Application of pyapx gene in regulating crop salt tolerance and / or breeding salt-tolerant crops

By applying or overexpressing the PyAPX gene in crops, the salt tolerance and breeding ability of crops are improved, solving the problem of the lack of regulation of crop salt tolerance in existing technologies and realizing growth enhancement under salt stress conditions.

CN120665944BActive Publication Date: 2025-11-18TOBACCO RESEARCH INSTITUTE OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES (QINGZHOU TOBACCO RESEARCH INSTITUTE OF CHINA NATIONAL TOBACCO COMPANY)
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511179590.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-22
Publication Date
2025-11-18
Estimated Expiration
2045-08-22

AI Technical Summary

Technical Problem

The lack of existing technologies for screening genes from halophytes that can regulate crop salt tolerance traits leads to limited crop growth under salt stress conditions.

Method used

By applying the PyAPX gene or biomaterials that overexpress the PyAPX gene, crop salt tolerance can be enhanced by increasing chlorophyll content, reducing malondialdehyde content, increasing SOD and APX enzyme activity, and maintaining K+/Na+ levels.

Benefits of technology

It can improve seed germination rate, chlorophyll content, SOD and APX enzyme activity in crops under salt stress, maintain a high K+/Na+ ratio, and enhance the salt tolerance of crops.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120665944B_ABST
    Figure CN120665944B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of plant genetic engineering, and particularly relates to PyAPX Application of the gene in regulating crop salt tolerance and / or breeding of salt-tolerant crops. PyAPX The nucleotide sequence of the gene is shown as SEQ ID NO:1. PyAPX Compared with wild-type crops, overexpression of the gene in crops can effectively improve seed germination rate, chlorophyll content, SOD and APX enzyme activity, maintain a higher K + / Na + content, and reduce the content of malondialdehyde, thereby effectively improving the salt tolerance of crops. Therefore, the application provides a new approach for creating salt-tolerant crops.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically involving PyAPX Application of genes in regulating crop salt tolerance and / or in salt-tolerant crop breeding. Background Technology

[0002] Soil salinization is an important abiotic stress that severely restricts plant growth and development. Salt stress disrupts plant ion homeostasis, limits water absorption, and impairs nutrient acquisition. To resist salt-induced damage, plants activate a series of adaptive responses, including inducing stress-response genes, accumulating non-enzymatic antioxidants and compatible solutes, activating antioxidant defense mechanisms, regulating ion transport, and ion compartmentalization.

[0003] Based on their tolerance to salt stress, plants are broadly classified into glycophytes and halophytes. Halophytes exhibit high salt tolerance and can grow and reproduce under high salt concentrations, while glycophytes show signs of ion stress, osmotic stress, and oxidative stress under high salt concentrations. Seaweed is a typical halophyte, and due to its long-term immersion in seawater, it possesses excellent salt tolerance, enabling it to survive in extreme salt stress environments. These halophytes are valuable plant genetic resources and potential sources of novel salt-tolerant genes, which can be used in molecular breeding programs to enhance crop tolerance to abiotic stresses.

[0004] Porphyra tenuifolia ( Pyropia yezoensis ) and long-hearted kappa algae ( Kappaphycus alvarezii Salt-tolerant marine crops, including *Porphyra yezoensis* and *Kappa longifolia*, are widely cultivated and possess strong salt stress tolerance, making them promising candidates for screening for salt tolerance-related genes. However, it remains unclear whether salt stress-related genes in these two plants can enhance their salt tolerance. Therefore, applying genes that regulate crop salt tolerance, screened from *Porphyra yezoensis* and *Kappa longifolia*, to crop breeding has become a pressing issue in this field. Summary of the Invention

[0005] To address the lack of genes from halophytes that can regulate salt tolerance traits in crops, this invention provides... PyAPX The application of genes in regulating crop salt tolerance and / or in salt-tolerant crop breeding includes the following technical solutions:

[0006] This invention provides PyAPX Gene or overexpression PyAPX The application of genes in biological materials, wherein the application includes any one of the following two:

[0007] 1) Improve crop salt tolerance;

[0008] 2) Breeding salt-tolerant crops;

[0009] The PyAPX The nucleotide sequence of the gene is shown in SEQ ID NO:1.

