY1A-F is shown in SEQ ID NO.4, and the nucleotide sequence of primer ID-CsRHY1A-R is shown in SEQ ID NO.

5.

7. The method according to claim 5, characterized in that, In the qRT-PCR analysis, the primers for qRT-PCR detection were RT-CsRHY1A-F and RT-CsRHY1A-R; The nucleotide sequence of the primer RT-CsRHY1A-F is shown in SEQ ID NO.6, and the nucleotide sequence of the primer RT-CsRHY1A-R is shown in SEQ ID NO.7.