[0010] Preferably, the improvement of crop salt tolerance includes one or more of the following six items:

[0011] (1) Improve seed germination rate;

[0012] (2) Increase the chlorophyll content in crops;

[0013] (3) Reduce the content of malondialdehyde;

[0014] (4) Increase SOD enzyme activity;

[0015] (5) Increase APX enzyme activity;

[0016] (6) Maintain K + / Na + level.

[0017] Preferably, the salt-tolerant crop breeding includes overexpression in the crop PyAPX Genes can be used to improve crop salt tolerance, resulting in salt-tolerant crops.

[0018] Preferably, the overexpression step includes overexpressing... PyAPX The biological material of genes is transferred into crops to obtain crops with improved salt tolerance.

[0019] This invention also provides an overexpression PyAPX Biological materials for gene expression, including overexpression PyAPX One or more of the following: primer pairs for genes, recombinant vectors, and recombinant microorganisms;

[0020] The PyAPX The nucleotide sequence of the gene is shown in SEQ ID NO:1.

[0021] Preferably, the primer pair includes PyAPX-F and PyAPX-R, the sequence of PyAPX-F is shown in SEQ ID NO:4, and the sequence of PyAPX-R is shown in SEQ ID NO:5.

[0022] Preferably, the base vector of the recombinant vector includes a plasmid vector; the plasmid vector includes the pCAMBIA1301 vector.

[0023] Preferably, the initial microorganism of the recombinant microorganism includes Agrobacterium strain GV3101.

[0024] The beneficial effects of this invention are as follows:

[0025] This invention provides PyAPX Gene or overexpression PyAPX The application of genetically modified biomaterials in improving crop salt tolerance and / or in salt-tolerant crop breeding, PyAPX The nucleotide sequence of the gene is shown in SEQ ID NO:1. Overexpression in crops compared to wild-type crops... PyAPX Genes can improve seed germination rate, chlorophyll content, SOD and APX enzyme activity, and maintain a high potassium level in crops under salt stress. + / Na + This invention reduces malondialdehyde (MDA) content, thereby effectively improving the salt tolerance of crops. Therefore, this invention provides a new approach for creating salt-tolerant crops. Attached Figure Description

[0026] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0027] Figure 1 The seed germination rate of ZH11 and each gene overexpression group in Example 1 of this invention under ultrapure water and saline treatment;

[0028] Wherein, CK represents ultrapure water treatment, and NaCl represents treatment with 0.8% NaCl by mass; the different letters indicate significant differences. P <0.05;

[0029] ZH11 represents the germination rate of Zhonghua 11, and PyMnSOD-3 and PyMnSOD-8 represent different rice varieties. PyMnSOD Germination rate of seeds produced by transgenic lines; PyAPX-14 and PyAPX-16 represent different rice varieties. PyAPX Germination rate of seeds produced by transgenic lines; KaNa + / H + -30, KaNa + / H + -26 indicates different types of rice KaNa + / H + Germination rate of seeds produced by transgenic lines;

[0030] Figure 2 The results of the detection of physiological and biochemical indicators of rice in each group in Example 2 of the present invention;

[0031] In this figure, A represents the plant height of rice in each group, and different letters indicate significant differences. P<0.05; B represents the root length detection results of rice in each group, and different letters indicate significant differences. P <0.05; C represents the chlorophyll a content detection results of rice in each group, and different letters indicate significant differences. P <0.05; D represents the chlorophyll b content detection results of rice in each group, and different letters indicate significant differences. P <0.05;

[0032] Figure 3 The results of the detection of physiological and biochemical indicators of rice in each group in Example 2 of the present invention;

[0033] In this figure, A represents the propylene glycol content detection results of rice in each group, and different letters indicate significant differences. P <0.05; B represents the SOD enzyme activity detection results of rice in each group, and different letters indicate significant differences. P <0.05; C represents the POD enzyme activity content detection results of rice in each group, and different letters indicate significant differences. P <0.05; D represents the CAT enzyme activity content detection results of rice in each group, and different letters indicate significant differences. P <0.05; E represents the APX enzyme activity content detection results of rice in each group, and different letters indicate significant differences. P <0.05. Detailed Implementation

[0034] This invention provides PyAPX Gene or overexpression PyAPX The application of genes in biomaterials, wherein the application includes either of the following two: 1) improving crop salt tolerance; 2) breeding salt-tolerant crops; PyAPX The nucleotide sequence of the gene is shown in SEQ ID NO:1.

[0035] PyAPXGene (SEQ ID NO:1): 5'--3'.

[0036] As one implementation method, the improvement of crop salt tolerance according to the present invention includes one or more of the following six items:

[0037] (1) Improve seed germination rate;

[0038] (2) Increase the chlorophyll content in crops;

[0039] (3) Reduce the content of malondialdehyde;

[0040] (4) Increase SOD enzyme activity;

[0041] (5) Increase APX enzyme activity;

[0042] (6) Maintain K + / Na + level.

[0043] As one implementation, the salt-tolerant crop breeding includes overexpression in the crop PyAPX Genes that enhance crop salt tolerance, resulting in salt-tolerant crops. As one implementation method, the overexpression... PyAPX The gene-transforming process includes constructing a recombinant vector, constructing a recombinant microorganism using the recombinant vector, and then transforming the recombinant microorganism into the target crop using Agrobacterium-mediated transformation to obtain a salt-tolerant crop. As one implementation method, the salt tolerance of the salt-tolerant crop includes one or more of the following six aspects: (1) increasing seed germination rate; (2) increasing chlorophyll content in the crop; (3) decreasing malondialdehyde content; (4) increasing SOD enzyme activity; (5) increasing APX enzyme activity; and (6) maintaining K... + / Na + level.

[0044] This invention also provides an overexpression PyAPX Biological materials for gene expression, including overexpression PyAPX One or more of the following: primer pairs for genes, recombinant vectors, and recombinant microorganisms;

[0045] The PyAPX The nucleotide sequence of the gene is shown in SEQ ID NO:1.

[0046] In one embodiment, the primer pair includes PyAPX-F and PyAPX-R, the sequence of PyAPX-F is shown in SEQ ID NO:4, and the sequence of PyAPX-R is shown in SEQ ID NO:5.

[0047] SEQ ID NO: 4: 5'-TTTACACTTTATGCTTCCGGCTATGGTGTCTGACCTGGAGAAGG-3';

[0048] SEQ ID NO: 5'-ACAAGTAAAGCGGCCGCGACTTCACGCCCAAACCGCGCCCAAC-3';

[0049] In one embodiment, the base vector of the recombinant vector includes a plasmid vector. In another embodiment, the plasmid vector includes the pCAMBIA1301 vector.

[0050] In one embodiment, the initial microorganism of the recombinant microorganism includes bacteria. In one embodiment, the bacteria include Agrobacterium strain GV3101.

[0051] To further illustrate the present invention, the following description, in conjunction with the accompanying drawings and embodiments, explains the invention. PyAPX The application of genes in regulating crop salt tolerance and / or in salt-tolerant crop breeding is described in detail, but should not be construed as limiting the scope of protection of this invention.

[0052] Unless otherwise specified, all reagents used in this invention are commercially available in the art; all experimental methods used in this invention are conventional operations in the art.

[0053] Example 1: Pathway for Obtaining Transgenic Rice T1 Generation

[0054] According to existing technology reports, this invention selects genes related to salt tolerance in seaweed: PyAPX , PyMnSOD , KaNa + / H + Gene experiments were conducted to verify the feasibility of using seaweed salt tolerance-related genes to improve crop salt tolerance.

[0055] According to SEQ ID NO:1~SEQ ID NO:3 PyAPX , PyMnSOD , KaNa + / H + The gene sequence is used for whole-genome synthesis.

[0056] PyAPX The gene sequence is shown in SEQ ID NO:1 as described above.

[0057] PyMnSOD Genes and KaNa + / H + The DNA sequence of the gene is shown below:

[0058] PyMnSOD(SEQ ID NO:2):5'-ATGGCGTTTGCTCTGCCCCCCCTGCCCTATGCGTACGATGCCCTCGAGCCGTACATCGACTCGACGACGATGAACATCCACCACACCAAGCACCACAACACATATGTGACCAACGTCAACAACGTGCTCGCAGGCGAGAATGGCGGCGCCCTCAAGGGCCTGAGCCTGAGCGCCATCCAGAAGGAAGTCGTGACCCTGCCCGACTCCATCAAGACGGCGGTGCGCAACAGCGGTGGCGGCCACTGGAACCACTCCTTCTTTTGGAGTGTCATGGGCAAGACCGGCAGCATTGCCGAGGCCCCGACGGGTGACCTCAAGTCGAGCATTGAGTCTACCTTTGGCTCCCTCGACGAGATGCAAAAGAAGTTCAACACGGCCGCGGCGTCCCGCTTTGGCTCTGGCTGGGCGTGGCTTTCCGTGAACGCTGACGGGCAGCTGTTCATCAGCAGCACTCCCAACCAGGACAACCCACTCATGGAGGGCATCGTCGACCAGCCGGGGACGCCCATTTTGGGCCTGGATGTGTGGGAGCACGCCTACTACCTCAAGTACCAGAACCGCCGGCCGGAGTATATTGCGTCGTGGTGGAAGACCGTCGACTTTGACGTCATTGCCAAGAACTACTCCGCGGCCAAGTCGGGTGGGCTGCCTGCCTTTGACACGCCGCTGGTGTAA-3';

[0059] KaNa + / H +(SEQ ID NO:3): 5'--3'.

[0060] Using pCAMBIA1301 as the base vector, BamH I and Kpn I. The linearized vector was double-digested with enzymes; using the synthesized gene sequences SEQ ID NO:1~SEQ ID NO:3 as templates, amplification primers PyAPX-F / PyAPX-R, PyMnSOD-F / PyMnSOD-R, and KaNa were used for amplification. + / H + -F / KaNa + / H+ -R respectively obtain PyAPX , PyMnSOD and KaNa + / H + Gene fragments; under the action of homologous recombinase, PyAPX , PyMnSOD and KaNa + / H + The gene fragments were ligated into the linearized pCAMBIA1301 vector to obtain pCAMBIA1301-35S:PyAPX, pCAMBIA1301-35S:PyMnSOD, and pCAMBIA1301-35S:KaNa. + / H + Overexpression vectors. The expression vectors obtained in the above steps were transformed into Agrobacterium GV3101 to obtain overexpression vectors carrying pCAMBIA1301-35S:PyAPX, pCAMBIA1301-35S:PyMnSOD, and pCAMBIA1301-35S:KaNa. + / H + Agrobacterium strain GV3101 was used to overexpress the vector. The Agrobacterium strain was transformed into rice variety ZH11. The transformed seedlings were screened by resistance plates to obtain positive T1 generation transgenic rice seedlings. The resistance plates contained hygromycin at a final concentration of 15 mg / L.

[0061] PyAPX-F (SEQ ID NO:4): 5'-TTTACACTTTATGCTTCCGGCTATGGTGTCTGACCTGGAGAAGG-3';

[0062] PyAPX-R (SEQ ID NO:5): 5'-ACAAGTAAAGCGGCCGCGACTTCACGCCCAAACCGCGCCCAAC-3';

[0063] PyMnSOD-F (SEQ ID NO:6): 5'-TTTACACTTTATGCTTCCGGCTATGGCGTTTGCTCTGCCCCCCC-3';

[0064] PyMnSOD-R (SEQ ID NO:7): 5'-ACAAGTAAAGCGGCCGCGACTTTACACCAGCGGCGTGTCAAAG-3';

[0065] KaNa + / H +-F (SEQ ID NO:8): 5'-TTTACACTTTATGCTTCCGGCTATGGCAGACCTCTTCATTCCAT-3';

[0066] KaNa + / H + -R (SEQ ID NO:9): 5'-ACAAGTAAAGCGGCCGCGACTTCATAATCCTAGGGAGGCCGTT-3'.

[0067] Salt treatment during rice germination:

[0068] Using seeds of rice variety Zhonghua 11 and overexpression PyAPX , PyMnSOD , KaNa + / H + Seeds of T1 generation transgenic rice with positive genes were used as the experimental material in this embodiment.

[0069] Before germination, seeds of ZH11 and positive T1 generation transgenic rice were placed in 50mL centrifuge tubes, and 70% ethanol solution was added until the ethanol solution covered the seeds. After standing for 1 min for sterilization, the seeds were shaken with 1% sodium hypochlorite for 30 min. After shaking, the seeds were rinsed 5 times with sterile water and then placed on a plate (9 cm in diameter) containing three layers of filter paper.

[0070] The above ZH11 and the transfer PyAPX , PyMnSOD , KaNa + / H + 180 seeds of each type of positive T1 generation transgenic rice were used, with 30 seeds evenly placed in each petri dish. Each culture medium served as a replicate, and each treatment was repeated six times. Of the six replicates for each treatment, three replicates contained 20 mL of ultrapure water as a control group, and the other three replicates contained 20 mL of 0.8% NaCl solution. The ultrapure water or 0.8% NaCl solution in the petri dishes was replaced every 24 hours.

[0071] The petri dishes were placed in an incubator at 28℃ with a 16-hour light / 8-hour dark cycle. The appearance of the radicle was used as the criterion for seed germination. After 6 days of treatment, the germination rate of rice seeds was statistically analyzed, and the results are as follows: Figure 1 As shown.

[0072] Depend on Figure 1 It can be seen that, under the control group (ultrapure water) conditions, PyAPX ,PyMnSOD and KaNa + / H + The germination rate of the overexpression lines was not different from that of the wild-type Zhonghua 11; treatment with 0.8% NaCl had a certain inhibitory effect on the germination of seeds in all lines, among which, PyAPX The germination rate of the overexpression lines was significantly higher than that of the wild-type control, and PyMnSOD and KaNa + / H + The germination rate of the overexpressing lines was significantly lower than that of the wild-type control. These results indicate that overexpression... PyAPX Genes can improve the germination rate of rice seeds under salt stress.

[0073] Example 2 Salt stress treatment during rice seedling stage

[0074] Zhonghua 11 and Zhuan PyAPX , PyMnSOD , KaNa + / H + Seeds of positive T1 generation transgenic rice were placed in culture baskets for growth. Six baskets of ZH11 and each positive T1 generation transgenic rice were planted, with 18 rice plants in each basket. After three weeks of normal growth, the water in three baskets of ZH11 and each positive T1 generation transgenic rice was replaced with a 250 mM NaCl solution, the same volume as the usual irrigation, serving as the salt stress treatment group. The other three baskets were continuously irrigated with ultrapure water at the same volume as the usual irrigation, serving as the control treatment group. After two more weeks of growth, rice materials from the control group (plants grown continuously in water) and the salt stress treatment group were collected for subsequent phenotypic and physicochemical property testing. The physiological and biochemical indicators and their results are as follows.

[0075] (1) Measurement of plant height and root length

[0076] The plant height and root length of seedlings of each of the above treatment lines were measured.

[0077] Table 1. Plant height and root length (cm) of crops in each group

[0078]

[0079] Note: Different letters in the same column of data in Table 1 indicate significant differences. P <0.05).

[0080] The measurement results are as follows Figure 2 As shown in A and B and Table 1, it can be seen that under the CK condition, KaNa + / H + Overexpression of the compound increased plant height in rice; however, under 250 mM NaCl treatment, plant height was significantly inhibited in all lines. PyAPX , PyMnSOD and KaNa + / H + The overexpressing lines were all taller than the wild-type control, among which... PyAPX The overexpression lines had the tallest plant height; the root length of each overexpression line was not significantly different from the wild type under control and salt stress conditions. These results indicate that... PyAPX Overexpression of [a substance] improved the salt tolerance of rice seedlings.

[0081] (2) Determination of chlorophyll content

[0082] Each group took 0.1 g of rice leaves, placed them in a pre-cooled mortar, added liquid nitrogen and ground them into powder. 20 mL of 95% ethanol solution was added and mixed with the powder to extract chlorophyll. The mixture of ethanol and powder was centrifuged at 4000 r / min for 10 min, and the supernatant was collected. The absorbance of the supernatant was measured at 440 nm, 649 nm and 665 nm, respectively. The contents of chlorophyll a and chlorophyll b were calculated according to the formula shown below.

[0083] Chlorophyll a concentration (mg / L) = 12.71 × A 665 -2.59×A 649 ;

[0084] Chlorophyll b concentration (mg / L) = 22.88 × A 649 -4.67×A 665 .

[0085] Table 2. Chlorophyll a and chlorophyll b content (mg / L) of crops in each group

[0086]

[0087] Note: Different letters in the same column of data in Table 2 indicate significant differences. P <0.05).

[0088] The results are as follows Figure 2 As shown in C and D and Table 2, it can be seen that... PyAPX , PyMnSOD and KaNa + / H + The chlorophyll a content of the overexpressing strains was not significantly different from that of wild-type ZH11 under both control and salt treatment conditions; PyAPXThe chlorophyll b content of the overexpressing lines was significantly higher than that of the wild-type ZH11 under salt stress conditions. PyMnSOD and KaNa + / H + The chlorophyll b content of the overexpressing lines was not different from that of the wild-type ZH11, indicating that... PyAPX Overexpression lines exhibit higher salt tolerance and can increase chlorophyll b content in rice under salt stress conditions.

[0089] (3) Determination of malondialdehyde (MDA) content

[0090] For each of the above groups, 0.1 g of rice leaves were taken and placed in a pre-cooled mortar. Liquid nitrogen was added, and the mixture was ground into powder. 3 mL of 10% trichloroacetic acid (TCA) was added and mixed thoroughly. The mixture was centrifuged at 4000 r / min for 10 min. 800 μL of the supernatant was transferred to a new 2 mL centrifuge tube, and 800 μL of 0.6% thiobarbituric acid (TBA) was added to obtain a mixture. The mixture was heated at 100℃ for 15 min, and then immediately cooled in an ice bath. The cooled mixture was centrifuged at 10000 r / min for 15 min. 200 μL of the supernatant was then transferred to an ELISA plate, and the absorbance was measured at 450 nm, 532 nm, and 600 nm. The MDA content was calculated using the formula shown below.

[0091] MDA content (μmol / g) = (6.45 × (A) 532 -A 600 -0.56×A 450 )*(3 / 0.8) / 0.1.

[0092] Table 3. MDA content in crops of each group (μmol / g FW)

[0093]

[0094] Note: Different letters in the same column of data in Table 3 indicate significant differences. P <0.05).

[0095] The results are as follows Figure 3 As shown in Table A and Table 3, salt stress significantly increased the MDA content in all strains; under salt stress conditions, KaNa + / H + The MDA content in the overexpression lines was significantly higher than that in the wild-type control, while PyMnSOD and PyAPX The MDA content in the overexpression lines was significantly lower than that in the wild-type control. ​The content of overexpression was lowest in the plants.

[0096] (4) Determination of the activity of oxidative scavenging related enzymes

[0097] 0.1 g of rice leaves from each group were taken to determine the contents of superoxide dismutase (SOD), peroxidase, catalase, and ascorbate peroxidase (APX). Specific methods for activity assays can be found in the instructions for the following kits from Shanghai Sangon Biotech Co., Ltd.: Superoxide Dismutase (SOD) Activity Assay Kit (D799593-0050), Peroxidase (POD) Activity Assay Kit (D799591-0050), Catalase (CAT) Activity Assay Kit (D799597-0050), and Ascorbate Peroxidase (APX) Activity Assay Kit (D799461-0050). All four enzyme activities were detected using ultraviolet colorimetry.

[0098] Table 4. Content of oxidation scavenging related enzymes in crops of each group

[0099]

[0100] Note: Different letters in the same column of data in Table 4 indicate significant differences. P <0.05).

[0101] The results are as follows ​ As shown in B~E and Table 4, ​ + / H + Overexpression of the enzymes had no effect on the activities of SOD, CAT, POD and CAT enzymes in rice seedlings under normal and salt treatment conditions. ​ The SOD activity of the overexpressing plants was significantly higher than that of the wild-type control under both control and salt treatment conditions. ​ The activities of SOD and APX in overexpressing plants were significantly higher than those in the wild-type control under both control and salt treatment conditions.

[0102] (5) Na + and K + Content determination

[0103] wild type and ​ Roots and leaves of the overexpression lines under control and salt treatment conditions were dried at 65°C for 3 days to constant weight, and the dry weight of the samples was recorded. The samples were then digested in nitric acid at 110°C for 6 h. Na+ was then determined using an optical emission spectrometer (ICP, Optima 8000, PerkinElmer, USA). + and K + content.

[0104] Table 5 Na + and K +Content determination results

[0105]

[0106] Note: Different letters in the same column of data in Table 5 indicate significant differences. P <0.05).

[0107] As shown in Table 5, under salt stress treatment, overexpression ​ The Na⁺ level in the leaves of the rice variety with the ZH11 gene showed no significant increase compared to ZH11, while the Na⁺ level in the roots was significantly lower than that of ZH11. ​ K in leaves and roots of overexpressing strains + The water levels have dropped significantly, but ​ K in leaves and roots of overexpressing strains + The decrease was relatively small. This indicates... ​ The overexpression lines have stronger K + Retention capacity and less Na + Accumulation effect, thereby maintaining a high K + / Na + .

[0108] Under salt stress, sodium ions (Na+) in plant cells... + Excessive accumulation of Na can disrupt cytoplasmic ion homeostasis. + Steady state is mainly composed of Na + / H + Antiporters (NHX) maintain this state by limiting Na+. + Salt tolerance is conferred by absorbing and enhancing efflux of these substances and isolating them within vacuoles, thereby reducing cytoplasmic toxicity and maintaining ion homeostasis through vascular transport. Salt stress also triggers the excessive production of reactive oxygen species (ROS), including superoxide anions (O3). 2- Reactive oxygen species (ROS) include hydrogen peroxide (H2O2), singlet oxygen (¹O2), and hydroxyl radicals (HO·). These ROS are generated and maintained in dynamic equilibrium in various cellular compartments under normal conditions. At low concentrations, ROS act as important signaling molecules regulating plant growth and stress responses. However, excessive ROS accumulation under salt stress can cause oxidative damage. To mitigate oxidative stress, plants have developed a robust antioxidant defense system composed of both enzymatic and non-enzymatic components. Major enzymatic antioxidants include superoxide dismutase (SOD), catalase (CAT), and enzymes in the ascorbate-glutathione cycle, such as ascorbate peroxidase (APX), glutathione peroxidase (GPX), monodehydroascorbate reductase (MDHAR), dehydroascorbate reductase (DHAR), and glutathione reductase (GR). Among these, SOD plays a crucial role, converting O2 into hydrogen peroxide. 2-It is converted into H2O2, which is then decomposed into water by APX, CAT, and GPX. This invention involves overexpression... ​ Following gene expression, the activity and content of oxidation scavenging-related enzymes in the plant were significantly increased, indicating overexpression. ​ Genes can enhance the antioxidant capacity of crops under salt stress.

[0109] (6) Yield Experiment

[0110] T1 generation transgenic plants were planted using standard procedures, and T2 generation transgenic seeds were obtained after the crops matured.

[0111] The comparison of Zhonghua 11 and T2 was transferred. ​ , ​ , ​ + / H + The genetically modified plants were planted in planting ponds with a salinity of 0% (control group) and 0.8%, with each material planted in 25 m² planting ponds with different salinity levels. 2 The yield per mu after harvest is shown in Table 6, with 3 repeated randomized blocks arranged in a single block.

[0112] Table 6. Yield data of transgenic rice under salt stress

[0113]

[0114] Note: Different letters in the same column of data in Table 6 indicate significant differences. P <0.05).

[0115] As shown in Table 6, under normal conditions, the yield of Zhonghua 11 is equivalent to 505.5 kg / mu, and the yields of the three transgenic lines are also around 500 kg / mu, showing no significant difference compared to the control. However, under 0.8% NaCl stress, the yield of Zhonghua 11 is 420.3 kg / mu, a decrease of about 16.9% compared to normal conditions; while the yield of the transgenic lines is... ​ The genetically modified rice yield was 452.7 kg / mu, which, although about 9.7% lower than under normal conditions, was 7.7% higher than the control under the same conditions. ​ and ​ + / H + The rice varieties with the same genetic makeup performed essentially the same as the control under salt stress conditions, showing no significant differences.

[0116] In summary, this invention utilizes seaweed ​ In ​ and ​ and seaweed ​ In ​ + / H + It was expressed in rice (Zhonghua 11), and the results of salt stress treatments during germination and seedling stages showed... ​ Overexpression of this compound can improve seed germination rate in rice under salt stress, increase chlorophyll content in seedlings under salt stress, reduce malondialdehyde content, increase SOD and APX enzyme activity, and maintain high K levels. + / Na + This invention improves the salt tolerance of rice. It provides a new approach for breeding crops to enhance their salt stress tolerance.

[0117] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments without creative effort, as shown in these embodiments, and these embodiments all fall within the protection scope of the present invention.

Claims

1. The application of the PyAPX gene or biomaterials overexpressing the PyAPX gene, characterized in that, The application includes any two of the following: 1) Improve crop salt tolerance; 2) Breeding salt-tolerant crops; The nucleotide sequence of the PyAPX gene is shown in SEQ ID NO:1; The crop in question is rice.

2. The application as described in claim 1, characterized in that, The improvement of crop salt tolerance includes one or more of the following six items: (1) Improve seed germination rate; (2) Increase the chlorophyll content in crops; (3) Reduce the content of malondialdehyde; (4) Increase SOD enzyme activity; (5) Increase APX enzyme activity; (6) Maintain K + / Na + level.

3. The application as described in claim 1, characterized in that, The salt-tolerant crop breeding involves overexpressing the PyAPX gene in crops to improve their salt tolerance and obtain salt-tolerant crops.

4. The application as described in claim 3, characterized in that, The overexpression step includes converting biological material overexpressing the PyAPX gene into crops to obtain crops with improved salt tolerance.

5. The application as described in claim 1, characterized in that, The biological material overexpressing the PyAPX gene includes one or more of primer pairs, recombinant vectors, and recombinant microorganisms that overexpress the PyAPX gene.

6. The application as described in claim 5, characterized in that, The primer pair includes PyAPX-F and PyAPX-R, the sequence of PyAPX-F is shown in SEQ ID NO:4, and the sequence of PyAPX-R is shown in SEQ ID NO:

5.

7. The application as described in claim 5, characterized in that, The base vector of the recombinant vector includes a plasmid vector; the plasmid vector includes the pCAMBIA1301 vector.

8. The application as described in claim 5, characterized in that, The initial microorganisms of the recombinant microorganisms include Agrobacterium strain GV3101.